MOTS‑c protects against placental injury via Nrf2 activation in hypoxia‑induced intrauterine growth restriction mice

Introduction

Intrauterine growth restriction (IUGR), also known as fetal growth restriction, is defined as a condition in which a fetus is small for gestational age (SGA) and falls below the 10th percentile for gestational age and sex. (1). In 2020, one in five newborns worldwide (23.4 million) were SGA, a condition linked to ~20% of term stillbirths (2). Maternal nutrition and stress during pregnancy, such as high-altitude pregnancy, smoking and preeclampsia, can lead to adverse effects (3,4). Among these, antenatal hypoxia-induced placental insufficiency has been identified as a primary risk factor for stillbirths, neonatal deaths and perinatal morbidity associated with IUGR (5-7). Antioxidant supplementation has been attempted to treat IUGR, but has not achieved success (8,9). Therefore, it remains crucial to discover new and efficacious treatments for IUGR.

The 16-amino acid mitochondria-derived peptide, MOTS-c, is synthesized by encoding a compact open reading frame located within the genomic sequence of the mitochondrial 12S ribosomal RNA gene (10). It has been reported that MOTS-c induces transcription of antioxidant genes and enhances cellular resistance to oxidative stress injury (11). Low plasma levels of MOTS-c are associated with endothelial mitochondrial dysfunction in patients with obesity and coronary artery disease (12,13). MOTS-c serves key roles in the onset and development of cardiovascular diseases, aging and age-related diseases (14,15). In addition, supplementation with MOTS-c inhibits oxidative stress in rotenone-induced neuron degeneration (13), diabetic cardiomyopathy (16) and diabetic nephropathy (17). However, the role of MOTS-c in hypoxia-induced IUGR remains unclear.

The placenta possesses a diverse range of antioxidant defense systems that effectively mitigate the accumulation of reactive oxygen species (ROS). Among these systems, the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway serves a pivotal role in governing oxidative stress-associated disorders (18). Nrf2 is typically bound to Kelch-like ECH-associated protein 1 (KEAP1) in the cytoplasm, but dissociates upon exposure to ROS and moves into the nucleus where it activates genes associated with antioxidant defense mechanisms (19). Furthermore, the KEAP1-Nrf2 pathway is also activated by aerobic exercise or MOTS-c (20). We previously demonstrated that MOTS-c could directly increase synthesis of Nrf2 independent of protein degradation and promote Nrf2 nucleus translocation (21,22). During pregnancy, Nrf2 protects the fetus from adverse oxidative stress conditions by ensuring proper placental function (23). Evidence suggests that Nrf2 deficiency leads to reduced fetal weight and placental volume (24). However, it remains unclear whether MOTS-c regulates oxidative stress in IUGR via activation of the Nrf2-mediated anti-oxidative pathway. The present study aimed to investigate whether MOTS-c alleviates hypoxia-induced placental restriction and IUGR by activating the Nrf2 signaling pathway.

Materials and methods

Animals

A total of 69 C57BL/6 wild-type mice (46 female and 23 male), aged 6-8 weeks, and weighing 18-20 g, were sourced from the Jiangnan University Laboratory Animal Center (Wuxi, China). Nrf2 knockout (KO) mice were obtained from the Model Animal Research Institute of Nanjing (Nanjing, China). These mice were housed in a specific pathogen-free facility environment, which maintained an ambient humidity of 50% and a temperature range of 22-25°C. The mice had free access to food and water and were subjected to a 12-h light-dark cycle managed by an automated light control system. All animal experiments were approved by the Animal Experimentation Ethics Committee of Jiangnan University [approval nos. 2 0220930m1080501(383) and 20231115m1080530(555)]. All animal experiments were performed in accordance with guidelines established by the International Association for the Assessment and Accreditation of Laboratory Animal Care (25) and the relevant laws of the National Research Council's Guide for the Care and Use of Laboratory Animals.

IUGR mouse model establishment and sample collection

Females were paired with males (with a total of 23 pairs) overnight for mating purposes, and the day of observation of a vaginal plug was designated as gestational day (GD) 0. The IUGR mouse model was established as previously reported (26,27) and as similarly described in our previous studies (28,29). Briefly, 17 pregnant mice were housed under hypoxic conditions (FiO2=0.105) from GD 11 to GD 17.5, which refers to IUGR group. The control group of pregnant mice were housed under normoxic conditions (FiO2=0.21) throughout pregnancy. To determine the protective effects of MOTS-c, randomly selected control and IUGR pregnant mice received intraperitoneal injections of 5 mg/kg MOTS-c once a day from GD 11 to 17.5 (10,30,31), which refers to the MOTS-c (n=6) and IUGR + MOTS-c groups (n=5), respectively. Meanwhile, control and IUGR mice were injected with an equivalent volume of physiological saline from GD 11 to 17.5, which refers to the normal group (n=6) and IUGR group (n=6) respectively. No suitable drug is presently available for use as a positive control in the treatment of hypoxia-induced IUGR (8,9), therefore, no positive control group was included.

To explore the protective mechanisms of MOTS-c, pregnant C57BL/6 mice and Nrf2 knockout (KO) mice were randomly divided into six groups: Normal (n=6), Nrf2−/− (n=4), IUGR (n=6), IUGR + MOTS-c (n=5), Nrf2−/− + IUGR (n=4), and Nrf2−/− + IUGR + MOTS-c (n=5). MOTS-c (5 mg/kg) was intraperitoneally injected daily from GD 11 to 17.5, with an equivalent volume of physiological saline injected as the loading control. On GD 17.5, each pregnant mouse was terminally anesthetized using pentobarbital sodium (50 mg/kg, intraperitoneally) as previously reported (32,33). The maternal blood was collected according to our previous study (34). Briefly, the mice were fixed in a supine position. After making a sternal incision, blood was collected by inserting a 26-G needle vertically through the second intercostal space into the heart, using a vacuum tube system. The blood was incubated at room temperature for 30 min, centrifuged at 105.45 × g for 10 min at 4°C and then the separated serum was used for the study. Finally, the mice were then euthanized via cervical dislocation, and death was confirmed by the absence of a heartbeat and cessation of breathing. After euthanizing the dams, caesarean section surgery was performed via hysterectomy as according to a previous study (35). Briefly, the abdomen was sterilized with 70% ethanol and an abdominal incision was made to retrieve the uterus, which was transferred onto a sterile gauze over a heating pad. Finally, the pups were extracted by incising the uterine wall and applying gentle pressure. Fetuses and placentas were then collected. The total number of fetuses were counted, and the weight of the fetuses and placentas were measured. The placental efficiency was calculated as follows: Placental efficiency (%)=(fetal weight/placental weight) × 100 (36). Fetal pups were anesthetized by inhalation of 2% isoflurane and sacrificed via cervical dislocation. Euthanasia was confirmed by the absence of heartbeat under the dissecting microscope, with the tissue appears pale. Placental tissues were collected for subsequent experiments; all collected samples were stored at −80°C until use.

Synthesis of MOTS-c peptides

The human MOTS-c peptide was synthesized by the Mimotopes Pty Ltd., using 9-fluorenylmethoxycarbonyl solid-phase chemistry in accordance with standard peptide synthesis protocols (37). The synthesized peptide had purity >95%, as determined through high-performance liquid chromatography by Mimotopes Pty Ltd. The amino acid sequence of MOTS-c was as follows: Met-Arg-Tr p-Gln-Glu-Met-Gly-Tyr-Ile-Phe-Tyr-Pro-Arg-Lys-Leu-Arg. The MOTS-c peptide was dissolved in distilled deionized water at a concentration of 1 mg/ml and stored at −20°C.

Histopathological staining

Placental tissues were fixed in a 4% paraformaldehyde solution at room temperature for 48 h, and embed in paraffin and sectioned (4-μm thick). The sections were stained with hematoxylin and eosin (cat. no. D006-1, Nanjing Jiancheng Bioengineering Institute). Briefly, the sections were stained with Harris's hematoxylin (0.1%) for 6 min, differentiated with 1% acid ethanol, rinsed and blued with tap water, following counterstaining with eosin Y (0.5-1%) for 1 min at room temperature. Images of placenta sections were captured using a Panoramic MIDI scanner (3DHISTECH Ltd.; magnification, ×20) and for each sample, ~10 images were acquired. Imaging and quantification were performed blinded. The area of the segmented blood sinusoid regions was quantified using the area measurement tool of the ImageJ software version 1.53k (National Institutes of Health). Data on the areas of blood sinusoids were statistically analyzed to calculate the means and standard deviation. The assessment of placental angiogenesis was performed by quantifying the sinusoidal areas.

Immunohistochemical staining

To detect intracellular antigens, the placental sections (4-μm thick) were deparaffinized at 65°C for 60 min and rehydrated using gradient alcohol. Antigen retrieval was performed using tris-EDTA buffer at 98°C for 25 min, followed by permeabilization with 0.1% Triton X-100 in PBS for 15 min at room temperature. To minimize non-specific binding, sections were blocked with 5% normal goat serum (cat. no. A7906; MilliporeSigma) for 2 h at room temperature. For HRP-based assays, endogenous peroxidases were quenched with 3% hydrogen peroxide in methanol for 15 min before blocking. The placental sections were then incubated with the primary antibodies against CD31 (1:100; cat. no. #77699s; Cell Signaling Technology) and MOTS-c (1:100; cat. no. #MOTSC-101AP; FabGennix International Inc.) overnight at 4°C. At room temperature, the samples were co-incubated with the corresponding fluorescence labeled secondary antibody (1:100; cat. no. 33106ES60; Shanghai Yeasen Biotechnology Co., Ltd.) for 60 min, and freshly prepared DAB (cat. no. #CW20695; CWBIO) staining was then performed. Finally, sections were counterstained with hematoxylin (cat. no. I030-1; Nanjing Jiancheng Bioengineering Institute), dehydrated and cleared. Images were captured using Panoramic MIDI (3D HISTECH Ltd.) and analyzed using the Panoramic Viewer software version 2.1 (3DHISTECH Ltd.).

Enzyme linked immunosorbent assay (ELISA)

MOTS-c content in the serum and placental tissues of the pregnant mice was quantified using an ELISA kit (cat. no #MM-46300M1; Jiangsu Meimian Industrial Co., Ltd.) following the manufacturer's guidelines.

Cell culture and treatments

The immortalized human umbilical vein endothelial cells (HUVECs) and human placental trophoblast cell (HTR-8/SVneo) were obtained from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. These cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; cat. no. 319-005-CL; Wisent, Inc.) enriched with 10% fetal bovine serum (FBS; cat. no. 40130ES76; Shanghai Yeasen Biotechnology Co., Ltd.) and 1% penicillin-streptomycin mixture (cat. no. C0222; Beyotime Institute of Biotechnology). Incubation conditions were set to a humidified atmosphere at 37°C and 5% CO2.

In investigating the effects of MOTS-c on hypoxia-induced HUVECs and HTR-8/SVneo cells, the cells were pre-treated with 10 μM MOTS-c under normoxic conditions (21% O2) or an equivalent volume of phosphate buffer saline (PBS), followed by modeling under hypoxic conditions for 48 h; the use of 1% O2 is a well-established model in the in vitro study of hypoxia-related diseases, and has been demonstrated to cause dysregulation of angiogenesis and proliferation in HUVECs as previously described (38). To mimic the abnormal angiogenesis under hypoxia exposure, HUVECs were exposed to an oxygen concentration of FiO2=0.01 for 48 h. The procedure for each experimental approach was standardized to ensure consistent operational steps and treatment conditions across three replicates. HUVECs and HTR-8/SVneo cells used were confined to those within the 3rd to 5th passages for experimental consistency and reliability. The experiment was independently repeated for three times.

To determine the role of Nrf2 in hypoxia-stimulated HUVECs, ML385 (cat. no. HY-100523; MedChemExpress), a specific Nrf2 inhibitor was used as previously reported (39). Briefly, HUVECs were stimulated with ML358 (5 μM) for 1 h, followed by administration with MOTS-c (10 μM) for 2 h and exposed to hypoxia (1% O2) for an additional 48 h.

Optical Microscopy

For morphological assessment, HUVECs were examined under a phase-contrast microscope equipped with a digital camera (DP11, Olympus), and images were documented.

Cell viability assay

Cell viability was evaluated by the Cell Counting Kit-8 (CCK-8) assay (cat. no. C0037; Beyotime Institute of Biotechnology). Cells were seeded at a density of 1×104 cells/well in 96-well plates. After rinsing with PBS, the cells were exposed to CCK-8 solution (1:10 dilution). The cells were incubated at 37°C for 2 h, and then the absorbance were measured at 450 nm using a microplate reader (BioTek; Agilent Technologies, Inc.).

Nrf2 overexpression in HUVECs

The Nrf2 overexpression plasmid was constructed and obtained from OBiO Technology (Shanghai) Corp., Ltd. Briefly, after reaching 80% confluence, the cells were transfected with pcDNA3.1 plasmid or Nrf2 overexpression plasmids (1 μg/ml) using a transfection reagent (cat. no. C10511-05; Guangzhou RiboBio Co., Ltd.) and cultured at 37°C and 5% CO2. After 24 h, the medium was changed and exposed to normoxic (21% O2) or hypoxic (1% O2) conditions for 48 h. Cells were then harvested for downstream analysis, with Nrf2 overexpression verification performed by reverse transcription-quantitative PCR (RT-qPCR).

Nrf2 siRNA transfection in HUVECs

Nrf2 siRNA was obtained from KeyGEN BioTECH. Briefly, after reaching 80% confluence, HUVECs cells were transfected with control siRNA (20 μM) or Nrf2 siRNA (20 μM) using a transfection reagent (cat. no. C10511-05; Guangzhou RiboBio Co., Ltd.) according to the manufacturer's instructions. After 12 h, the medium was changed and the cells were cultured for 36 h at 37°C and 5% CO2. Cells were then harvested for downstream analysis, with Nrf2 knockdown verification performed by RT-qPCR. The siRNA sequences used were as follows: Nrf2 sense (S), 5'-GCAGCAAACAAGAGAUGGCAAdTdT-3' and anti-sense (AS), 5'-UUGCCAUCUCUUGUUUGCUGCdTdT-3'; and negative control siRNA (vector-siRNA) S, 5'-UUCUCCGAACGUGUCACGUdTdT-3' and AS, 5'-ACGUGACACGUUCGGAGAAdTdT-3'.

ROS measurements

The ROS production in HUVECs and HTR-8/SVneo cells were assessed using 2',7'-dichlorodihydro fluorescein diacetate (DCFH-DA) diacetyldichlorofluorescein staining solution (1:1,000; cat. no. E004-1-1; Nanjing Jiancheng Bioengineering Institute) in the dark at 37°C for 15 min, and analyzed with a Zeiss fluorescence microscope (Zeiss AG). The mitochondrial ROS levels were assessed using MitoSOX (cat. no. #40778ES50; Shanghai Yeasen Biotechnology Co., Ltd.). The cells were treated with a MitoSOX working solution (5 mM) at 37°C for 20 min. Then, the ROS fluorescence intensity was visualized using a confocal microscope (Zeiss AG).

Immunofluorescence staining

For Nrf2 immunofluorescence staining in HUVECs, cells were fixed with 100% methanol for 15 min at −20°C, followed by permeabilization with 0.1% Triton X-100 for 10 min and blocked with 1% bovine serum albumin (BSA) (cat. no. HY-D0842; MedChemExpress) for 60 min at room temperature. The cells were then incubated with Nrf2 antibody (cat. no. #ab62352; Abcam) at 1/100 dilution overnight at 4°C followed by a further incubation with Alexa 488-conjugated secondary antibody (1:200; cat. no. 33103ES60; Shanghai Yeasen Biotechnology Co., Ltd.) at room temperature for 1 h. The Nrf2 antibody specificity was validated by Nrf2 siRNA knockdown (Fig. S1). The nuclei were labelled with DAPI solution (1 mg/ml; cat. no. #P0131; Beyotime Institute of Biotechnology) for 10 min at room temperature. Images were captured using a confocal microscope.

For Ki-67 and Nrf2 immunofluorescence staining in placental tissues, the sections were permeabilized with 0.1% Triton X-100 for 10 min and blocked with 5% BSA (cat. no. HY-D0842; MedChemExpress) for 2 h at room temperature. The samples were incubated with primary antibodies anti-Ki-67 (1:100; cat. no. #9129; Cell Signaling Technology, Inc.) and anti-Nrf2 (1:100; cat. no. #62352; Abcam) overnight at 4°C, followed by incubation with secondary antibodies conjugated to Alexa Fluor 488 (cat. no. #33103ES60; 1:200; Shanghai Yeasen Biotechnology Co., Ltd.) or Alexa Fluor 594 (cat. no. #33112ES60; 1:200; Shanghai Yeasen Biotechnology Co., Ltd.). Subsequently, the nuclei were stained with DAPI (1 μg/ml; cat. no. HY-D1738; MedChemExpress) for 5 min at room temperature. Images were acquired using a Zeiss Axio Imager 2 fluorescent microscope (Carl Zeiss AG). The number of immunoreactivity positive cells was quantified as the percentage of total cells. All samples were blinded during imaging and quantification.

Tube formation assay

Matrigel (50 μl; cat. no. #082704; Shanghai Nova Pharmaceutical Technology Co., Ltd) was added to each well of 96-well plates and allowed to solidify in a cell incubator at 37°C with 5% CO2 for 60 min. Next, 3×104 HUVECs in 100 μl of DMEM containing 5% fetal bovine serum (cat. no. 40130ES76; Shanghai Yeasen Biotechnology Co., Ltd.) and 1% penicillin-streptomycin (cat. no. C0222; Beyotime Institute of Biotechnology). were added to each well. After 6 h of incubation, tubular structures were examined and visualized using a Zeiss Axio Imager 2 fluorescent microscope (Carl Zeiss AG), and the tube lengths were quantified using ImageJ software version 1.53k (National Institutes of Health). The angiogenic capability was quantified by measuring the number of tubes and the mean mesh size per field from three randomly selected fields per well.

L-lactate dehydrogenase (LDH), superoxide dismutase activity (SOD) and malondialdehyde (MDA) content

LDH concentration, SOD activity and the MDA content were quantified in the serum of pregnant mice and HUVECs using kits from Nanjing Jiancheng Bioengineering Institute (LDH kit, cat. no. A020-2; SOD kit, cat. no. A001-3-2: MDA kit, cat. no. A003-1-2) following the manufacturer's protocols.

Determination of mitochondrial membrane potential (MMP)

The MMP was assessed using JC-1 dye (Beyotime Institute of Biotechnology). Briefly, JC-1 dye added to the cell suspension to achieve a final dye concentration of 10 μM. The cells were incubated with the JC-1 dye mixture at 37°C for 15 min to allow the dye to enter the cells and accumulate in the mitochondria. JC monomers (488 nm) and JC aggregates (570 nm) were visualized using a fluorescence microscope (Olympus Corporation), and images were acquired from a random selection of 3-4 fields per well.

Western blotting

Placentas and HUVEC cells were lysed using RIPA buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) containing with protease and phosphatase inhibitors (cat. no. P1045; Beyotime Institute of Biotechnology). Nuclear and cytoplasmic extracts from placental tissues were prepared using a Nuclear Extraction Kit (cat. no. W037-1-1; Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions. The protein concentrations were determined according to the manufacturer instructions using a BCA Protein Assay kit (cat. no. P0009; Beyotime Institute of Biotechnology). Subsequently, the lysates were separated on 8 and 10% SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (cat. no. P2938; MilliporeSigma; Merck KGaA). Following a 2 h blocking step at room temperature with 5% BSA (cat. no. HY-D0842; MedChemExpress) in Tris-buffered saline, the membranes were incubated overnight at 4°C with primary antibodies targeting CD31 (1:1,000; cat. no. 77699s; Cell Signaling Technology, Inc.), vascular endothelial growth factor receptor 2 (VEGFR2; 1:1,000; cat. no. 26415-1-AP; Proteintech), vascular endothelial growth factor A (VEGFA; 1:1,000; cat. no. 66828-1-Ig; Proteintech), Nrf2 (1:1,000; cat. no. 62352; Abcam) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5,000; cat. no. 263962; Abcam). After washing, the membranes were incubated with secondary antibodies for 2 h at room temperature (Goat Anti-Mouse IgG, 1:5,000; cat. no. CW0102S; Goat Anti-Rabbit IgG, 1:5,000; cat. no. CW0103S; Jiangsu CoWin Biotech Co., Ltd.) corresponding to the primary antibody source. Protein bands were visualized using a ChemiDocTM XRS Plus luminescence image analyzer (Bio-Rad Laboratories, Inc.) with an ECL system (MilliporeSigma; Merck KGaA), and quantified using ImageJ software version 1.53k (National Institutes of Health).

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR)

Total RNA from the placental tissue was extracted using TRIzol Reagent (cat. no. R401; Vazyme Biotech Co., Ltd.) and then reverse-transcribed into complementary DNA using a PrimeScript RT Reagent Kit (cat. no. R323; Vazyme Biotech Co., Ltd.) according to the manufacturer's protocol. Target mRNA amplification was measured using SYBR Premix Ex Taq™ (cat. no. 11201ES08; Shanghai Yeasen Biotechnology Co., Ltd.) with a LightCycler® 480 detection PCR system (Roche Diagnostics). The PCR amplification protocol consisted of an initial denaturation step at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 55°C for 20 sec and extension at 72°C for 20 sec. Quantification was performed employing the 2−ΔΔCq method (40), with GAPDH serving as the reference gene. The primer sequences are provided in Table I.

Table I Primers for reverse-transcription quantitative PCR analysis.

Table I

Primers for reverse-transcription quantitative PCR analysis.

A, Mouse primers
Gene	Sequence (5'-3')
Pgf	F: AGTGGAAGTGGTGCCTTTCAA
	R: GTGAGACACCTCATCAGGGTA
Fatp4	F: ACTGTTCTCCAAGCTAGTGCT
	R: GATGAAGACCCGGATGAAACG
Glut1	F: TCAAACATGGAACCACCGCTA
	R: AAGAGGCCGACAGAGAAGGAA
Snat2	F: GGGACATAAGGCGTATGGTCT
	R: GGTAGCTTGACATAGCCCCAA
Igf2	F: CGTGGCATCGTGGAAGAGT
	R: ACGTCCCTCTCGGACTTGG
Nrf2	F: TCTTGGAGTAAGTCGAGAAGTGT
	R: GTTGAAACTGAGCGAAAAAGGC
Gapdh	F: AGGTCGGTGTGAACGGATTTG
	R: GGGGTCGTTGATGGCAACA
B, Human primers
Gene	Sequence (5'-3')
VEGFA	F: AGGGCAGAATCATCACGAAGT
	R: AGGGTCTCGATTGGATGGCA
VEGFR2	F: GGCCCAATAATCAGAGTGGCA
	R: CCAGTGTCATTTCCGATCACTTT
CD31	F: CCAAGGTGGGATCGTGAGG
	R: TCGGAAGGATAAAACGCGGTC
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
	R: GGCTGTTGTCATACTTCTCATGG

[i] F, forward; R, reverse; Pgf, placental growth factor; Igf2, insulin-like growth factor 2; Glut1, glucose transporter type 1; Fatp4, fatty acid transporter 4; Snat2, sodium-dependent neutral amino acid transporter-2; VEGFA, vascular endothelial growth factor A; VEGFR2, VEGF receptor 2; Nrf2, nuclear factor erythroid 2-related factor 2.

Statistical analyses

Statistical data are depicted as means ± standard deviation. The D'Agostino-Pearson test and Shapiro-Wilk test were used for normality tests. For quantitative data obeying normal distribution, comparisons between two groups were performed using Student's unpaired two-tailed t-test. To compare among ≥3 groups, the Brown-Forsythe analysis was used to test for homogeneity of variance, if the variance was homogeneous, the Tukey's test of one-way analysis of variance was used. If variances were not homogeneous, Dunnett's T3 test was used to test for differences between multiple groups. The association between different targets was analyzed using Pearson's correlation test. Analyses were performed using the GraphPad Prism software (version 8.0.2; Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

Results

Decreased levels of MOTS-c in the serum and placenta of pregnant mice is associated with reduced fetal weight and lower placental vascular density

Exposure to hypoxia during pregnancy led to significant fetal growth restriction (Fig. 1A), evidenced by reduced fetal body weight and diminished placental efficiency (the fetal-to-placental weight ratio; Table II). Additionally, the blood sinus areas within the placenta were significantly reduced in IUGR mice (Fig. 1B and C). The expression levels of CD31, a vascular marker, were significantly lower in the placenta of IUGR mice compared with that of the Controlgroup (Fig. 1D and E). These findings suggested a reduction in placental vascular density following antenatal maternal hypoxia exposure. MOTS-c content was significantly reduced in both maternal serum and placenta after hypoxic exposure (Fig. 1F and G), further validated by immunohistochemistry of placental tissues, with 34.8% reduction of MOTS-c positive cells in IUGR mice when compared with the control group (Fig. 1H and I). Furthermore, placental MOTS-c levels exhibited a positive correlation with fetal mouse weight (R2=0.4010; P=0.0382; Fig. 1J). These data suggested that the decreased fetal weight and placental vascular density resulting from antenatal maternal hypoxia may be associated with reduced MOTS-c content.

Figure 1 Decreased MOTS-c expression levels are associated with low fetal weight in hypoxia-induced IUGR mice. (A) Morphology of normal and IUGR fetal mice on GD17.5. (B) Representative images of H&E staining of placental tissues. Scale bar, 20 μm. (C) Quantification of placental blood sinus area. (D) Representative IHC images of CD31. Scale bar, 50 μm. (E) Quantification of the CD31 positive area of IHC images. (F) Maternal serum MOTS-c content and (G) Placental MOTS-c content. (H) Representative IHC images of MOTS-c in placenta. Scale bar, 100 μm. (I) Quantification of the MOTS-c positive area of IHC images. (J) Pearson's correlation coefficient analysis of the MOTS-c content with fetal mouse weight. Data are expressed as the mean ± SD, n=6. ***P<0.001 vs. Control. IUGR, intrauterine growth restriction; GD, gestational day; IHC, immunohistochemistry.

Table II Descriptive statistics of dams and fetuses exposed to hypoxia.

Table II

Descriptive statistics of dams and fetuses exposed to hypoxia.

Characteristic	Normal	IUGR	P-value
Maternal body weight, g	31.9±1.1	29.6±1.3a	0.0087
Litter size	7.6±1.4	7.4±1.6	0.8626
Litter parameters, n	53	52
Fetal weight (g)	0.90±0.085	0.49±0.075b	<0.0001
Crown-rump length (mm)	8.6±0.4	8.0±0.4	0.0333
Placenta, n	53	52
Placenta weight (g)	0.0772±0.0102	0.0836±0.00790	0.2954
Fetal/weight ratio	11.8±2.0	6.0±1.2b	0.0001

a P<0.01;

b P<0.001. Data are presented as mean ± SD. IUGR, intrauterine growth restriction.

MOTS-c promotes placental angiogenesis and increased fetal weight in IUGR mice

To assess the potential benefits of MOTS-c supplementation on fetal growth, synthetic MOTS-c peptide was administered intraperitoneally. The timeline of this experimental study is schematically presented in Fig. 2A. This intervention resulted in a significant increase in maternal serum and placental MOTS-c content, as showed in Fig. S2A-D. When compared with that of the normal group, the MOTS-c group mice showed no significant differences in fetal growth, as indicated by normal size, morphology and fetal weight (Fig. S3A and B), fetal weight of the MOTS-c group remained normal for up to 4 weeks after birth (Fig. S3C). Therefore, subsequent investigations focused solely on the effects of MOTS-c on IUGR mice. MOTS-c administration significantly improved fetal development, with increased fetal size and fetal weight compared with that of the IUGR group (Fig. 2B and C). Furthermore, the ratio of fetal to placental weight was significantly increased following MOTS-c administration in the IUGR mice compared with the untreated IUGR mice (Fig. 2D). In addition, MOTS-c administration significantly improved blood sinus areas (Fig. 2E and F) and upregulated CD31 expression in the placenta in the IUGR + MOTS-c group compared with that of the IUGR group (Fig. 2G and H). These findings suggested beneficial effects of MOTS-c treatment against hypoxia-induced poor placental vascular density and subsequent fetal development. As the VEGF pathway is recognized as a major regulatory mechanism governing developmental angiogenesis (41), the expression levels of VEGFA and VEGFR2 were investigated. The protein expressions levels of VEGFA and VEGFR2 were decreased in placental tissues following hypoxic exposure in the IUGR group, while in comparison, MOTS-c treatment significantly upregulated the VEGF pathway in the IUGR + MOTS-c group (Fig. 2I). These results suggested that MOTS-c improved hypoxia-induced IUGR by promoting placental angiogenesis.

Figure 2 MOTS-c administration protects against hypoxia-induced fetal growth restriction. (A) Schematic timeline of the experimental setup. (B) Morphology of fetal mice on GD17.5. (C) Mean fetal weights within each litter. (D) Placental efficiency, which represents the ratio of fetal to placenta weight. (E) Representative images of H&E staining of placental tissues. Scale bar, 20 μm. (F) Quantification of placental blood sinus area. (G) Representative IHC images CD31. Scale bar, 50 μm. (H) Quantification of CD31 positive area. (I) Western blotting analysis of CD31, VEGFA and VEGFR2 protein expression in placenta. Data are expressed as the mean ± SD. Normal, n=6; IUGR, n=6; IUGR + MOTS-c, n=5. **P<0.01 vs. normal, ***P<0.001 vs. normal; #P<0.05 vs. IUGR; ##P<0.01 vs. IUGR; ###P<0.001 vs. IUGR. IUGR, intrauterine growth restriction; GD, gestational day; VEGFA, vascular endothelial growth factor A; VEGFR2, VEGF receptor 2.

Increased cell proliferation and upregulation of mRNA expression of nutrient transporter genes in placental tissues are associated with MOTS-c treatment

To investigate the role of MOTS-c on cell proliferation in placenta subjected to IUGR, placental tissues of the normal, IUGR and IUGR + MOTS-c group mice were stained with Ki-67, a marker for cell proliferation, and the number of positive cells was quantified. The concentration of Ki-67-positive cells were significantly decreased in hypoxia-exposed placental tissues compared with that in the normal group, which was subsequently reversed by MOTS-c administration (Fig. 3A and B). Furthermore, the mRNA expression levels of placental growth factor (Pgf), sodium-dependent neutral amino acid transporter-2 (Snat2), glucose transporter type 1 (Glut1), insulin-like growth factor 2 (Igf2) and fatty acid transporter 4 (Fatp4) in placental tissues were assessed. Hypoxia exposure resulted in the downregulation of placental growth factors (Pgf and Igf2), as well as placental nutrient transport-related genes (Glut1, Fatp4 and Snat2) in the IUGR group; MOTS-c treatment in the IUGR + MOTS-c group significantly increased the mRNA expression levels when compared with that in the IUGR group (Fig. 3C). These findings suggested that MOTS-c treatment exerted a beneficial effect on placental proliferation defects in hypoxic environments.

Figure 3 Administration of MOTS-c improves placental injury. (A) Representative immunofluorescence images of Ki-67 in placental tissues. Scale bar, 10 μm. (B) Qualification of Ki-67 positive cells. (C) Relative mRNA expression levels of Pgf, Igf2, Glut1, Fatp4 and Snat2 in placenta. Data are expressed as the mean ± SD. Normal, n=6; IUGR, n=6; IUGR + MOTS-c, n=5. *P<0.05 vs. normal, **P<0.01 vs. normal, ***P<0.001 vs. normal; #P<0.05 vs. IUGR; ##P<0.01 vs. IUGR; ###P<0.001 vs. IUGR. IUGR, intrauterine growth restriction; Pgf, placental growth factor; Igf2, insulin-like growth factor 2; Glut1, glucose transporter type 1; Fatp4, fatty acid transporter 4; Snat2, sodium-dependent neutral amino acid transporter-2.

MOTS-c mitigates hypoxia-mediated oxidative stress in the placenta tissue

MOTS-c administration effectively mitigated oxidative stress-induced damage in placental tissues, as evidenced by a significant reduction in MDA levels and an increased SOD activity in the IUGR + MOTS-c group compared with that of the IUGR group (Fig. 4A and B). Nrf2, which upregulates the expressions of numerous antioxidant genes, serves a key role in inhibiting oxidative stress in the placenta (42). Maternal hypoxia exposure resulted in significantly decreased Nrf2 mRNA expression levels in the placenta of the IUGR group, while MOTS-c treatment restored Nrf2 mRNA expression levels in the IUGR + MOTS-c group (Fig. 4C). Furthermore, total, nuclear and cytoplasmic Nrf2 protein expression levels were also examined. Hypoxia restricted Nrf2 nuclear translocation, while MOTS-c significantly increased nuclear Nrf2 expression in placental tissues (Fig. 4D-G). The accumulation and nuclear translocation of Nrf2 was also detected by immunofluorescence, which demonstrated that in the IUGR + MOTS-c group, MOTS-c treatment promoted Nrf2 nuclear translocation compared with that in the IUGR group (Fig. 4H and I). In addition, MOTS-c treatment was associated with increased mRNA expression levels of heme oxygenase 1 and NAD(P)H quinone dehydrogenase 1, which are known Nrf2 downstream targeted anti-oxidative genes (Fig. 4J). These results suggest that MOTS-c activate Nrf2-mediated antioxidant pathway.

Figure 4 MOTS-c mitigates hypoxia-mediated oxidative stress in placenta. (A) MDA content in placenta. (B) SOD activity in placenta. (C) Nrf2 mRNA expression levels in placenta. (D) Representative western blotting images. (E) Total Nrf2 expression in placental tissues. (F) Nuclear Nrf2 expression in placental tissues. (G) Nrf2 expression in cytoplasm of placental tissues. (H) Representative immunofluorescence images and (I) quantification of Nrf2 in placenta. Scale bar, 50 μm. (J) Relative mRNA expression levels of HO-1 and NQO-1. Data are expressed as the mean ± SD. Normal, n=6; IUGR, n=6; IUGR + MOTS-c, n=5. *P<0.05 vs. normal, **P<0.01 vs. normal, ***P<0.001 vs. normal; #P<0.05 vs. IUGR; ##P<0.01 vs. IUGR; ###P<0.001 vs. IUGR. IUGR, intrauterine growth restriction; SOD, superoxide dismutase; MDA, malondialdehyde; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase 1; NQO-1, NAD(P)H quinone dehydrogenase 1.

MOTS-c treatment attenuates hypoxia-induced injury in HUVEC cells

To elucidate the effects of MOTS-c on HUVECs, MOTS-c (10 μM) was used for subsequent in vitro assays, according to the CCK-8 results (Fig. S4A), since MOTS-c (20 and 40 μM) resulted in significantly decreased cell viability. It was demonstrated that MOTS-c content significantly decreased after hypoxic stimuli compared with HUVECs in normoxic conditions, which was consistent with the in vivo results. Exogenous MOTS-c (10 μM) significantly increased the MOTS-c content in hypoxia-induced HUVECs compared with that in the hypoxia group. (Fig. 5A). MOTS-c administration restored hypoxia-induced abnormal morphology in HUVECs (Fig. 5B) and significantly increased tube formation of HUVECs (Fig. 5C and D) compared with that in the hypoxia group. Furthermore, MOTS-c treatment increased mRNA expression levels of CD31, VEGFA and VEGFR2 under hypoxic conditions in HUVECs compared with that in the hypoxia group (Fig. 5E). In addition, MOTS-c treatment promoted proliferation in hypoxia-exposed HUVECs, as evidenced by the significantly increased levels of Ki-67 positive cells under MOTS-c treatment compared with the control group (Fig. S4B and C). These results suggested that MOTS-c mitigated hypoxia-induced injury and promoted angiogenesis and proliferation in HUVECs.

Figure 5 MOTS-c exposure promotes angiogenesis in HUVECs. (A) MOTS-c content in HUVECs. (B) Cell morphology under white light. Scale bar, 200 μm. (C) Representative images and (D) quantitative analysis of the in vitro tube formation. Scale bar, 10 μm. (E) Relative mRNA expression levels of CD31, VEGFA and VEGFR2 in HUVECs. Results are representative of three independent experiments. Data are expressed as mean ± SD, n=4. *P<0.05, **P<0.01, ***P<0.001; #P<0.05 vs. PBS under hypoxic conditions, ##P<0.01 vs. PBS under hypoxic conditions. VEGFA, vascular endothelial growth factor A; VEGFR2, VEGF receptor 2.

It was further investigated whether MOTS-c functions in other cell types in the placenta; placental trophoblast cells are critically important for pregnancy and embryonic development (43). Thus, human placental trophoblast cells (HTR-8/SVneo) was also examined. MOTS-c treatment significantly increased cell viability reduced cell injury and enhanced the mRNA levels of nutrient transporter genes, including Pgf, Igf2, Glut1, Fatp4 and Snat2 (Fig. S5A-C). Furthermore, MOTS-c treatment significantly reduced ROS production in hypoxia-stimulated HTR-8/SVneo cells compared with that of the PBS treated HTR-8/SVneo cells under hypoxic conditions (Fig. S5D and E). These results indicated that the beneficial effects of MOTS-c against hypoxia was not limited to HUVECs.

MOTS-c treatment increased Nrf2 nuclear translocation and attenuated mitochondrial injury in HUVECs

The antioxidant effect of MOTS-c treatment was also examined in HUVECs. Intracellular ROS production was assessed using DCFH-DA staining, which demonstrated that MOTS-c treatment significantly suppressed the hypoxia-induced ROS generation compared with that of PBS-treated hypoxic cells (Fig. 6A). Furthermore, MOTS-c treatment under hypoxic conditions resulted in significantly reduced MDA content and restored SOD activity in HUVECs compared with that of PBS-treated hypoxic cells (Fig. 6B and C). Additionally, mitochondrial ROS levels were evaluated using MitoSOX staining, which similarly demonstrated that MOTS-c treatment significantly inhibited hypoxia-induced mitochondrial ROS generation compared with that of PBS-treated hypoxic cells (Fig. 6D). Concurrently, MMP levels was assessed using JC-1 staining, which demonstrated that MOTS-c significantly reduced MMP levels in hypoxic HUVECs compared with untreated cells (Fig. 6E). Consistent with the present in vivo findings, MOTS-c treatment promoted Nrf2 nuclear translocation in hypoxia-induced HUVECs (Fig. 6F and G). These findings suggested that MOTS-c exerted its protective effects, at least in part, through enhanced Nrf2 activity and by mitigating mitochondrial injury in hypoxia-induced HUVECs.

Figure 6 MOTS-c exposure attenuates oxidative stress in HUVECs. (A) Relative intensity of DCFH-DA staining. (B) Cellular SOD activity. (C) Cellular MDA content. (D) Representative images of MitoSOX staining. Scale bar, 10 μm. (E) Representative images of JC-1 staining. Scale bar, 50 μm. (F) Representative immunofluorescence images of Nrf2 in HUVECs. Scale bar, 5 μm. (G) Relative nuclear to cytoplasm fluorescence ratio. Results are representative of three independent experiments. Data are expressed as the mean ± SD, n=4. ***P<0.001, #P<0.05 vs. PBS under hypoxic conditions, ##P<0.01 vs. PBS under hypoxic conditions; ###P<0.001 vs. PBS under hypoxic conditions. SOD, superoxide dismutase; MDA, malondialdehyde; DCFH-DA,2'7'-dichlorodihydro fluorescein diacetate ; Nrf2, nuclear factor erythroid 2-related factor 2.

Nrf2 inhibitor ML385 offsets the protective effect of MOTS-c against hypoxia in HUVECs

To investigate whether Nrf2 serves a role in the protective effects of MOTS-c against hypoxia in HUVECs, ML385, a specific Nrf2 inhibitor was used (39). It was demonstrated that pretreatment with ML385 under hypoxic conditions inhibited tube formation compared with the hypoxia group, implying the significance of Nrf2. MOTS-c treatment, upon co-administration of ML385 in hypoxia-induced HUVECs, failed to promote tube formation (Fig. 7A and B). Additionally, pretreatment with ML385 under hypoxic conditions increased ROS production compared with the hypoxia group, and MOTS-c did not reduce the generation of ROS in ML385-pretreated HUVECs under hypoxic stimuli (Fig. 7C and D). These findings suggested that the protective effect of MOTS-c against hypoxia-induced HUVECs injury in HUVECs may partially rely on Nrf2 activation.

Figure 7 Nrf2 inhibitor ML385 offset the protective effect of MOTS-c against hypoxia-induced dysregulated angiogenesis and oxidative stress in HUVECs. (A) Representative images and (B) quantitative analysis of the in vitro tube formation. Scale bar, 10 μm. (C) Representative images of DCFH-DA staining and (D) quantification of cellular ROS. Scale bar, 50 μm. Results are representative of three independent experiments. Data are expressed as the mean ± SD. *P<0.05, **P<0.01. NS, not significant; DCFH-DA,2',7'-dichlorodihydro fluorescein diacetate; Nrf2, nuclear factor erythroid 2-related factor 2.

Nrf2 overexpression fails to enhance the beneficial effect of MOTS-c on hypoxia-stimulated HUVECs

In addition to Nrf2 inhibition, the effects of Nrf2 overexpression on hypoxia-exposed HUVECs was also determined. Under hypoxic conditions, Nrf2 overexpression significantly increased Nrf2 mRNA expression levels in HUVECs compared with control cells, which indicated the efficiency of the Nrf2 transfection (Fig. 8A). Nrf2 overexpression significantly enhanced cell viability under hypoxic conditions. However, there was no significant difference between the Nrf OE and MOTS-c + Nrf2 OE groups under hypoxic stimuli (Fig. 8B). In addition, Nrf2 overexpression markedly reduced ROS production under hypoxic conditions, and Nrf2 overexpression failed to further inhibit ROS generation in MOTS-c treated HUVECs under hypoxic conditions (Fig. 8C and D).

Figure 8 Nrf2 overexpression does not enhance the beneficial effects of MOTS-c on hypoxia-stimulated HUVECs. (A) Relative Nrf2 mRNA expression levels. (B) Cell viability. (C). Representative images of DCFH-DA staining and (D) quantification of cellular ROS. Scale bar, 10 μm. Data are expressed as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001, #P<0.05, ##P<0.01. NS, not significant; Nrf2, nuclear factor erythroid 2-related factor 2; ROS, reactive oxygen species; OE, overexpression; DCFH-DA, 2',7'-dichlorodihydro fluorescein diacetate.

MOTS-c protects against hypoxia-induced placental insufficiency in an Nrf2-dependent manner

To further investigate the role of Nrf2 in the protective effects of MOTS-c against hypoxia-induced IUGR and placental insufficiency, Nrf2−/− pregnant mice were exposed to hypoxic conditions for further investigation. Placental tissues from Nrf2−/− mice exhibited no Nrf2 protein expression (Fig. S6A and B). MOTS-c treatment did not affect fetal growth restriction in Nrf2 deficiency mice, as evidenced by unchanged fetal size, morphology and the fetal to placenta weight ratio in Nrf2−/− pregnant mice when compared with the hypoxia-treated Nrf2−/− pregnant mice (Fig. 9A and B). Notably, MOTS-c administration failed to enhance the blood sinus areas (Fig. 9C and D) and did not upregulate the protein expressions of CD31, VEGFA and VEGFR2 in Nrf2−/− mice (Fig. 9E). Additionally, MOTS-c supplementation did not impact the mRNA expressions of placental growth factors, including Pgf and Igf2 in Nrf2−/− mice. However, MOTS-c upregulated the expression levels of placental nutrient transport-related genes, such as Glut1, Fatp4 and Snat2, in Nrf2−/− mice (Fig. 9F). This suggested that the beneficial effects of MOTS-c on placental nutrient transport-related genes might be independent of Nrf2.

Figure 9 MOTS-c protects against hypoxia-induced placental insufficiency in an Nrf2-dependent manner. (A) Morphology of fetal mice on GD17.5 in WT and Nrf2 KO mice. (B) Placental efficiency, which represents the ratio of fetal to placenta weight. (C) Representative images of H&E staining of placental tissues. Scale bar, 100 μm. (D) Quantification of the placental blood sinus area. (E) Western blotting analysis of CD31, VEGFA and VEGFR2 protein expression levels in placenta. (F) Relative mRNA expression levels of Pgf, Igf2, Glut1, Fatp4 and Snat2 in placenta. Data are expressed as mean ± SD. n=4-6. *P<0.05 vs. normal, **P<0.01 vs. normal, ***P<0.001 vs. normal, #P<0.05 vs. IUGR, ###P<0.001 vs. IUGR.. NS, not significant; IUGR, intrauterine growth restriction; GD, gestational day; Pgf, placental growth factor; Nrf2, nuclear factor erythroid 2-related factor 2; Igf2, insulin-like growth factor 2; Glut1, glucose transporter type 1; Fatp4, fatty acid transporter 4; Snat2, sodium-dependent neutral amino acid transporter-2; VEGFA, vascular endothelial growth factor A; VEGFR2, VEGF receptor 2.

Discussion

IUGR is characterized by a fetus that is small for gestational age. A study of 600,000 stillbirths (≥22 weeks) from 12 countries reported that being small for gestational age contributed to ~20% of term stillbirths (2). However, there is currently no effective treatment for IUGR. The present study investigated the effects of MOTS-c peptides on hypoxia-induced IUGR, and demonstrated that MOTS-c administration significantly mitigated hypoxia-induced IUGR, promoted placental angiogenesis, suppressed oxidative stress and ameliorated placental injury both in vivo and in vitro. Furthermore, the protective effects of MOTS-c were shown to be Nrf2-dependent, as the protective effect of MOTS-c were abolished not only in Nrf2 inhibitor treated HUVECs, but also in Nrf2 KO mice. To the best of our knowledge, the present study is the first to demonstrate that MOTS-c treatment could attenuate hypoxia-induced IUGR, and thus suggest a new strategy for treating hypoxia-related neonatal disease.

Prenatal hypoxia, a common consequence of complicated pregnancies, serves a key role in triggering IUGR (44,45). In such cases, the placenta fails to adequately supply oxygen and nutrients to the developing fetus, resulting in low birth weight (LBW) (7). Normal development of the placental vascular tree is essential for both proper placental growth and nutrient delivery from mother to fetus. Studies have reported impaired angiogenesis in placental tissues of infants with LBW (46,47), which has been identified as an important pathophysiologic contributor to IUGR. VEGFA and its receptor VEGFR2 are vital for blood vessel development and their reduction has been observed in LBW placentas (48). Higher expression of the NADPH oxidase 2 and lower vessel density were found in LBW placentas, as NADPH oxidase 2 inhibited VEGFA-mediated placental angiogenesis (49). Dietary supplementation with adenosine has been shown to enhance placental angiogenesis and reduce the incidence of IUGR in piglets (50). Therefore, improving placental angiogenesis appears crucial for alleviating IUGR. Consistent with this notion, the present study demonstrated that MOTS-c treatment accelerated the formation of placental blood vessels in IUGR by increasing blood sinus areas and upregulating angiogenesis-related markers CD31 and VEGF. In addition, increased Ki-67 positive cells in both placental tissues and hypoxia-exposed HUVECs were observed. Ki-67 is widely considered a marker of proliferation, which is mainly expressed during the active phases of the cell cycle: G1, S, G2 and mitosis (51). However, low amounts of Ki-67 may also be detected in quiescent cells (52). The present study found positive Ki-67 signals peripheral to DAPI staining in placental tissues, while the Ki-67 signal was totally located in the nucleus of HUVECs. The observed extra-nuclear Ki-67 immunofluorescence signal in tissues is a well-documented phenomenon as reported in previous studies (53,54). It was considered that the apparent peripheral signal potentially reflected different cell type and cell cycle stages. Furthermore, MOTS-c was injected intraperitoneally from GD 11 to 17.5, and beneficial effects of MOTS-c administration on maintaining placenta angiogenesis and proliferation, attenuating placental insufficiency, and subsequently alleviating IUGR were observed. The timing of the experiment was aligned with prior work, in which MOTS-c was administered concurrently with the induction of the disease model (10,30,31,55).

The placenta is highly susceptible to oxidative stress, which in turn triggers placental vascular dysfunction and insufficiency (56). Oxidative stress in the placenta is a major contributor to the development of IUGR. Elevated levels of MDA and decreased catalase activity have been observed in plasma and placental tissues of pregnancies with IUGR (57). Therefore, restoring redox homeostasis through antioxidant therapy would be an effective treatment for these pregnancy complications (58). However, a previous clinical trial showed limited success in using antioxidant therapy for hypoxic pregnancy (59,60). Therefore, further investigation into alternative treatment options for IUGR is warranted. The present study found that that administration of MOTS-c reduced MDA content and increased SOD activity in placental tissues. The in vitro experiments demonstrated a decrease in ROS generation after MOTS-c treatment in hypoxia-induced HUVECs, which indicated the anti-oxidative stress effects of MOTS-c. Dysfunctional mitochondria are another source of ROS overproduction in individuals with IUGR (61). The present study demonstrated that MOTS-c treatment reduced MMP levels and inhibited mitochondria ROS generation, which suggested a protective role of MOTS-c on mitochondrial function. These results indicated that MOTS-c ameliorated mitochondrial dysfunction and restored antioxidant enzymes, thereby reducing ROS generation and alleviated placental insufficiency in IUGR.

The transcription factor Nrf2 serves a crucial role in coordinating the cellular antioxidant defense system, regulating the expression of >100 genes involved in oxidative stress responses and detoxification processes (62,63). The activation of Nrf2 is suggested to be a compensatory mechanism that safeguards the fetus against oxidative damage. A previous study reported that in both human and rat IUGR groups, placentas had lower Nrf2 expression levels compared with that of the control group placentas (64). Similarly, the downregulation of Nrf2 was found in placental tissues from patients with eclampsia (65). The present study similarly demonstrated downregulated expression of Nrf2, especially the reduced nuclear Nrf2 expression in hypoxia-induced maternal placenta compared with the normal group of mice, and that MOTS-c administration increased Nrf2 nuclear accumulation compared with the IUGR group. Cytoplasmic and nuclear Nrf2 protein expressions were verified through immunoblotting, and Nrf2 immunofluorescence was performed. However, there remains a limitation regarding the quantitative analyses of Nrf2 distribution (nuclear/cytoplasmic ratio) in placenta tissue in the present study. The detection of Nrf2 subcellular localization is important as nuclear translocation of Nrf2 directly reflect its activation status (19), thus further research regarding Nrf2 subcellular localization, particularly precise quantification is warranted. Additionally, increased transcriptional activity of Nrf2 under MOTS-c administration was demonstrated in the present study. However, it was assessed at only one time point, and the relevant pharmacokinetics of Nrf2 activation over time following MOTS-c administration is important to optimize dosing regimen to maintain efficacy of MOTS-c. For example, to investigate the optimal Nrf2 activity time after MOTS-c treatment, future work could establish the Nrf2 signaling pathway activation reporting system using secreted Gaussia luciferase (Gluc) as the reporter gene, thus the activity of Gluc could be monitored constantly in MOTS-c-treated cells. Furthermore, a reporter protein complementation imaging assay could be established to screen and observe Nrf2 nuclear translocation in MOTS-c-treated cells and living animals in the future.

The protective effects of MOTS-c were abolished when the Nrf2 inhibitor ML385 and Nrf2 KO mice were used in the present study. By contrast, Nrf2 overexpression failed to enhance the beneficial effects of MOTS-c on cell viability and ROS generation in hypoxia-stimulated HUVECs, in which there was no difference between the Hypoxia + Nrf2 OE and Hypoxia + MOTS-c + Nrf2 OE groups. Notably, under hypoxic conditions, Nrf2 overexpression (Hypoxia + Nrf2 OE group) demonstrated more pronounced cytoprotective effects (increased cell viability and decreased ROS production) compared with that of MOTS-c-treated cells (Hypoxia + MOTS-c group). This result further highlighted the central regulatory role of Nrf2 against oxidative stress damage, which overall suggested that the protective role of MOTS-c against hypoxia-induced abnormal placental injury and fetal growth is at least partially dependent on Nrf2. However, the specific mechanism how MOTS-c regulates Nrf2 has not been fully elucidated until now. Previous studies from the present research group have demonstrated that MOTS-c could directly increase synthesis of Nrf2 independent of protein degradation and promote Nrf2 nuclear translocation (21,22), and demonstrated nuclear accumulation of Nrf2 under MOTS-c administration in the IUGR model. Future research should focus on elucidating the regulatory mechanism of MOTS-c on Nrf2 and investigating the impact of MOTS-c presence or absence on the interaction between Nrf2 and KEAP1 in response to hypoxia or other stress conditions. Notably, the mRNA expression levels of nutrient transporters (Glut1, Fatp4 and Snat4) were still upregulated under MOTS-c administration in Nrf2 KO mice in the present study. It has been reported that MOTS-c induces glucose uptake and GLUT4 translocation in mitochondrial fusion dependent way, and that MOTS-c functionally prevents nutrient metabolism disorders, including insulin resistance, obesity and bone metabolism (66). These studies suggest that MOTS-c can function on nutrient transporters in other non-Nrf2-dependent pathways, such as targeting the mitochondrion. Our previous study found altered glucose and lipid metabolic levels in IUGR offspring in vivo (28); whether MOTS-c treatment alters actual amino acid, glucose or fatty acid levels in fetal serum and functions in regulating glucose or fatty acid in the offspring could be investigated in future research.

The present study has several clinical implications. First, significantly decreased maternal serum MOTS-c content following hypoxic exposure was observed, which suggested that plasma MOTS content could potentially serve as a novel marker for diagnosing IUGR. Second, the in vivo and in vitro experiments demonstrated that administration of MOTS-c effectively attenuated hypoxia-induced IUGR, which suggested that MOTS-c peptides may offer a novel therapeutic approach for treating hypoxia-related neonatal disease, including IUGR.

Several limitations of the present study should be acknowledged. First, a single dose of MOTS-c (5 mg/kg) was used in the present study from GD11 to GD17.5; however, future work should include a dose-response experiment from GD11 to GD17.5 or at later stages in pregnancy to determine the optimal therapeutic concentration, administration time and potential toxicity of MOTS-c. Second, further randomized clinical trials are needed to confirm the endogenous levels of MOTS-c in human placentas or maternal serum from IUGR pregnancies to further the clinical understanding of MOTS-c in IUGR. Currently, the MOTS-c ELISA kit is most commonly used to determine MOTS-c content in body fluids, such as serum. However, this detection system present challenges and can potentially lead to strongly differing results (67). The previous study has established an LC/MS-based method for MOTS-c quantification; therefore, serum or amniotic fluid MOTS-c content may be measured in human IUGR pregnancies using LC/MS in future (67). Furthermore, future studies should focus on the long-term development of main organs such as lungs, heart and brain in offspring mice following MOTS-c administration in an IUGR mouse model.

In conclusion, MOTS-c treatment effectively improved placental insufficiency in hypoxia-induced IUGR by activating the Nrf2-mediated anti-oxidant pathway. The present provided insights for developing MOTS-c as a therapeutic strategy for fetal diseases associated with hypoxic pregnancy, including IUGR.

Supplementary Data

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

DC, HMZ and QFP performed study conceptualization. HMZ and XLS managed project administration and data collection. SPL, SCL and ZXX conducted investigation, provided resources, developed software and performed validation. YXW and JFH curated data. DC, XLS, YXW, JFH and QFP acquired funding. DC, QFP and JFH contributed to writing. DC and HMZ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experimental procedures were approved by the Experimental Animal Care and Use Committee of Jiangnan University [approval nos. 20220930m1080501(383) and 20231115m1080530(555)] and conducted according to the Guide for the Care and Use of Laboratory Animal published by the US National Institutes of Health (8th edition).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Abbreviations:

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 82171704 and 82100018), Natural Science Foundation of Jiangsu Province (grant no. BE2023684), Natural Science Foundation of Shandong Province (grant no. ZR2021MH333), Fundamental Research Funds for the Central Universities (grant no. JUSRP121062), Translational medicine Project of Wuxi Commission of Health (grant no. ZH202101), Wuxi Taihu Talent Training Project (Double hundred Medical Youth Professionals Program; grant no. HB2020054) and the Clinical research and translational medicine program of the Affiliated Hospital of Jiangnan University (grant no. LCYJ202239).

References