Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
March 2013 Volume 42 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March 2013 Volume 42 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Molecular clone and functional study of a novel hepatoma associated gene

  • Authors:
    • Yanhong Liu
    • Yanjie Zhao
    • Qiang Ju
    • Lin Chen
    • Feng Li
    • Guohua  Zhou
    • Pingli Xie
    • Guancheng Li
    • Yuehui Li
  • View Affiliations / Copyright

    Affiliations: Tumor Immunobiology Laboratory of Cancer Research Institute, Key Laboratory of Carcinogenesis and Cancer Invasion, Ministry of Education, Key Laboratory of Carcinogenesis, Ministry of Health, Central South University, Changsha, Hunan 410078, P.R. China
  • Pages: 1105-1112
    |
    Published online on: January 10, 2013
       https://doi.org/10.3892/ijo.2013.1766
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

HTA is a novel hepatoma associated gene screened by bioinformatic strategies in our previous study. In the present investigation, the full-length sequence of the HTA gene was cloned by 3'-rapid amplification of cDNA ends (RACE) and 5'-RACE, which was 1414 bp and the open reading frame (ORF) was constituted with 3 exons and 2 introns. There are two types of splicing of the mRNA of HTA. Northern blot analysis showed that the 1.4 kb HTA mRNA and 1.7 kb HTA mRNA transcripts were present in the hepatocellular carcinoma (HCC) cell lines HepG2 and QGY-7703 but not in the normal cell line L02 and the human umbilical vein endothelial cells (HUVECs). Overexpression of the HTA gene in the hepatic cell line QSG-7701 via stable transfection can promote its proliferation rate and colony forming ability and change the cell cycle distribution of the cell lines. These results showed that the HTA gene is a potential therapeutic target in HCC and the clarification of its gene structure and sequence information provide an essential tool for future research.

Introduction

Hepatocellular carcinoma (HCC) is a highly aggressive cancer with multiple causes and no currently available effective treatment (1,2). Understanding the molecular mechanism of HCC carcinogenesis, its development and progression is imperative for developing novel, effective and targeted therapies for this fatal disease (3,4). Numerous investigations using different improved approaches, such as insertional mutagenesis screen (5), in vivo RNAi screen (6) and omics-based methods (7), are being conducted. Novel tumor associated genes such as glypican-3 (GPC3), astrocyte elevated gene-1 (AEG-1) and exportin 4 (XPO4) have been discovered and studied extensively (8,9).

To search for new biomarkers for tumor diagnosis and therapy, we previously detected tumor associated genes using bioinformatic approaches on a large scale. HTA is a novel tumor associated gene screened by cDNA xProfile, an in silico identification tool based on the EST database provided by the Cancer Genome Anatomy Project (CGAP) web site and preliminarily confirmed by electronic-northern (E-northern). RT-PCR revealed that HTA (NM 001101347) was specifically expressed in certain types of tumor and had a high expression rate in HCC. To further elucidate its mechanism in hepatoma carcinogenesis and its potential role as a cancer biomarker, research were carried out and the results showed that knockdown of endogenous HTA expression in the malignant hepatic cell line HepG2 by small interfering RNA (siRNA) attenuated cell growth, weakened its tumor formation ability in nude mice (10) and changed the expression level of some genes associated with apoptosis (Liu et al, unpublished data), which suggests that HTA may be important in HCC development and progression and its mechanism might be apoptosis-related.

Since HTA is a gene screened from the EST database, the full length sequences were essential for its functional investigation. In this report, the full length cDNA of the HTA gene was verified by rapid amplification of cDNA 3′-ends [3′-rapid amplification of cDNA ends (RACE)] and amplification of cDNA 5′-ends (5′-RACE) (11,12). Northern blot assay was performed to determine the transcripts of HTA mRNA expression in HCC and normal hepatic cell lines.

Materials and methods

Cell lines

The HepG2, QGY-7703, HUVEC, L-02, QGY-7701 cell lines were used in this study. The malignant hepatic cell line HepG2 was stored by our laboratory. QGY-7703 was obtained from the cell bank of the Chinese Academy of Sciences, Shanghai, China. The benign hepatic cell lines QSG-7701, L-02 were stored by our laboratory. Human umbilical vein endothelial cells (HUVEC) were stored by our laboratory. These cell lines were cultured in Gibco® RPMI-1640 medium, supplemented with 10% FBS. All cells were maintained at 37°C in a 5% CO2 incubator.

Preparation of RNA

Total RNA from cell lines was extracted using TRIzol RNA isolation reagents (Life Technologies) according to the manufacturer’s instructions. The mRNA was prepared from total RNA using the PolyATtract® mRNA Isolation Systems (Promega) according to the manufacturer’s instructions. All the RNA samples were tested for integrity and purity by an ultraviolet spectrophotometer (OD260/OD280), RNA temperature incubation experiment and formaldehyde degeneration electrophoresis.

Cloning and sequencing of full length HTA cDNA

In accordance with the existing sequence of the HTA gene obtained in a previous study (10), the gene specific primers for 5′-RACE (GSP1), 3′-RACE (GSP2) and for nest PCR NGSP1 were designed as shown in Fig. 1 and Table I. Then, the 5′-end sequence and 3′-end sequence of the cDNA encoding the HTA gene were obtained from the HCC cell line HepG2 using Smarter™ RACE cDNA Amplification kit 5′/3′ (Clontech) according to the manufacturer’s instructions. Initially with 1 μg total RNA of HepG2 cells, the 3′-RACE ready cDNA and 5′-RACE ready cDNA were synthesized according to the protocol, respectively. GSP1 primer and Upper primer mix were then used to amplify the 5′-end sequences of the HTA gene. Upper primer mix and GSP2 primer were used to amplify the 3′-end sequence of the HTA gene. Then, a touch-down program was performed as follows: 5 cycles of denaturing at 94°C for 30 sec, 72°C for 3 min, followed by 5 cycles of each 94°C for 30 sec, 70°C for 30 sec and 72°C for 3 min, then followed by 35 cycles of 94°C for 30 sec, 68°C for 30 sec and 72°C for 3 min. The RACE PCR product was analyzed by 1% agarose gel electrophoresis and photographed by Image Master VDS Gel Imaging system (Pharmacia). Using 25-fold diluted RACE PCR product as template, nest PCR was performed by nest primers and program as follows: 30 cycles of 94°C for 30 sec, 68°C for 30 sec and 72°C for 3 min. The nest PCR product was separated by 1% low-melting agarose gel electrophoresis and Objective band was retrieved and ligated to pGEM-T easy vector, then transformed into Escherichia coli (E. coli) DH5α. Several positive clones were picked out and sequenced.

Figure 1

The location and direction of primers for 3′/5′-RACE.

Table I

Primers used in this study.

Table I

Primers used in this study.

Primer(5′-3′)
Universal primer (long) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
Universal primer (short) CTAATACGACTCACTATAGGGC
Nested universal primer AAGCAGTGGTATCAACGCAGAGT
GSP1 TCTGCTGGAGGTGAGGGCTCGTGGT
GSP2 ATGGGTTGCTTGGGGCATCCTGTG
NGSP1 GTCGGGGTTGTTCTTGTTTTCAG
HTA-cDNA-F CGAAGATTTCTTATAGACAGGC
HTA-cDNA-R GGAGGGCATTATGGTGAG
HTA-probe-F CTATTTATGGGTTGCTTGG
HTA-probe-R-T7 CTAATACGACTCACTATAGGGAGAGAGGGCATTATGGTGAGAT
GAPDH-probe-F AATCCCATCACCATCTTCC
GAPDH-probe-R-T7 CTAATACGACTCACTATAGGGAGAGCTGTAGCCAAATTCGTTGT
Analysis of HTA gene structure and alternative splicing

The sequences of products of RACE PCR positive clones were comprehensively analyzed by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and online software open reading frame (ORF) finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi) provided by the National Center For Biotechnology Information (NCBI). The full length sequence primers of HTA (HTA-cDNA-F and HTA cDNA-R in Table I) were designed and the full lengths of HTA transcripts were amplified. The amplified product was sequenced and the alternative splicing of the HTA gene was analyzed.

Northern blot analysis of HTA mRNA expression

Probes for northern blotting were produced using a DIG RNA labeling and detection kit (Roche Diagnostics). A 589-bp HTA gene specific primer pair was designed for amplification of northern bolt probe; at the same time, a 24-bp T7 promoter sequence 5′-CTAATACGACTCACTATAGGGAGA-3′ was added to the 5′-end of reverse primer (Table I). Then, the northern blot probe of HTA gene labeling with digoxin in UTP was produced by in vitro transcription. GAPDH probe was produced with the same procedure. The labeling efficiency of the probes was determined according to the manufacturer’s instructions.

mRNA (1 μg) from four hepatic cell lines (HUVEC, L-02, HepG2, QGY-7703) was separated on denaturing 0.667% formaldehyde-2% agarose gel and was transferred onto positively charged nylon membrane Biodyne Plus (Pall) by the capillary transfer method. Following UV cross-linking (245 nm, 1.5 J/cm2 for 1 min 45 sec), prehybridization was carried out at 68°C for 1 h using DIG Easy Hyb (Roche Diagnostics). Hybridization was performed at 68°C for 12 h, 40 revolutions per minute (rpm), using the DIG Easy Hyb containing 100 ng/ml of the complementary RNA (cRNA) probe that was previously produced. The membrane was then washed twice for 5 min in 2X SSC with 0.1% sodium dodecyl sulfate (SDS) at room temperature, and was washed again twice in 0.1X SSC with 0.1% SDS at 68°C for 15 min. After incubating the membrane in alkaline phosphatase (AP) labeled anti-digoxin antibody, the chemiluminescent signals were detected using the DIG RNA labeling and detection kit according to the manufacturer’s instructions. Signals were detected after exposure on Pierce ECL Plus (Thermo Scientific). For standardization, the HTA probe was stripped from the membrane and was reprobed using the DIG-labeled GAPDH RNA probe under conditions similar to assessing the RNA loading and transfer efficiency.

Construction of expression vectors of HTA

Total RNA was extracted from HepG2 cells by homogenization in TRIzol reagent (Invitrogen, USA) and first-strand cDNAs were synthesized from 2 μg of DNase I-treated total RNA using First Strand cDNA Synthesis kit (Fermentas, USA) by way of a two-step system. Gene-specific polymerase chain reaction (PCR) primers for HTA ORF amplification were: 5′-CGCGGATCCGCCGCCATGCTCTGTGTGCCCTTCCT-3′ (sense) and 5′-CCGGAATTCTTAGCCCAAGATGAAGACAAGGC-3′ (antisense) and introduced with BamHI site (sense) and an EcoRI site (antisense) respectively (underlined). The italic GCCGCC in the sense primer was a Kozak sequence (13) designed to improve gene expression quantity. The bold ATG and TAA were initial and terminator codon, respectively. The PCR products of the HTA gene were purified by 1% agarose gel electrophoresis then double digested and ligated into the eukaryotic expression vector pcDNA3.1(+). The recombinant plasmid was transformed into E. coli DH5α then identified by PCR, double endonuclease digestion and DNA sequencing.

Transfection and selection of stable HTA overexpression hepatic cell line

Plasmids pcDNA3.1(+)-HTA and pcDNA3.1(+) were transfected into QSG-7701 cell lines using Lipofectamine™ 2000 (Invitrogen). Three days later, cells were selected in a medium containing G418 (600 mg/ml) for 10 days, then the limiting dilution method was used and G418-resistant colonies were cloned and expanded. RT-PCR was performed to detect the HTA mRNA expression level in empty vector and HTA overexpression clones. A clone with the highest HTA expression was selected to perform subsequent experiments.

Cell proliferation test in vitro

Growth experiments of QSG-7701-c [QSG-7701 cell line stably transfected with pcDNA3.1 (+) empty vector as a control] and QSG-7701-HTA-2 were performed using the Cell Counting kit-8 (CCK-8, Beyotime) based on WST-8 [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium]. Cell doubling time test and plate cloning formation assay were reconfirmed by cell cycle analysis, which was performed by flow cytometry.

In the CCK-8 assay, cells were seeded with serum-free medium at a density of 103 cells/well in 96-well plates (n=6), grown overnight, washed with PBS, and incubated in DMEM medium supplemented with 5% FBS. The samples were tested every 24 h for 6 days. WST-8 (10 μl) each well was added for 2 h and the optical density was measured at 450 nm in an SM-3 automatic enzyme-linked immune-analyzer (TianShi, China).

In the cell doubling time test, cells were seeded at a density of 104 cells/well in 24-well plates (n=3), grown with serum-free medium overnight, washed with PBS, and incubated in DMEM medium with 3% FBS. Cells were collected 6 days later and cell densities were assessed by counting the cells in a hemocytometer. Cell doubling time (TD) was calculated with the following formula: TD= t[lg2/(lgNt - lgNo)] [t, period of culturing (hour). No, cell density when the cells were seeded. Nt, cell density when the cells were cultured t hours].

Plate colony formation assay was used to assess the colony formation ability of cells. The cells were incubated in serum-free medium overnight. A total of 1,000 single-cell suspension cells resuspended in 2 ml growth media were plated in triplicate on 6-well plates. Colonies >50 cells were counted 14 days after plating. Colony formation ratio was calculated with the following formula: Colony formation rate = (number of colonies counted /numbers of cells seeded) x 100%.

For flow cytometry, cells were incubated with serum-free medium for 24 h, and then cultured in DMEM with 10% FBS for 48 h (n=3). Cells were harvested and resuspended in fixation fluid at a density of 106/ml, 1,500 μl propidium iodide (PI) solution was added, and the cell cycle was detected by FACSCalibur (Becton-Dickinson).

Statistical analysis

The values are presented as the means ± SD for three or more individual experiments. Data were tested with SPSS software (version 13.0, SPSS Inc.) for significance. The analysis of variance and t-test were applied in comparing the intergroup difference of measurement data. p<0.05 was considered to indicate a statistically significant difference. The diagrams were drawn by GraphPad Prism 5.

Results

Molecular cloning of the full-length HTA cDNA

We cloned the 5′-RACE and 3′-RACE product and determined the sequence. The products using this method were partly consistent with a previous known sequence of HTA. Finally, the 1414-bp obtained HTA cDNA was reconfirmed to be full length by northern blot analysis. Fig. 2 shows the nucleotide sequence and the deduced amino acid sequence using 5′-RACE and 3′-RACE. The 3′-end of the product was in line with the sequence previously obtained. The ORF of the HTA gene encoded a protein of 92 amino acids with an estimated molecular weight of 10.2 kDa. A comparison of the HTA cDNA sequence with the GenBank database showed no significant homology with other genes except its homologous sequences in Macaca fascicularis and Macaca fascicularis genome. Furthermore, a comparison of the deduced amino acid sequence with a protein sequence database showed no overall significant homology with other proteins whose function is known. It also showed no conserved domains and no valid domain hit for architecture searched by NCBI.

Figure 2

The full length sequence and the deduced amino acid sequence of the HTA gene.

Alternative splicing analysis of the HTA gene

Online prediction software ORF finder provided by NCBI revealed that the HTA gene was constituted with 3 exons and 2 introns. RT-PCR with HTA full length primer pair HTA-cDNA-F and HTA-cDNA-R showed that the HTA gene has two transcripts which were 1.4 and 1.7 kb, respectively (Fig. 3). Sequencing of RT-PCR product suggested an alternative splicing of the HTA gene. The 252-bp second introns of the HTA gene can be spliced, or retained as a part of mRNA (Fig. 4).

Figure 3

Full length amplification of the HTA gene.

Figure 4

Alternative splicing of the HTA gene. (A) Sequence of the 1.4 kb transcript; (B) sequence of the 1.7 kb transcript; (C) sketch map of alternative splicing form.

Expression of HTA mRNA in hepatic cell lines

The labeling efficiency of HTA and GAPDH digoxin probes were defined. When the samples were diluted to the concentration of 0.3 pg/μl, the signal could still be detected, which means that adequate amounts of labeled RNA probe for northern blot analysis were obtained (Fig. 5A). Northern blot analysis showed that the 1.4-kb HTA mRNA and 1.7-kb HTA mRNA transcripts were present in HCC cell lines HepG2 and QGY-7703. The expression amount of the 1.4-kb transcript was much higher than the 1.7-kb transcript. In the normal hepatic cell line L-02 and the normal cell line HUVEC, no HTA transcript was detected (Fig. 5B).

Figure 5

Expression of HTA in different hepatic cell lines detected by northern blot analysis. (A) Labeling efficiency of HTA and GAPDH digoxin probes. (B) Expression of HTA and GAPDH.

Establishment of the overexpression of the HTA hepatic cell line

The recombinant eukaryotic expression plasmid pcDNA3.1(+)-HTA was successfully constructed and verified by bacterial colony PCR, restriction enzyme digestions (Fig. 6A) and complete sequencing (Fig. 6B). The recombinant HTA protein obtained from this plasmid had a Kozak sequence for high potency of expressing heterologous protein (Fig. 6C).

Figure 6

Construction of plasmid pcDNA3.1(+)-HTA. (A) Identification of recombinant plasmid pcDNA3.1(+)-HTA by double enzyme digestion and bacterial colony PCR. Lane M, DNA ladder; lane 1, double digestion with BamHI and EcoRI; lane 2, pcDNA3.1 (+)-HTA without digestion; lane 3, PCR product of positive bacterial colony. (B) Part sequence of the 5′ terminal of pcDNA3.1(+)-HTA plasmid. The square shows the initial codon of HTA. (C) The schematic diagram of recombinant prokaryotic expression plasmid pcDNA3.1(+)-HTA.

After G418-resistant stable cell lines were picked up, a semi-quantitative RT-PCR analysis was performed to determine the HTA mRNA expression in different clones. QSG-7701-HTA-2, the clone with the highest HTA expression, was chosen to perform subsequent in vitro experiments (Fig. 7).

Figure 7

Determination of the HTA mRNA expression in different QSG-7701 clones. (A) The mRNA expression of HTA and GAPDH detected by RT-PCR. (B) Expression ratio of HTA/GAPDH evaluated by gray scan.

Overexpression of HTA promotes cell growth in vitro

The rate of the cell proliferation in the clone QSG-7701-HTA-2 was significantly increased compared to QSG-7701-c. Cell proliferation curve detected by CCK-8 assay (Fig. 8) and colony formation assay (Fig. 9) showed that the overexpression of HTA upregulated the cell proliferation and colony formation ability of QSG-7701 cells. The cell doubling time of QSG-7701-HTA-2 was 3.87±0.187 days, while QSG-7701-c was 9.14 ±0.143 days. Cell cycle distribution detected by flow cytometry is shown in Fig. 10. This result is in line with the above results.

Figure 8

Cell proliferation curve of QSG-7701-c and QSG-7701-HTA-2 detected by CCK-8 assay.

Figure 9

Colony formation assay. (A) The colony formation assay of QSG-7701-c and QSG-7701-HTA-2 cell lines. (B) The colony formation rate of QSG-7701-c and QSG-7701-HTA-2.

Figure 10

Cell cycle distribution. (A) Cell cycle distribution of QSG-7701-c and QSG-7701-HTA-2 detected by flow cytometry. (B) Cell cycle distribution percent of QSG-7701-c and QSG-7701-HTA-2.

Discussion

HTA is a novel tumor associated gene screened by our research group. To date, only a few studies have focused on the HTA gene. Specific expression characteristics and the cancer-promoting effect revealed by knockdown experiment suggested that HTA may play a role in HCC development (10). In order to thoroughly explore the role of HTA, the full length sequence of HTA is imperative for the further investigations such as overexpression and functional clarification. In this study, the full length cDNA of HTA was obtained by 3′-RACE and 5′-RACE; HTA mRNA expression in different hepatic cell lines and normal cell lines was analyzed by northern blot assay, and the over expression of HTA cDNA in the hepatic cell line was performed to clarify the biological function of the HTA gene.

There were certain difficulties in obtaining the full length cDNA sequence of the HTA gene, due to its relatively low expression even in the HepG2 cell line, which is considered to have the highest expression of the HTA gene. The smart technology, which is considered the most advanced approach to obtain the full length cDNA of a certain gene with a partial known sequence, was chosen for the full length cDNA of the HTA gene (11). At the same time, hot start PCR polymerase was applied to avoid non-specific amplification in lower temperatures (14) and a touch-down PCR program was applied to avoid non-specific amplification in early cycles and to improve the efficiency of specific amplification in later cycles of the program (15).

The accuracy and integrity of the cDNA sequence obtained by 3′/5′-RACE require further confirmation. Following 3′/5′-RACE, RT-PCR was performed. The sequence of HTA cDNA was amplified by full length primer. As the HTA gene is unique in quadrumana and exclusively found in the genome of humans and anthropoids, we could not confirm its full length cDNA sequence by homologous alignment (16). Therefore, the full length of the HTA gene according to the disciplines as following: the ready frame of the gene was integral: there was a terminal codon in the same frame in the upstream of the ORF’s initial codon ATG and there was polyA tail. At the same time, it was proved that the length of HTA transcripts defined by northern blot analysis was consistent with the sequence obtained by RACE.

Alternative splicing occurs as a normal phenomenon in eukaryotes, where it greatly increases the biodiversity of proteins that can be encoded by the genome (17,18). In humans, approximately 95% of multi-exonic genes are alternatively spliced (18). There are numerous modes of alternative splicing observed, of which the most common is exon skipping (17). It was reported that alternative splicing plays a crucial role in receptor diversity generation and growth and development regulation (19,20), particularly reflected in the nervous (21,22) and the immune system (23,24), which was closely related to their function diversity and reaction sensibility. It was estimated that 15% of disease occurred mutations would affect the splicing of pre-mRNA (25,26). We clarified that the second introns of the HTA gene were selectively retained in mRNA and produced a small quantity of longer transcript. Whether this alternative splicing plays a role in carcinogenesis requires further elucidation.

In vitro experiments revealed that overexpression of the HTA gene in the hepatic cell line QSG-7701 promotes the proliferation and colony formation ability of the cells, which proved the carcinogenesis by the HTA gene, and it was consistent with the interference experiment in a previous study (10). The result confirmed that the HTA gene plays an important role in HCC development.

In conclusion, this study obtained and identified the full length cDNA sequence of the HTA gene and analyzed its alternative splicing form, further elucidating the structure of the HTA gene and providing the foundations for HTA gene function studies. Primary function study of the HTA gene by overexpression in vitro proved its role in HCC carcinogenesis.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (81201903 and 2010CB833605), the Science and Technology Department Research Foundation of Hunan Province (2010SK3132), and the PhD Candidates’ Research Innovation Project of Hunan Province (CX2011B050), China.

References

1 

El-Serag HB: Hepatocellular carcinoma. N Engl J Med. 365:1118–1127. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar

3 

DuBray BJ, Chapman WC and Anderson CD: Hepatocellular carcinoma: a review of the surgical approaches to management. Mo Med. 108:195–198. 2011.PubMed/NCBI

4 

Jia HL, Ye QH, Qin LX, et al: Gene expression profiling reveals potential biomarkers of human hepatocellular carcinoma. Clin Cancer Res. 13:1133–1139. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Keng VW, Villanueva A, Chiang DY, et al: A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nat Biotechnol. 27:264–274. 2009. View Article : Google Scholar

6 

Zender L, Xue W, Zuber J, et al: An oncogenomics-based in vivo RNAi screen identifies tumor suppressors in liver cancer. Cell. 135:852–864. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Pei Y, Zhang T, Renault V and Zhang X: An overview of hepatocellular carcinoma study by omics-based methods. Acta Biochim Biophys Sin (Shanghai). 41:1–15. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Villanueva A, Minguez B, Forner A, Reig M and Llovet JM: Hepatocellular carcinoma: novel molecular approaches for diagnosis, prognosis, and therapy. Annu Rev Med. 61:317–328. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Zender L, Villanueva A, Tovar V, Sia D, Chiang DY and Llovet JM: Cancer gene discovery in hepatocellular carcinoma. J Hepatol. 52:921–929. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Liu Y, Li Y, Guo F, et al: Identification of HTA as a novel-specific marker for human hepatocellular carcinoma. J Cancer Res Clin Oncol. 136:1187–1192. 2010.

11 

Scotto-Lavino E, Du G and Frohman MA: 5′ end cDNA amplification using classic RACE. Nat Protoc. 1:2555–2562. 2006.

12 

Scotto-Lavino E, Du G and Frohman MA: 3′ end cDNA amplification using classic RACE. Nat Protoc. 1:2742–2745. 2006.

13 

Kozak M: Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem. 266:19867–19870. 1991.PubMed/NCBI

14 

Paul N, Shum J and Le T: Hot start PCR. Methods Mol Biol. 630:301–318. 2010. View Article : Google Scholar

15 

Pratyush DD, Tiwari S, Kumar A and Singh SK: A new approach to touch down method using betaine as co-solvent for increased specificity and intensity of GC rich gene amplification. Gene. 497:269–272. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Loytynoja A: Alignment methods: strategies, challenges, benchmarking, and comparative overview. Methods Mol Biol. 855:203–235. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Black DL: Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem. 72:291–336. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Pan Q, Shai O, Lee LJ, Frey BJ and Blencowe BJ: Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nat Genet. 40:1413–1415. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Roberts GC and Smith CW: Alternative splicing: combinatorial output from the genome. Curr Opin Chem Biol. 6:375–383. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Kelemen O, Convertini P, Zhang Z, et al: Function of alternative splicing. Gene. Aug 15–2012.(Epub ahead of print).

21 

Norris AD and Calarco JA: Emerging roles of alternative pre-mRNA splicing regulation in neuronal development and function. Front Neurosci. 6:1222012. View Article : Google Scholar : PubMed/NCBI

22 

Dever SM, Xu R, Fitting S, Knapp PE and Hauser KF: Differential expression and HIV-1 regulation of μ-opioid receptor splice variants across human central nervous system cell types. J Neurovirol. 18:181–190. 2012.PubMed/NCBI

23 

Magg T, Mannert J, Ellwart JW, Schmid I and Albert MH: Subcellular localization of FOXP3 in human regulatory and nonregulatory T cells. Eur J Immunol. 42:1627–1638. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Martinez NM, Pan Q, Cole BS, et al: Alternative splicing networks regulated by signaling in human T cells. RNA. 18:1029–1040. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Liu J, Lee W, Jiang Z, et al: Genome and transcriptome sequencing of lung cancers reveal diverse mutational and splicing events. Genome Res. Nov 1–2012.(Epub ahead of print).

26 

Singh RK and Cooper TA: Pre-mRNA splicing in disease and therapeutics. Trends Mol Med. 18:472–482. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu Y, Zhao Y, Ju Q, Chen L, Li F, Zhou G, Xie P, Li G and Li Y: Molecular clone and functional study of a novel hepatoma associated gene. Int J Oncol 42: 1105-1112, 2013.
APA
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G. ... Li, Y. (2013). Molecular clone and functional study of a novel hepatoma associated gene. International Journal of Oncology, 42, 1105-1112. https://doi.org/10.3892/ijo.2013.1766
MLA
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G., Xie, P., Li, G., Li, Y."Molecular clone and functional study of a novel hepatoma associated gene". International Journal of Oncology 42.3 (2013): 1105-1112.
Chicago
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G., Xie, P., Li, G., Li, Y."Molecular clone and functional study of a novel hepatoma associated gene". International Journal of Oncology 42, no. 3 (2013): 1105-1112. https://doi.org/10.3892/ijo.2013.1766
Copy and paste a formatted citation
x
Spandidos Publications style
Liu Y, Zhao Y, Ju Q, Chen L, Li F, Zhou G, Xie P, Li G and Li Y: Molecular clone and functional study of a novel hepatoma associated gene. Int J Oncol 42: 1105-1112, 2013.
APA
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G. ... Li, Y. (2013). Molecular clone and functional study of a novel hepatoma associated gene. International Journal of Oncology, 42, 1105-1112. https://doi.org/10.3892/ijo.2013.1766
MLA
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G., Xie, P., Li, G., Li, Y."Molecular clone and functional study of a novel hepatoma associated gene". International Journal of Oncology 42.3 (2013): 1105-1112.
Chicago
Liu, Y., Zhao, Y., Ju, Q., Chen, L., Li, F., Zhou, G., Xie, P., Li, G., Li, Y."Molecular clone and functional study of a novel hepatoma associated gene". International Journal of Oncology 42, no. 3 (2013): 1105-1112. https://doi.org/10.3892/ijo.2013.1766
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team