Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2014 Volume 45 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2014 Volume 45 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer

  • Authors:
    • Yoshifumi Umemori
    • Kageaki Kuribayashi
    • Shinya Nirasawa
    • Takashi Kondoh
    • Maki Tanaka
    • Daisuke Kobayashi
    • Naoki Watanabe
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Laboratory Medicine, Sapporo Medical University School of Medicine, South-1, West-16, Chuo-ku, Sapporo 060-8543, Japan
  • Pages: 1043-1050
    |
    Published online on: June 10, 2014
       https://doi.org/10.3892/ijo.2014.2489
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The phosphatidylinositol 3-kinase pathway transduces cell survival signals in different malignancies. Protein kinase C ζ (PKCζ) is one of the molecules involved in this pathway. In this study, we investigated the role of PKCζ in apoptosis. Short interfering RNA against PKCζ (siPKCζ) sensitized HCT116 and SW480 colon cancer cells to TRAIL‑induced apoptosis. Among anti-apoptotic proteins, survivin protein and mRNA expression levels decreased after siPKCζ transfection while protein half-life did not change. The expression levels of survivin and PKCζ were correlated in 18 colon cancer specimens (r=0.72, P=3.01x10‑4). Chemosensitivity to 5-FU was enhanced by siPKCζ in HCT116 and SW480 cells. These results indicate that PKCζ regulates survivin expression levels and inhibits apoptosis in colon cancer cells. This study provides a rationale for targeting PKCζ in combination with chemotherapy for colon cancer treatment.

Introduction

The phosphatidylinositol 3-kinase (PI3K) pathway transduces cell survival signal in different malignant cells (1,2). The pathway is directly activated by genetic mutations of PI3K or alterations in proteins regulating this pathway. Activating missense mutaions of the PI3K catalytic subunit, PIK3CA, are reported in 4.6–26.7, 8.3–40.0, 13.6–31.6, 35.6, 1.3–4.2, 6.0–12.1 and 4.3–25.0% of brain, breast, colon, liver, lung, ovary and stomach cancer cases, respectively (3). Phosphatase and tensin homologue (PTEN) antagonizes PI3K signaling by dephosphorylating phosphatidylinositol-3,4,5-trisphosphate (PIP). A germline mutation of PTEN leads to Cowden disease characterized by a predisposition to breast and thyroid cancer (4). KRAS is frequently mutated in various types of cancer, including colon, lung and pancreatic cancer. PI3K has been shown to be an essential target molecule in KRAS-dependent carcinogenesis in vitro and in vivo (5). Receptor tyrosine kinases reside upstream of the PI3K pathway: i) epidermal growth factor receptor (EGFR) mutations are reported in 7.6–30.6% of non-small cell lung cancer (6), ii) ERBB2 is overexpressed in 10–34% of breast cancer (7), and iii) BCR-ABL1 chimeric protein is produced and activates the PI3K pathway in chronic myeloid leukemia (8).

PI3K phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP) to produce PIP that activates downstream kinases including phosphoinositide dependent protein kinase 1 (PDK1) and AKT, which is a downstream target of PDK1 (9). Atypical protein kinase Cζ (PKCζ) is another kinase in the PI3K pathway. It is a member of protein kinase C family and is activated by PDK1 (10,11), K-RAS (12), and superoxide (13).

Reportedly, overexpression of PKCζ is associated with poor prognosis in patients with soft tissue sarcoma (14), cervical cancer (15), and prostate cancer (16). Experimentally, activation of PKCζ has been shown to confer aggressive phenotypes to cancer cells through different mechanisms, including promotion of cell proliferation (17,18), migration (13,19) and transactivation of hypoxia-inducible factors (20).

In this study, we show that PKCζ inhibits apoptotic stimuli by regulating survivin expression level in colon cancer cells.

Materials and methods

Reagents

Anti-PKCζ (sc-216), anti-actin (sc-8432), anti-Bcl-2 (sc-7382), and anti-Bcl-X (sc-8392) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-cIAP1 (AF818), anti-cIAP2 (AF817), anti-survivin (AF886), and anti-XIAP (MAB822) antibodies were purchased from R&D Systems (Minneapolis, MN, USA). Anti-phospho-PKCζ (NB100-80026) antibody was purchased from Novus Biologicals (Littleton, CO, USA). Anti-Ran antibody was purchased from BD Pharmingen (San Jose, CA, USA). Cycloheximide and 5-fluorouracil (5-FU) were purchased from Wako Pure Chemical Industries (Osaka, Japan) and Sigma-Aldrich (St. Louis, MO, USA), respectively.

Cell culture

The human colon cancer cell lines HCT116 and SW480 that present the constitutively active PI3K pathway were used in this study (21). SW480 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS; Hyclone Thermo Fischer Scientific, Logan, UT, USA) in humidified 5% CO at 37°C. HCT116 cells were cultured in the same condition except that McCoy’s 5A medium (Gibco Life Technologies, Gaithersburg, MD, USA) was used instead of DMEM.

Purification of soluble recombinant human TRAIL (rhTRAIL)

His6-tagged TRAIL expression plasmid (pQE-hTR) that expresses the extracellular portion of human TRAIL was kindly provided by Dr W.S. El-Deiry (Penn State Hershey Cancer Institute, PA, USA). It was transformed into DH10B (Takara Bio Inc., Tokyo, Japan). Briefly, rhTRAIL was induced by 0.5 mM Isopropyl-1-thio®-d-galactopyranoside, and purified using Ni-NTA agarose beads (Qiagen, Valencia, CA, USA) as previously described (22).

Sub-G1 analysis

After treatments, the cells were collected and fixed with 70% ethanol at 4°C. The cells were resuspended in phosphate-citrate buffer. After centrifugation, the pellets were treated with RNase A, stained with propidium iodide (PI), and analyzed by flow cytometry (FACSCanto, BD Bioscience, San Jose, CA, USA).

Western blotting

Western blotting was carried out using standard methods. Briefly, cells were sonicated in lysis buffer [20 mM Tris-HCl (pH 8.0), 135 mM NaCl, 5 mM EDTA and 1% NP-40] with a protease inhibitor cocktail (Sigma-Aldrich) and Halt phosphatase inhibitor cocktail (Pierce, Rockford, IL, USA). The samples were separated on a Tris-glycine gel (Life Technologies) under denaturing conditions. Proteins were electro-blotted onto a nitrocellulose membrane. After incubation with antibodies, the membranes were washed, incubated with the appropriate secondary antibody, washed again, and the proteins were detected using ECL Prime Western Blotting Detection kit (GE Healthcare, Piscataway, NJ, USA). The blots were visualized using the ChemiDoc XRS system (Bio-Rad Laboratories, Hercules, CA, USA).

Measurement of caspase-3 and -7 activities

Caspase-3 and -7 activities were measured using Caspase-Glo 3/7 assay (Promega, Madison, WI, USA). Briefly, 5,000 cells/100 μl of conditioned medium were seeded into each well of 96-well plates and the cells were treated using the conditions described in each figure. Assay reagent (100 μl) was added to each well, and the cells were incubated for 1 h at room temperature (RT). The luminescence signal was measured using a Veritas™ Microplate Luminometer (Promega).

Transduction of short interfering RNA (siRNA)

siRNAs were transfected into cells by electroporation using Amaxa Cell Line Nucleofector Kit V (Lonza, Gaithersburg, MD, USA) and Nucleofector II (Lonza). The programs D-032 and L-024 were used for HCT116 and SW480, respectively, according to the manufacturer’s instructions. The sequence 5′-CUACG GCAUGUGCAAGGArA-3′ was used to silence PKCζ. A non-silencing control siRNA (siNSC) was purchased from Applied Biosystems (Foster City, CA, USA).

Quantification of BIRC5 (survivin) mRNA

Expression of BIRC5 (survivin) mRNA was determined by quantitative reverse-transcriptase polymerase chain-reaction (RT-PCR) using the ABI PRISM 7700 sequence-detector system (Applied Biosystems). Total RNA was isolated using the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. The cDNA was reverse-transcribed by TaqMan reverse transcription reagents (Applied Biosystems). The gene-specific primers and fluorescent hybridization probes for BIRC5a were as follows: 5′-AAGAACTGGCCCTTCTTGGA-3′, 5′-CAACCGGACGAATGCTTTT-3′ and 5′-(FAM)CCAGATGACGACCCCATAGAGGAACA (TAMRA)-3′. These were used as forward primer, reverse primer, and the TaqMan probe, respectively. For the internal control, GAPDH was quantified using primers and TaqMan probe purchased from Applied Biosystems.

Determination of half-life of survivin protein

Protein synthesis of cells was blocked using 100 μg/ml cycloheximide, incubated for different times as indicated in each figure, and subjected to western blotting using anti-survivin and anti-actin antibodies. The densitometric units of the blots were measured by the software Quantity One (Bio-Rad Laboratories) and survivin expression level was normalized to that of actin.

Ubiquitination assay

siPKCζ or siNSC were cotransfected with p3xFLAG-survivin expression vector to cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The cells were treated with 10 μM MG132 (Sigma-Aldrich) for 8 h after the transfection, collected and the whole cell lysates were prepared. Ubiquitinated FLAG-tagged survivin was immunoprecipitated using anti-FLAG antibody and they were subjected to immunoblotting analysis using antibodies against ubiquitin or survivin.

Immunohistochemical staining of tissue sections

Colorectal cancer tissues were obtained from patients who underwent surgery at Sapporo Medical University Hospital. Written informed consent was obtained before the acquisition of these tissues. Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded sections. Antigen retrieval was performed by boiling the sections at 120°C for 5 min in a microwave oven in preheated 0.01 M sodium citrate (pH 6.0). Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxide in ethanol for 10 min. After blocking with 1% non-fat dry milk in PBS (pH 7.4), the sections were incubated with a polyclonal anti-PKCζ or anti-survivin antibody for 1 h followed by incubation with biotinylated anti-rabbit IgG (Nichirei Bioscience, Tokyo, Japan) for 30 min. Subsequently, the sections were stained with streptavidin-biotin complex (Nichirei Bioscience), followed by incubation with 3,3′-diaminobenzidine used as the chromogen, and counterstaining with hematoxylin.

Measurement of cell viability

The CellTiter-Glo Luminescent Cell Viability assay (Promega) was used according to the manufacturer’s instructions. Briefly, 1,000 cells were seeded in each 96-well culture plates. Cells were treated with different conditions as described in each figure, after which the assay reagent was added and incubated for 10 min at RT. The luminescent signal was measured using a Veritas Microplate Luminometer.

Immunofluorescence staining for p65

Cells were fixed in ice-cold 50% ethanol for 5 min. The samples were incubated with anti-p65 antibody (D14E2, Cell Signaling Technology) for 24 h at 4°C, washed, and incubated with anti-rabbit IgG Alexa Fluor 488 antibody (1/200 dilution) (Invitrogen, Carlsbad, CA, USA) for 1 h at RT. Then, the nuclei were counterstained with Hoechst 33342 in mounting medium and the fluorescence images were obtained using a Leica AF6000 fluorescence imaging system (Nussloch, Germany).

Statistical analysis

Statistical analysis of the data was conducted using Microsoft Excel®. Pearson’s correlation coefficient was used to determine the correlation between expression level of PKCζ and survivin in colorectal cancer clinical specimens. Statistical significance was evaluated using the Student’s t-test or χ2 test.

Results

PKCζ is anti-apoptotic in colon cancer cells

To check whether PKCζ is anti-apoptotic in colon cancer cells, the effect of siRNA to PKCζ (siPKCζ) on colon cancer cell apoptosis was tested. The effectiveness of siPKCζ to protein expression was confirmed by immunoblotting (data not shown). Preliminary experiments indicated that TRAIL induced apoptosis in HCT116 and SW480 dose- and time-dependently (data not shown). Sub-G1 analysis (Fig. 1A) and caspase-3/7 assay (Fig. 1B) showed that siPKCζ enhanced TRAIL sensitivity both in HCT116 and SW480 cells. Conversely, overexpression of PKCζ conferred TRAIL resistance to HCT116 cells (data not shown). These results show that PKCζ is anti-apoptotic in colon cancer cells.

Figure 1

PKCζ is anti-apoptotic in colon cancer cells. (A) HCT116 and SW480 cells were transfected with siRNA against PKCζ (siPKCζ) or non-silencing control (siNSC), treated with or without TRAIL (50 ng/ml) for 12 h and the samples were subjected to sub-G1 analysis. (B) HCT116 and SW480 cells were transfected with siPKCζ or siNSC, treated with TRAIL (50 ng/ml) for the times indicated in the figure and caspase-3/7 activities were measured as described in Materials and methods. Error bars denote 1 standard deviation. NS, statistically not significant. *P<0.05. **P<0.01.

Survivin is regulated by PKCζ

To determine the molecular mechanism by which PKCζ inhibits apoptosis in colon cancer cells, expression levels of anti-apoptotic proteins were analyzed in cells transfected with siPKCζ and siNSC. As shown in Fig. 2, among the anti-apoptotic proteins analyzed in this study, survivin was the only protein downregulated by siPKCζ in both HCT116 and SW480 cells. siPKCζ reduced the expression levels of survivin in HCT116 and SW480 cells in a time-dependent manner while overexpression of PKCζ upregulated survivin expression level in HCT116 cells (data not shown). These results show that expression level of survivin is regulated by PKCζ in colon cancer cells.

Figure 2

Downregulation of PKCζ suppresses survivin protein expression level. HCT116 and SW480 cells were transfected with siPKCζ or siNSC and subjected to western blot analysis using antibodies, as indicated.

PKCζ regulates survivin expression at transcriptional level

Generally, survivin is regulated by two different mechanisms: i) regulation at the transcriptional level or ii) by post-translational modifications. First, mRNA level of BIRC5 (survivin) was quantified by TaqMan RT-PCR. As shown in Fig. 3, siPKCζ reduced BIRC5 transcript expression level in HCT116 and SW480 cells. Half-life of survivin protein in cells silenced with siPKCζ (Fig. 4A) or in HCT116 cells overexpressing PKCζ (data not shown) did not differ from that of the control cells. We were unable to find a condition that shows difference in ubiquitination status of survivin in HCT116 cells transduced with siNSC and siPKCζ (Fig. 4B and C). These results indicate that PKCζ regulates survivin expression at the transcriptional level.

Figure 3

PKCζ regulates survivin expression at the transcriptional level. HCT116 and SW480 cells were transfected with siPKCζ or siNSC and levels of BIRC5 (survivin) mRNA was quantified by TaqMan RT-PCR. Level of BIRC5 mRNAs was normalized relative to that of GAPDH transcripts. Error bars denote standard deviation. NS, statistically not significant. *P<0.05. **P<0.01.

Figure 4

Downregulation of PKCζ does not affect the protein half-life of survivin. (A) HCT116 and SW480 cells were transfected with siPKCζ or siNSC, incubated for 24 h, after then half-life of survivin protein was monitored as described in Materials and methods. Left, western blotting; right, densitometric units of western blots represented as line graphs. (B) HCT116 and SW480 cells were transfected with p3xFLAG-survivin and subjected to immunoblotting analysis using anti-survivin antibody. (C) Ubiquitination status of survivin protein was analyzed as described in Materials and methods.

Correlatin of survivin and PKCζ expression levels in colon cancer

Expression levels of survivin and PKCζ were investigated in colon cancer specimens. Immunohistochemical analysis confirmed that survivin and PKCζ were expressed in 18 samples examined in this study. Generally, expression levels of these proteins were higher in cancer cells than neighboring normal cells (Fig. 5A). Moreover, expression levels of survivin and PKCζ were positively correlated (Fig. 5B, r=0.72, P=3.01×10−4).

Figure 5

Survivin and PKCζ expression levels correlate in colon cancer specimens. (A) Immunostaining for survivin (left) and PKCζ (right) in serial sections obtained from colon cancer tissues. Representative specimens after immunostaining for survivin and PKCζ are shown. Bright field images of immunostained tissues were captured using a digital camera (original magnification, ×100). (B) Relationship between immunostaining intensities of survivin and PKCζ in colon cancer specimens. Brightness of immunostaining was analyzed using Photoshop Elements software. Immunostaining intensities of survivin and PKCζ in cancer cells were calculated as a brightness ratio relative to non-neoplastic stromal cells.

siPKCζ sensitizes colon cancer cells to 5-FU

We next checked whether siPKCζ sensitizes colon cancer cells to 5-FU. SW480 cells were relatively more chemo-resistant than HCT116 cells (Fig. 6A). Transfection of siPKCζ enhanced caspase-3/7 activity in HCT116 and SW480 cells and sensitized HCT116 and SW480 cells to 5-FU (Fig. 6B).

Figure 6

siPKCζ sensitizes colon cancer cells to 5-FU. HCT116 and SW480 cells were treated with different concentrations of 5-FU as indicated for 24 h. Cell viability (A) and caspase-3/7 activity (B) were measured as described in Materials and methods. Relative luminescence signals to cells without 5-FU treatment were calculated and shown as bar graphs. Error bars denote standard deviation. NS, statistically not significant. *P<0.05. **P<0.01.

Discussion

In this study, we showed that PKCζ inhibits apoptosis by regulating survivin expression at the transcriptional level in colon cancer cells. Moreover, expression level of PKCζ and survivin correlated in colorectal cancer specimens, and silencing of PKCζ sensitized colon cancer cell lines to 5-FU, one of the key drugs in colon cancer chemotherapy (23).

Previously, the group of Quillet-Mary has shown that PKCζ is a component of DISC and inhibits Fas ligand-induced apoptosis in leukemic cells (24,25). PKCζ is also known to phosphorylate mitochondrial protein Bax to abrogate its pro-apoptotic function (26). PKCζ plays an essential role in the activation of the nuclear factor (NF)-κB cell survival pathway (27). The result obtained in this study, upregulation of survivin, is a novel mechanism by which PKCζ in inhibiting apoptosis.

Survivin is a multifunctional protein that belongs to the inhibitor of apoptosis protein (IAP) family and confers chemo- and radio-resistance to cancer cells (28,29). Survivin inhibits apoptosis by stabilizing and enhancing anti-apoptotic activity of X-linked IAP, and by sequestering pro-apoptotic mitochondrial protein Smac/DIABLO (30–33). Transcription of BIRC5 is regulated by several distinct mechanisms. It is transcriptionally upregulated by TCF4, STAT3, PML4 and c-REL, and downregulated by p53 (34). ERK and AKT pathways have been shown to cooperate in the translational regulation of survivin (35). Among these transcription factors and pathways, the NF-κB pathway is activated by PKCζ (27,36). Thus, involvement of NF-κB in regulation of BIRC5a by PKCζ was studied. As shown in Fig. 7, siPKCζ reduced the activation of NF-κB. This result suggests that the NF-κB pathway may be involved in survivin regulation by PKCζ.

Figure 7

siPKCζ reduces activation of NF-κB. (A) SW480 cells transfected with siRNA against siPKCζ or siNSC were treated with or without TNF-α (20 ng/ml) for times depicted in the figure. The nuclear extracts were subjected to immunoblotting analysis using anti-p65 antibody. (B) SW480 cells were treated with or without TNF-α (20 ng/ml) for 30 min. The cells were transfected with siRNA against siPKCζ or siNSC and they were subjected to immunofluorescence study using anti-p65 antibody. Green, p65. Blue, nuclei.

Proteins are synthesized and degraded equally at steady state. The effect of siRNAs on the level of expression of a protein largely depends on its turnover. Protein with a short half-life elicits dramatic decrease after gene-silencing whereas transient knock-down of a gene presents little impact on the expression level of proteins presenting longer half-life (37). From the results of Fig. 4A and previous studies (38), survivin has a short half-life. siPKCζ reduced the expression level of BIRC5 mRNA to ~70% compared to siNSC in HCT116 and SW480 cells (Fig. 3). However, it decreased survivin protein levels to less than half of that of cells transfected with siNSC (Fig. 2). Results from this gene-silencing experiment indicate that approximately one third of BIRC5 mRNA is dependent on PKCζ and that targeting PKCζ is sufficient to reduce survivin expression levels for sensitization of colon cancer cells to apoptotic stimuli (Figs. 1 and 6).

TRAIL belongs to the TNF superfamily and gathers expectations as an anticancer drug because it kills a wide variety of transformed cells while sparing normal cells in vitro and in vivo (39). Recombinant human TRAIL and agonistic antibodies against its cognate receptors are undergoing clinical trials; they show low toxicity, although, small therapeutic effects have been observed when they are used as a monotherapy (40). Studies in the field are currently focusing on TRAIL-resistance mechanisms and finding TRAIL sensitizers. Results of this study revealed that PKCζ may be a potential therapeutic target to overcome TRAIL-resistance in colon cancer.

The PKC family consists of 10 serine/threonine protein kinases, which are divided into three subfamilies based on their dependency on phospholipids and Ca2+. PKC isoforms are regulators of cell life and death. Generally, PKCα, PKCɛ, PKCζ and PKCι/λ are anti-apoptotic; PKCδ is pro-apoptotic (41). Atypical PKCs, PKCζ and PKCι/λ, share homology with each other and PKCι/λ is considered as an oncogene (42). This study leaves two unexplained aspects. The first is the determination of the common and distinct functions of PKCζ and PKCι/λ in the apoptotic pathway. AKT is another anti-apoptotic kinase in the PI3K pathway that is dependent of PIP. Thus, the second unexplained aspect is the possibility of crosstalk between AKT and PKCζ. Accumulating evidence led us to understand that there are tuned wirings in the apoptotic pathway (43–45). Revealing the relative contributions as well as crosstalk of these anti-apoptotic proteins to the cell death pathway require futher studies.

Acknowledgements

This study was supported by the Grants-in-Aid from Scientific Research in Japan (Grant no. 21790542, to K.K.).

References

1 

Vivanco I and Sawyers CL: The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer. 2:489–501. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Cully M, You H, Levine AJ and Mak TW: Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat Rev Cancer. 6:184–192. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Karakas B, Bachman KE and Park BH: Mutation of the PIK3CA oncogene in human cancers. Br J Cancer. 94:455–459. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Liaw D, Marsh DJ, Li J, et al: Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet. 16:64–67. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Castellano E and Downward J: Role of RAS in the regulation of PI 3-kinase. Curr Top Microbiol Immunol. 346:143–169. 2010.PubMed/NCBI

6 

Chan SK, Gullick WJ and Hill ME: Mutations of the epidermal growth factor receptor in non-small cell lung cancer - search and destroy. Eur J Cancer. 42:17–23. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Ross JS and Fletcher JA: The HER-2/neu oncogene in breast cancer: prognostic factor, predictive factor, and target for therapy. Stem Cells. 16:413–428. 1998. View Article : Google Scholar

8 

Quintas-Cardama A and Cortes J: Molecular biology of bcr-abl1-positive chronic myeloid leukemia. Blood. 113:1619–1630. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Alessi DR, James SR, Downes CP, et al: Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol. 7:261–269. 1997. View Article : Google Scholar

10 

Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P and Parker PJ: Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science. 281:2042–2045. 1998.

11 

Chou MM, Hou W, Johnson J, et al: Regulation of protein kinase C zeta by PI 3-kinase and PDK-1. Curr Biol. 8:1069–1077. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Diaz-Meco MT, Lozano J, Municio MM, et al: Evidence for the in vitro and in vivo interaction of Ras with protein kinase C zeta. J Biol Chem. 269:31706–31710. 1994.PubMed/NCBI

13 

Kuribayashi K, Nakamura K, Tanaka M, et al: Essential role of protein kinase C zeta in transducing a motility signal induced by superoxide and a chemotactic peptide, fMLP. J Cell Biol. 176:1049–1060. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Valkov A, Sorbye SW, Kilvaer TK, et al: The prognostic impact of TGF-beta1, fascin, NF-kappaB and PKC-zeta expression in soft tissue sarcomas. PLoS One. 6:e175072011. View Article : Google Scholar : PubMed/NCBI

15 

Yu LR, Lv JQ, Jin LY, et al: Over-expression of protein kinase Cisoforms (alpha, delta, theta and zeta) in squamous cervical cancer. Neoplasma. 58:491–498. 2011.PubMed/NCBI

16 

Yao S, Bee A, Brewer D, et al: PRKC-zeta expression promotes the aggressive phenotype of human prostate cancer cells and is a novel target for therapeutic intervention. Genes Cancer. 1:444–464. 2010. View Article : Google Scholar

17 

Schonwasser DC, Marais RM, Marshall CJ and Parker PJ: Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol Cell Biol. 18:790–798. 1998.

18 

Cohen EE, Lingen MW, Zhu B, et al: Protein kinase C zeta mediates epidermal growth factor-induced growth of head and neck tumor cells by regulating mitogen-activated protein kinase. Cancer Res. 66:6296–6303. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Sun R, Gao P, Chen L, et al: Protein kinase C zeta is required for epidermal growth factor-induced chemotaxis of human breast cancer cells. Cancer Res. 65:1433–1441. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Datta K, Li J, Bhattacharya R, Gasparian L, Wang E and Mukhopadhyay D: Protein kinase C zeta transactivates hypoxia-inducible factor alpha by promoting its association with p300 in renal cancer. Cancer Res. 64:456–462. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Jhawer M, Goel S, Wilson AJ, et al: PIK3CA mutation/PTEN expression status predicts response of colon cancer cells to the epidermal growth factor receptor inhibitor cetuximab. Cancer Res. 68:1953–1961. 2008. View Article : Google Scholar

22 

Kim SH, Kim K, Kwagh JG, et al: Death induction by recombinant native TRAIL and its prevention by a caspase 9 inhibitor in primary human esophageal epithelial cells. J Biol Chem. 279:40044–40052. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Saltz LB, Cox JV, Blanke C, et al: Irinotecan plus fluorouracil and leucovorin for metastatic colorectal cancer. Irinotecan Study Group. N Engl J Med. 343:905–914. 2000. View Article : Google Scholar : PubMed/NCBI

24 

de Thonel A, Bettaieb A, Jean C, Laurent G and Quillet-Mary A: Role of protein kinase C zeta isoform in Fas resistance of immature myeloid KG1a leukemic cells. Blood. 98:3770–3777. 2001.PubMed/NCBI

25 

Leroy I, de Thonel A, Laurent G and Quillet-Mary A: Protein kinase C zeta associates with death inducing signaling complex and regulates Fas ligand-induced apoptosis. Cell Signal. 17:1149–1157. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Xin MG, Gao FQ, May WS, Flagg T and Deng XM: Protein kinase C zeta abrogates the proapoptotic function of bax through phosphorylation. J Biol Chem. 282:21268–21277. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Moscat J, Rennert P and Diaz-Meco MT: PKCzeta at the crossroad of NF-kappaB and Jak1/Stat6 signaling pathways. Cell Death Differ. 13:702–711. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Asanuma K, Kobayashi D, Furuya D, Tsuji N, Yagihashi A and Watanabe N: A role for survivin in radioresistance of pancreatic cancer cells. Jpn J Cancer Res. 93:1057–1062. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Nakamura M, Tsuji N, Asanuma K, et al: Survivin as a predictor of cis-diamminedichloroplatinum sensitivity in gastric cancer patients. Cancer Sci. 95:44–51. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Ceballos-Cancino G, Espinosa M, Maldonado V and Melendez-Zajgla J: Regulation of mitochondrial Smac/DIABLO-selective release by survivin. Oncogene. 26:7569–7575. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Dohi T, Okada K, Xia F, et al: An IAP-IAP complex inhibits apoptosis. J Biol Chem. 279:34087–34090. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Dohi T, Xia F and Altieri DC: Compartmentalized phosphorylation of IAP by protein kinase A regulates cytoprotection. Mol Cell. 27:17–28. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Song Z, Yao X and Wu M: Direct interaction between survivin and Smac/DIABLO is essential for the anti-apoptotic activity of survivin during taxol-induced apoptosis. J Biol Chem. 278:23130–23140. 2003. View Article : Google Scholar

34 

Altieri DC: Survivin, cancer networks and pathway-directed drug discovery. Nat Rev Cancer. 8:61–70. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Ye Q, Cai W, Zheng Y, Evers BM and She QB: ERK and AKT signaling cooperate to translationally regulate survivin expression for metastatic progression of colorectal cancer. Oncogene. Apr 29–2013.(Epub ahead of print). View Article : Google Scholar

36 

Diaz-Meco MT and Moscat J: The atypical PKCs in inflammation: NF-kappaB and beyond. Immunol Rev. 246:154–167. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Lee WC, Berry R, Hohenstein P and Davies J: siRNA as a tool for investigating organogenesis: The pitfalls and the promises. Organogenesis. 4:176–181. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Zhao J, Tenev T, Martins LM, Downward J and Lemoine NR: The ubiquitin-proteasome pathway regulates survivin degradation in a cell cycle-dependent manner. J Cell Sci. 113:4363–4371. 2000.PubMed/NCBI

39 

Abdulghani J and El-Deiry WS: TRAIL receptor signaling and therapeutics. Expert Opin Ther Targets. 14:1091–1108. 2010. View Article : Google Scholar

40 

Dimberg LY, Anderson CK, Camidge R, Behbakht K, Thorburn A and Ford HL: On the TRAIL to successful cancer therapy? Predicting and counteracting resistance against TRAIL-based therapeutics. Oncogene. 32:1341–1350. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Reyland ME: Protein kinase C isoforms: multi-functional regulators of cell life and death. Front Biosci. 14:2386–2399. 2009. View Article : Google Scholar : PubMed/NCBI

42 

Murray NR, Kalari KR and Fields AP: Protein kinase Ciota expression and oncogenic signaling mechanisms in cancer. J Cell Physiol. 226:879–887. 2011. View Article : Google Scholar : PubMed/NCBI

43 

Kuribayashi K and El-Deiry WS: Regulation of programmed cell death by the p53 pathway. Adv Exp Med Biol. 615:201–221. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Kuribayashi K, Finnberg N, Jeffers JR, Zambetti GP and El-Deiry WS: The relative contribution of pro-apoptotic p53-target genes in the triggering of apoptosis following DNA damage in vitro and in vivo. Cell Cycle. 10:2380–2389. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Kuribayashi K, Mayes PA and El-Deiry WS: What are caspases 3 and 7 doing upstream of the mitochondria? Cancer Biol Ther. 5:763–765. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Umemori Y, Kuribayashi K, Nirasawa S, Kondoh T, Tanaka M, Kobayashi D and Watanabe N: Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer. Int J Oncol 45: 1043-1050, 2014.
APA
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., & Watanabe, N. (2014). Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer. International Journal of Oncology, 45, 1043-1050. https://doi.org/10.3892/ijo.2014.2489
MLA
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., Watanabe, N."Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer". International Journal of Oncology 45.3 (2014): 1043-1050.
Chicago
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., Watanabe, N."Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer". International Journal of Oncology 45, no. 3 (2014): 1043-1050. https://doi.org/10.3892/ijo.2014.2489
Copy and paste a formatted citation
x
Spandidos Publications style
Umemori Y, Kuribayashi K, Nirasawa S, Kondoh T, Tanaka M, Kobayashi D and Watanabe N: Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer. Int J Oncol 45: 1043-1050, 2014.
APA
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., & Watanabe, N. (2014). Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer. International Journal of Oncology, 45, 1043-1050. https://doi.org/10.3892/ijo.2014.2489
MLA
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., Watanabe, N."Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer". International Journal of Oncology 45.3 (2014): 1043-1050.
Chicago
Umemori, Y., Kuribayashi, K., Nirasawa, S., Kondoh, T., Tanaka, M., Kobayashi, D., Watanabe, N."Protein kinase C ζ regulates survivin expression and inhibits apoptosis in colon cancer". International Journal of Oncology 45, no. 3 (2014): 1043-1050. https://doi.org/10.3892/ijo.2014.2489
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team