Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
November-2014 Volume 45 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2014 Volume 45 Issue 5

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma

  • Authors:
    • Mitsuro Kanda
    • Hiroyuki Sugimoto
    • Shuji Nomoto
    • Hisaharu Oya
    • Dai Shimizu
    • Hideki Takami
    • Ryoji Hashimoto
    • Fuminori Sonohara
    • Yukiyasu Okamura
    • Suguru Yamada
    • Tsutomu Fujii
    • Goro Nakayama
    • Masahiko Koike
    • Michitaka Fujiwara
    • Yasuhiro Kodera
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterological Surgery (Surgery II), Nagoya University Graduate School of Medicine, Nagoya, Japan
  • Pages: 2005-2012
    |
    Published online on: September 3, 2014
       https://doi.org/10.3892/ijo.2014.2637
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Identification of novel genetic and epigenetic alterations is required for optimal stratification of patients with hepatocellular carcinoma (HCC) at risk for recurrence and adverse prognosis. Coenzyme Q10 (CoQ10), which mediates apoptosis, is synthesized by prenyl diphosphate synthase subunit 2 (PDSS2). In the present study we evaluated the clinical significance and regulatory mechanisms of PDSS2 expression in HCC. PDSS2 expression levels and those of genes encoding potentially interacting proteins as well as the methylation status of the PDSS2 promoter region were analyzed in HCC cell lines. PDSS2 mRNA levels in 151 pairs of resected specimens were determined to evaluate the association of PDSS2 expression and clinicopathological factors. The expression and distribution of PDSS2 were determined using immunohistochemistry. PDSS2 mRNA expression was decreased in six of nine HCC cell lines and significantly correlated with those of hepatocyte nuclear factor 4α. PDSS2 transcription in HCC cells with decreased PDSS2 expression accompanying hypermethylation was reactivated after treating these cells with a methylation inhibitor. Mean expression levels of PDSS2 mRNA relative to that of uninvolved liver diminished gradually in the order of chronic hepatitis to cirrhosis, and each was significantly higher than those of HCCs. PDSS2 and PDSS2 mRNA levels were consistent. Decreased PDSS2 mRNA levels were detected in HCC tissues of 56 patients, correlated with shorter disease-specific survival, and was identified as an independent prognostic factor. PDSS2 is a putative tumor suppressor, and promoter hypermethylation is a key regulatory mechanism in HCC. Decreased levels of PDSS2 mRNA expression may represent a novel biomarker of HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide and is the main cause of death among cirrhotic patients (1–3). Patients diagnosed with HCC have a poor prognosis because of the aggressive nature of the disease (4,5), and surgical resection or local ablation therapy is effective only at an early stage (6). Furthermore, ~70% of these patients develop recurrent tumors within five years after curative surgery (7). Recurrence of HCC, including multicentric hepatocarcinogenesis and intrahepatic metastasis, is a key prognostic factor, but it is difficult to distinguish patients at high risk for recurrence and subsequent adverse prognosis using only clinical staging systems comprising tumor characteristics and liver function (1,8). Therefore, a novel approach for predicting progression and recurrence of HCC is urgently required.

Liver damage and the increased incidence of HCC (chronic viral hepatitis B and C, alcohol consumption and aflatoxin) have multiple causes (5,9,10). Furthermore, as with other malignancies, the initiation of HCC is a multistep process, and because it is characterized by high molecular variability, clinical management requires a more complex approach (11).

Although recent research along with the development of new genomic technologies establishes that the development and progression of HCC are caused by the accumulation of genetic and epigenetic alterations (12–14), the detailed underlying mechanisms have not been determined. Therefore, identifying molecular markers for HCC, particularly those that may predict recurrence, is important, because stratification of patients at risk for recurrence facilitates individualized management, including intensive surveillance and aggressive adjuvant therapy for high-risk patients.

Prenyl diphosphate synthase subunit 2 (PDSS2) was identified in 2005 (15), it encodes the second subunit of prenyl diphosphate synthase, which is an essential enzyme involved in the biosynthesis of coenzyme Q10 (CoQ10), and PDSS2 determines the side-chain length of mammalian ubiquinones (16). CoQ10 is synthesized from mevalonic acid in the liver and plays a vital role in the mitochondrial respiratory chain, pyrimidine nucleoside biosynthesis and the modulation of cell apoptosis (17). Aberrant expression of PDSS2 in the liver may cause DNA damage and disrupt the cell cycle through inhibition of CoQ10 synthesis, leading to initiation and progression of HCC (18,19). Furthermore, chronic inflammation caused by hepatitis virus infection might affect PDSS2 expression. Although evidence indicates that PDSS2 suppresses the development of malignant melanoma and lung cancer (16,20), the clinical significance and regulatory mechanisms of PDSS2 expression in HCC remain undefined.

Therefore, we attempted to answer these questions in the present study by analyzing PDSS2 expression in HCC to identify novel, clinically significant biomarkers for progression and recurrence of HCC. To the best of our knowledge, this is the first report to determine PDSS2 expression levels in HCC.

Materials and methods

Sample collection

Nine HCC cell lines (Hep3B, HepG2, HLE, HLF, HuH1, HuH2, HuH7, PLC/PRF/5 and SK-Hep1) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and were maintained as previously described (21). Primary HCC and non-cancerous tissues were collected from 151 patients who underwent liver resection for HCC at Nagoya University Hospital between January 1998 and July 2012. Clinicopathological data were collected from medical records. Specimens were classified histologically according to the 7th Edition of the Union for International Cancer Control classification (22).

Tissue samples were immediately flash-frozen in liquid nitrogen and stored at −80°C. RNA was extracted from ~5 mm2 diameter tumor samples without detectable necrotic areas comprising >80% tumor cells. The corresponding non-cancerous liver tissue samples that lacked regenerative or dysplastic nodules were collected from the same patient that were >2 cm distant from the edge of the tumor. The median duration of patient follow-up was 37.9 months (range, 0.37–147 months). Postoperative follow-up included physical examinations, measurement of serum tumor markers every three months, and enhanced computed tomography scans every six months. Treatment after recurrence was generally selected from one of the options as follows: surgery, radiofrequency ablation, transcatheter arterial chemoembolization, and chemotherapy, according to tumor status and liver function. Enrollees granted written informed consent for the use of clinical samples and data as required by the Institutional Review Board of Nagoya University, Japan.

Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). PDSS2

mRNA levels were determined using qRT-PCR. Total RNA (10 μg) was isolated from 9 HCC cell lines, 151 primary HCCs and adjacent non-cancerous tissues, and was used as a template for cDNA synthesis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA (TaqMan, GAPDH control reagents; Applied Biosystems, Foster City, CA, USA) was quantified in each sample for standardization. Quantitative real-time RT-PCR was performed using the SYBR® Green PCR Core Reagents kit (Applied Biosystems) as follows: one cycle at 95°C for 10 min, 40 cycles at 95°C for 5 sec, and 60°C for 60 sec. Real-time detection of the SYBR® Green fluoresence was conducted using an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems). Triplicate samples of 9 HCC cell lines and 151 clinical samples were analyzed. Samples without templates served as negative controls. The expression level of each sample is shown as the value of the PDSS2 amplicon divided by that of GAPDH (23). The primer sequences are listed in Table I. PDSS2 mRNA levels were considered downregulated in tumor tissues when they were <50% compared with those of the corresponding non-cancerous tissues.

Table I

Primers and annealing temperatures.

Table I

Primers and annealing temperatures.

GeneExperimentTypeSequence (5′-3′)Product size (bp)Annealing temperature (°C)
PDSS2qRT-PCRForward GAATCAGGTAGTGTCAGAGG18160
Reverse GAGGCTATTCCAGCTGTCATG
MSP methylatedForward TCGAAGTTGGATTCGAGGAT26362
Reverse AAACGTCGAACGAAAACACC
MSP unmethylatedForward GGTTGGTGGTGATAGTGATA19556
Reverse CAACAAATAATCCCTCTACAC
Bisulfite sequencingForward TGTTTGGTTGGGTTTTGAGG15258
ReverseCACCAACCCCTA ACA ATA AC
HNF4αqRT-PCRForward CGTGGTGGACAAAGACAAGA12860
Reverse CATAGCTTGACCTTCGAGTGC
CDX2qRT-PCRForward GGAACCTGTGCGAGTGGAT12860
Reverse GAAACTCCTTCTCCAGCTCC
GAPDHqRT-PCRForward GAAGGTGAAGGTCGGAGTC22660
Probe CAAGCTTCCCGTTCTCAGCC
Reverse GAAGATGGTGATGGGATTTC

[i] PDSS2, prenyl diphosphate synthase subunit 2; HNF4α, hepatocyte nuclear factor 4α; CDX2, caudal-related homeobox transcription factor 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, quantitative real-time reverse-transcription polymerase chain reaction; MSP, methylation specific PCR; bp, base pair.

Analysis of the promoter region of PDSS2

The nucleotide sequence of the PDSS2 promoter region was analyzed to determine the presence or absence of CpG islands defined as follows: at least a 200-bp region of DNA with a high HCC content (>50%) and an Observed CpG/Expected CpG ratio ≥0.6 (24,25). CpG Island Searcher software (http://cpgislands.usc.edu/) was employed to determine the locations of CpG islands (26).

Methylation-specific PCR (MSP) and bisulfite sequence analysis

PDSS2 possesses a CpG island near its promoter region, and we hypothesized that aberrant methylation regulates PDSS2 transcription in HCC. DNA samples from nine HCC cell lines treated with bisulfite were subjected to MSP. Genomic bisulfite-treated DNA from HCC cell lines was sequenced to ascertain whether the MSP amplification was reliable. The primer sequences used for MSP and bisulfite sequencing are listed in Table I. Bisulfite treatment and the sequencing procedure were performed as reported (27).

5-Aza-2′-deoxycytidine (5-aza-dC) treatment

To assess the relation of promoter hypermethylation to PDSS2 transcription, HCC cells (1.5×106) were treated with 5-aza-dC (Sigma-Aldrich, St. Louis, MO, USA) to inhibit DNA methylation and cultured for 6 days with medium changes on days 1, 3 and 5. RNA was extracted, and RT-PCR was performed as previously described (27).

Expression of genes encoding proteins potentially associated with PDSS2

The expression levels of hepatocyte nuclear factor 4α (HNF4α) and caudal-type homeobox transcription factor 2 (CDX2), which may associate with PDSS2 (20,28) were determined in HCC cell lines using qRT-PCR. The sequences of primers specific for HNF4α and CDX2 are listed in Table I.

Immunohistochemistry (IHC)

IHC analysis of the localization of PDSS2 was performed using a mouse monoclonal antibody against PDSS2 (ab119768; Abcam, Cambridge, UK) diluted 1:150 in antibody diluent (Dako, Glostrup, Denmark) to probe 30 representative sections of well-preserved HCC tissue previously described (2). Staining patterns were compared between HCCs and the corresponding normal adjacent tissues. To avoid subjectivity, the specimens were randomized and coded before analysis by two independent observers who were unaware of the status of the samples. Each observer evaluated all specimens at least twice to minimize intraobserver variation (29).

Statistical analysis

Correlations between the levels of PDSS2 mRNA with those of HNF4α and CDX2 were a nalyzed using the Spearman rank correlation test. Relative levels of mRNA expression (PDSS2/GAPDH) between HCC and non-cancerous tissues were analyzed using the Mann-Whitney U test. The χ2 test was used to analyze the significance of the association between the expression and methylation status of PDSS2 and clinicopathological parameters. Disease-specific and disease-free survival rates were calculated using the Kaplan-Meier method, and the difference in survival curves was analyzed using the log-rank test. We performed multivariate regression analysis using the Cox proportional hazards model to detect prognostic factors, and variables with P<0.05 were entered into the final model. All statistical analyses were performed using JMP 10 software (SAS Institute, Inc., Cary, NC, USA). P<0.05 was considered statistically significant.

Results

Identification of a CpG island in the PDSS2 promoter region

A CpG island was identified in the PDSS2 promoter region (Fig. 1A), leading to the hypothesis that hypermethylation of the CpG islands regulates the expression of PDSS2 in HCC.

Figure 1

(A) A CpG island was detected near the PDSS2 transcription initiation site, extending upstream into the promoter region. (B) Bar graphs indicate PDSS2 mRNA expression in HCC cell lines before or after 5-aza-dC treatment. The methylation status of the PDSS2 promoter is shown in the box. M, methylated; pM, partially methylated; U, unmethylated. (C) Representative results of bisulfite sequence analysis. All CpG sites in Hep3B cells were retained as CG and those of HepG2 cells were converted to TG.

PDSS2 mRNA expression and regulatory mechanisms in HCC cell lines

Significant decrease in PDSS2 mRNA levels was detected in 6 (67%) of 9 HCC cell lines compared with the mean expression level in 151 non-cancerous liver tissues (Fig. 1B). Hypermethylation of the PDSS2 promoter was detected in Hep3B, HuH2, HuH7 and SK-Hep1 cells (Fig. 1B). To determine whether hypermethylation of the PDSS2 promoter inhibited expression, PDSS2 mRNA expression levels were compared before and after treatment with the methylation inhibitor 5-aza-dC. PDSS2 mRNA levels were restored in cells with downregulated PDSS2 expression accompanying hypermethylation after 5-aza-dC treatment (Fig. 1B), indicating that promoter hypermethylation inhibited PDSS2 transcription in HCC.

Expression of genes encoding proteins potentially associated with PDSS2 in HCC cell lines

The relative mRNA expression levels of PDSS2, HNF4α and CDX2 in HCC cell lines are shown in Fig. 2A. PDSS2 expression levels significantly correlated with those of HNF4α (Fig. 2B).

Figure 2

(A) Analysis of PDSS2, HNF4α and CDX2 mRNA expression in HCC cell lines. (B) Comparison of mRNA expression levels between PDSS2, HNF4α and CDX2.

Patient characteristics

The mean age of the 151 patients was 64.6±9.7 years (range, 34–84 years), the male to female ratio was 5:1, and there were 37 and 84 patients with hepatitis B and C virus infections, respectively. Of the patients without HCC, 10, 87 and 54 presented with normal liver function, chronic hepatitis or cirrhosis, respectively. We classified 140 and 11 patients as Child-Pugh class A or B, respectively.

Expression levels of PDSS2 mRNA and protein in resected tissues

The mean level of PDSS2 mRNA compared with that of non-cancerous liver diminished gradually in the order of normal liver, chronic hepatitis and cirrhosis, indicating that chronic inflammation and fibrosis of non-cancerous liver decreased PDSS2 expression (Fig. 3A). In contrast, the type of hepatitis virus infection (hepatitis virus B, C or none) did not influence PDSS2 expression in non-cancerous liver tissues. PDSS2 mRNA expression was decreased in HCC tissues of 122 (81%) of 151 patients compared with that of the corresponding non-cancerous tissues. The mean expression level of PDSS2 mRNA was significantly lower in HCC tissues compared with that of the corresponding non-cancerous tissues (P<0.001; Fig. 3A). Moreover, poorly differentiated tumor cells expressed relatively lower levels of PDSS2 mRNA (Fig. 3B).

Figure 3

Analysis of the expression of PDSS2 in clinical specimens. (A) The mean level of PDSS2 mRNA expression was lower in HCC tissues compared with the corresponding non-cancerous tissues categorized by background uninvolved liver status. (B) Comparison of PDSS2 mRNA expression level among HCCs categorized by tumor differentiation. (C) Representative IHC data. PDSS2 was expressed at lower levels compared with non-cancerous adjacent tissue (magnified at ×100 and ×400). N, non-cancerous tissue; T, tumor tissue.

The expression of PDSS2 was analyzed using IHC. Representative sections with reduced PDSS2 staining in HCC tissues are shown in Fig. 3C. The overall staining intensities of 30 samples were consistent with mRNA levels detected using qRT-PCR.

Prognostic implications of PDSS2 mRNA expression levels

Fifty-six (37%) of 151 patients were categorized with decreased PDSS2 mRNA levels in HCC tissues compared with noncancerous tissues. The disease-specific survival rate of patients with HCC with decreased PDSS2 mRNA was significantly lower compared with those without this factor (5-year survival rates, 51 and 74%, respectively, P=0.001; Fig. 4A). Decreased PDSS2 mRNA expression in patients with HCCs was significantly associated with uninvolved liver status, preoperative serum α-fetoprotein >20 ng/ml, tumor size ≥3.0 cm, tumor differentiation (moderate to poor), serosal infiltration, septum formation and advanced UICC stage (Table II). Multivariate analysis identified decreased PDSS2 mRNA expression as an independent prognostic factor (hazard ratio 2.45, 95% confidence interval 1.27–4.80, P=0.008; Table III). Patients with HCC with decreased PDSS2 mRNA levels experienced significantly earlier recurrences compared with those without (2-year recurrence-free survival rates, 38 and 59%, respectively, P=0.021; Fig. 4B). A stepwise decrease of PDSS mRNA expression in patients with HCC correlated with UICC stage (Fig. 4C).

Figure 4

Prognostic significance of PDSS2 mRNA expression in patients with HCC. (A) Disease-specific survival of patients with decreased PDSS2 mRNA in HCC was significantly shorter than those without. (B) Recurrencefree survival of patients with decreased PDSS2 mRNA was significantly shorter than those without. (C) PDSS2 expression levels in each UICC stage.

Table II

Association between expression levels of PDSS2 mRNA and clinicopathological parameters in 151 patients with hepatocellular carcinoma (HCC).

Table II

Association between expression levels of PDSS2 mRNA and clinicopathological parameters in 151 patients with hepatocellular carcinoma (HCC).

Clinicopathological parametersDecreased PDSS2 in HCCs (n=56)Others (n=95)P-value
Age (years)
 <6526410.696
 ≥653054
Gender
 Male50760.128
 Female619
Background liver
 Normal liver19
 Chronic hepatitis38490.046a
 Cirrhosis1737
Pugh-Child’s classification
 A52880.959
 B47
Hepatitis virus
 Absent1317
 HBV15220.551
 HCV2856
AFP (ng/ml)
 ≤201863<0.001a
 >203832
PIVKA II (mAU/ml)
 ≤4016420.054
 >404053
Tumor multiplicity
 Solitary43740.875
 Multiple1321
Tumor size (cm)
 <3.012350.045a
 ≥3.04460
Differentiation
 Well7280.014a
 Moderate to poor4967
Growth type
 Expansive growth43840.063
 Invasive growth1311
Serosal infiltration
 Absent35790.005a
 Present2116
Formation of capsule
 Absent17300.875
 Present3965
Infiltration to capsule
 Absent24440.680
 Present3251
Septum formation
 Absent13400.017a
 Present4355
Vascular invasion
 Absent3381<0.001a
 Present2314
UICC pathological stage
 I27670.014a
 II1821
 III117

a Statistically significant difference (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn3-ijo-45-05-2005'] } HBV, hepatitis B virus; HCV, hepatitis C virus; AFP, α-fetoprotein; PIVKA, protein induced by vitamin K antagonists; UICC, Union for International Cancer Control.

Table III

Prognostic factors of 151 patients with hepatocellular carcinoma (HCC).

Table III

Prognostic factors of 151 patients with hepatocellular carcinoma (HCC).

Univariate analysisMultivariable analysis


VariablesnHazard ratio95% CIP-valueHazard ratio95% CIP-value
Age (≥65 years)841.921.07–3.570.030a1.700.92–3.250.090
Gender (male)1261.270.60–3.130.553
Background liver (cirrhosis)541.580.88–2.810.123
Pugh-Child’s classification (B)110.930.28–2.320.889
AFP (>20 ng/ml)701.901.07–3.420.029a1.090.57–2.100.785
PIVKA II (>40 mAU/ml)932.101.14–4.070.016a1.200.62–2.490.595
Tumor multiplicity (multiple)342.091.11–3.760.023a1.800.92–3.410.085
Tumor size (≥3.0 cm)1042.201.13–4.710.020a1.400.63–3.430.418
Tumor differentiation (well)350.550.25–1.100.095
Growth type (invasive growth)241.440.69–2.760.318
Serosal infiltration372.511.32–4.610.006a1.140.56–2.250.712
Formation of capsule1041.050.57–2.020.884
Infiltration to capsule831.200.67–2.180.537
Septum formation980.870.49–1.600.651
Vascular invasion373.401.87–6.07<0.001a1.850.94–3.660.076
Margin status (positive)282.641.42–4.730.003a2.601.36–4.840.005a
Decreased PDSS2 in HCC562.521.41–4.520.002a2.451.27–4.800.008a

a Statistically significant (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn5-ijo-45-05-2005'] } CI, confidence interval; AFP, α-fetoprotein; PIVKA, protein induced by vitamin K antagonists. Univariate analysis was performed using the log-rank test. Multivariate analysis was performed using the Cox proportional hazards model.

Discussion

In the present study, our data support the role of PDSS2 as a suppressor of HCC. PDSS2 mRNA was differentially expressed by HCC cell lines and was decreased in 81% of the HCC tissues. Hypermethylation of the PDSS2 promoter was detected in four HCC cell types that expressed low levels of PDSS2 mRNA. Moreover, PDSS2 mRNA synthesis was reactivated after demethylation, indicating that promoter hypermethylation regulated PDSS2 transcription. To the best of our knowledge, the present study is the first to show a correlation between the expression and methylation status of PDSS2. However, decreased transcription of PDSS2 was detected in some HCC cells without hypermethylation of the PDSS2 promoter. Because PDSS2 is located within chromosome 6q16.3-21, a site of frequent loss of heterozygosity (LOH) in HCC (30,31), we consider LOH as a possible alternative factor leading to dysregulation.

Recent in silico pathway analysis suggests that PDSS2 interacts with HNF4α, a nuclear transcription factor that acts as a tumor suppressor and regulates the expression of many genes involved in cell growth and proliferation (20,32). CDX2 is a tumor suppressor of various malignancies and interacts with HNF4α (28,33). Accordingly, the correlations of mRNA expression between PDSS2, HNF4α and CDX2 were evaluated, and we found that the expression of PDSS2 correlated positively with that of HNF4α. These findings support the function of PDSS2 as a suppressor of HCC, and further pathway analysis will be required to support this conclusion.

PDSSs are heterotetrameric enzymes comprising subunits encoded by PDSS1 (10p12.1) and PDSS2 (15,16). In the absence of prenyl diphosphate synthase activity, CoQ10 is not synthesized (15). Therefore, decreased expression of PDSS2 in the liver tissues may lead to reduced synthesis of CoQ10 by hepatocytes, resulting in the inhibition of tumor suppressors (17,18).

Similar to patients with malignant melanoma and lung cancer, most patients with HCC harbored decreased levels of PDSS2 mRNA in HCC tissues, and their mean level of PDSS2 expression was significantly decreased in HCC tissues compared with non-cancerous liver tissues (16,20). Notably, we show here a stepwise decrease of PDSS2 expression accompanied with chronic inflammation and fibrosis of uninvolved liver. Moreover, our data link the level of PDSS2 expression to tumor differentiation. Taken together, these results suggest that PDSS2 plays a role in suppressing multistep hepatocarcinogenesis.

Because the IHC and qRT-PCR data were consistent, we used the latter to assess the prognostic significance of PDSS2 mRNA levels in a quantitative manner (24,29). We found that decreased PDSS2 mRNA expression in HCCs was significantly associated with more aggressive tumor features, including elevated preoperative serum α-fetoprotein, larger tumor size and serosal infiltration, and therefore, was identified as an independent prognostic factor. Moreover, patients with decreased PDSS2 mRNA levels in their tumor tissues experienced significantly earlier recurrence after curative hepatectomy. Furthermore, the degree of the decrease in PDSS2 expression correlated with UICC stage, indicating that the level of PDSS2 expression reflects the severity of the malignant phenotype of HCC.

Our evidence that PDSS2 act as a tumor suppressor is as follows: i) decreased expression of PDSS2 was frequently detected and the mean level of PDSS2 expression was significantly lower in HCC tissues, and ii) decreased expression of PDSS2 was associated with shorter recurrence free survival and subsequent poor prognosis. PDSS2 expression levels in biopsy or resected tissues may be useful for the prediction of recurrence and poor prognosis, which will facilitate efforts to devise an efficacious therapeutic strategy.

Our data support the conclusion that PDSS2 acts as a tumor suppressor and that its expression is regulated by promoter hypermethylation in HCC. Moreover, decreased expression of PDSS2 mRNA may represent a novel biomarker for predicting the progression and recurrence of HCC.

References

1 

Minguez B and Lachenmayer A: Diagnostic and prognostic molecular markers in hepatocellular carcinoma. Dis Markers. 31:181–190. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Kanda M, Nomoto S, Oya H, et al: Downregulation of DENND2D by promoter hypermethylation is associated with early recurrence of hepatocellular carcinoma. Int J Oncol. 44:44–52. 2014.PubMed/NCBI

3 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar

4 

El-Serag HB and Rudolph KL: Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology. 132:2557–2576. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Shiraha H, Yamamoto K and Namba M: Human hepatocyte carcinogenesis (review). Int J Oncol. 42:1133–1138. 2013.PubMed/NCBI

6 

El-Serag HB: Hepatocellular carcinoma: recent trends in the United States. Gastroenterology. 127:S27–S34. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Kanda M, Nomoto S, Nishikawa Y, et al: Correlations of the expression of vascular endothelial growth factor B and its isoforms in hepatocellular carcinoma with clinico-pathological parameters. J Surg Oncol. 98:190–196. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Llovet JM, Burroughs A and Bruix J: Hepatocellular carcinoma. Lancet. 362:1907–1917. 2003. View Article : Google Scholar

9 

Kanda M, Nomoto S, Okamura Y, et al: Promoter hypermethylation of fibulin 1 gene is associated with tumor progression in hepatocellular carcinoma. Mol Carcinog. 50:571–579. 2011. View Article : Google Scholar : PubMed/NCBI

10 

El-Serag HB and Mason AC: Rising incidence of hepatocellular carcinoma in the United States. N Engl J Med. 340:745–750. 1999. View Article : Google Scholar : PubMed/NCBI

11 

Villanueva A, Newell P, Chiang DY, Friedman SL and Llovet JM: Genomics and signaling pathways in hepatocellular carcinoma. Semin Liver Dis. 27:55–76. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Miki D, Ochi H, Hayes CN, Aikata H and Chayama K: Hepatocellular carcinoma: towards personalized medicine. Cancer Sci. 103:846–850. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Kanda M, Nomoto S, Okamura Y, et al: Detection of metallothionein 1G as a methylated tumor suppressor gene in human hepatocellular carcinoma using a novel method of double combination array analysis. Int J Oncol. 35:477–483. 2009.

14 

Herath NI, Leggett BA and MacDonald GA: Review of genetic and epigenetic alterations in hepatocarcinogenesis. J Gastroenterol Hepatol. 21:15–21. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Saiki R, Nagata A, Kainou T, Matsuda H and Kawamukai M: Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans. FEBS J. 272:5606–5622. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Fung JM, Smith R, Brown MA, et al: Identification and characterization of a novel melanoma tumor suppressor gene on human chromosome 6q21. Clin Cancer Res. 15:797–803. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Turunen M, Olsson J and Dallner G: Metabolism and function of coenzyme Q. Biochim Biophys Acta. 1660:171–199. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Quinzii CM, DiMauro S and Hirano M: Human coenzyme Q10 deficiency. Neurochem Res. 32:723–727. 2007. View Article : Google Scholar

19 

DiMauro S, Quinzii CM and Hirano M: Mutations in coenzyme Q10 biosynthetic genes. J Clin Invest. 117:587–589. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Chen P, Yu J, Knecht J and Chen Q: Decrease of PDSS2 expression, a novel tumor suppressor, in non-small cell lung cancer. Cancer Epidemiol. 37:166–171. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Takami H, Kanda M, Oya H, et al: Evaluation of MAGE-D4 expression in hepatocellular carcinoma in Japanese patients. J Surg Oncol. 108:557–562. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Sobin LH, Gospodarowicz MK and Wittekind Ch: International Union Against Cancer: TNM Classification of Malignant Tumors. 7th edition. Wiley-Blackwell; New York: 2009

23 

Oya H, Kanda M, Takami H, et al: Overexpression of melanomaassociated antigen D4 is an independent prognostic factor in squamous cell carcinoma of the esophagus. Dis Esophagus. Oct 2–2013.(Epub ahead of print). View Article : Google Scholar

24 

Kanda M, Shimizu D, Nomoto S, et al: Prognostic impact of expression and methylation status of DENN/MADD domaincontaining protein 2D in gastric cancer. Gastric Cancer. Apr 3–2014.(Epub ahead of print).

25 

Shimizu D, Kanda M, Nomoto S, et al: Identification of intragenic methylation in the TU SC1 gene as a novel prognostic marker of hepatocellular carcinoma. Oncol Rep. 31:1305–1313. 2014.PubMed/NCBI

26 

Takai D and Jones PA: The CpG island searcher: a new WWW resource. In Silico Biol. 3:235–240. 2003.PubMed/NCBI

27 

Hibino S, Kanda M, Oya H, et al: Reduced expression of DENND2D through promoter hypermethylation is an adverse prognostic factor in squamous cell carcinoma of the esophagus. Oncol Rep. 31:693–700. 2014.PubMed/NCBI

28 

Saandi T, Baraille F, Derbal-Wolfrom L, et al: Regulation of the tumor suppressor homeogene Cdx2 by HNF4alpha in intestinal cancer. Oncogene. 32:3782–3788. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Kanda M, Shimizu D, Nomoto S, et al: Clinical significance of expression and epigenetic profiling of TU SC1 in gastric cancer. J Surg Oncol. 110:136–144. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Nagai H, Pineau P, Tiollais P, Buendia MA and Dejean A: Comprehensive allelotyping of human hepatocellular carcinoma. Oncogene. 14:2927–2933. 1997. View Article : Google Scholar : PubMed/NCBI

31 

Li SP, Wang HY, Li JQ, et al: Genome-wide analyses on loss of heterozygosity in hepatocellular carcinoma in Southern China. J Hepatol. 34:840–849. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Walesky C, Edwards G, Borude P, et al: Hepatocyte nuclear factor 4 alpha deletion promotes diethylnitrosamine-induced hepatocellular carcinoma in rodents. Hepatology. 57:2480–2490. 2013. View Article : Google Scholar

33 

Ehehalt F, Rummele P, Kersting S, et al: Hepatocyte nuclear factor (HNF) 4alpha expression distinguishes ampullary cancer subtypes and prognosis after resection. Ann Surg. 254:302–310. 2011. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kanda M, Sugimoto H, Nomoto S, Oya H, Shimizu D, Takami H, Hashimoto R, Sonohara F, Okamura Y, Yamada S, Yamada S, et al: Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma. Int J Oncol 45: 2005-2012, 2014.
APA
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H. ... Kodera, Y. (2014). Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma. International Journal of Oncology, 45, 2005-2012. https://doi.org/10.3892/ijo.2014.2637
MLA
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H., Hashimoto, R., Sonohara, F., Okamura, Y., Yamada, S., Fujii, T., Nakayama, G., Koike, M., Fujiwara, M., Kodera, Y."Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma". International Journal of Oncology 45.5 (2014): 2005-2012.
Chicago
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H., Hashimoto, R., Sonohara, F., Okamura, Y., Yamada, S., Fujii, T., Nakayama, G., Koike, M., Fujiwara, M., Kodera, Y."Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma". International Journal of Oncology 45, no. 5 (2014): 2005-2012. https://doi.org/10.3892/ijo.2014.2637
Copy and paste a formatted citation
x
Spandidos Publications style
Kanda M, Sugimoto H, Nomoto S, Oya H, Shimizu D, Takami H, Hashimoto R, Sonohara F, Okamura Y, Yamada S, Yamada S, et al: Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma. Int J Oncol 45: 2005-2012, 2014.
APA
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H. ... Kodera, Y. (2014). Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma. International Journal of Oncology, 45, 2005-2012. https://doi.org/10.3892/ijo.2014.2637
MLA
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H., Hashimoto, R., Sonohara, F., Okamura, Y., Yamada, S., Fujii, T., Nakayama, G., Koike, M., Fujiwara, M., Kodera, Y."Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma". International Journal of Oncology 45.5 (2014): 2005-2012.
Chicago
Kanda, M., Sugimoto, H., Nomoto, S., Oya, H., Shimizu, D., Takami, H., Hashimoto, R., Sonohara, F., Okamura, Y., Yamada, S., Fujii, T., Nakayama, G., Koike, M., Fujiwara, M., Kodera, Y."Clinical utility of PDSS2 expression to stratify patients at risk for recurrence of hepatocellular carcinoma". International Journal of Oncology 45, no. 5 (2014): 2005-2012. https://doi.org/10.3892/ijo.2014.2637
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team