Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
February-2015 Volume 46 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2015 Volume 46 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells

  • Authors:
    • Qin Ru
    • Xiang Tian
    • Ming‑Shan Pi
    • Lin Chen
    • Kai Yue
    • Qi Xiong
    • Bao‑Miao Ma
    • Chao‑Ying Li
  • View Affiliations / Copyright

    Affiliations: Wuhan Institutes of Biomedical Sciences, Jianghan University, Wuhan, Hubei 430056, P.R. China
  • Pages: 833-840
    |
    Published online on: November 25, 2014
       https://doi.org/10.3892/ijo.2014.2777
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Accumulating evidence has proved that potassium channels (K+ channels) are involved in regulating cell proliferation, cell cycle progression and apoptosis of tumor cells. However, the precise cellular mechanisms are still unknown. In the present study, we investigated the effect and mechanisms of quinidine, a commonly used voltage‑gated K+ channel blocker, on cell proliferation and apoptosis of human glioma U87‑MG cells. We found that quinidine significantly inhibited the proliferation of U87‑MG cells and induced apoptosis in a dose‑dependent manner. The results of caspase colorimetric assay showed that the mitochondrial pathway was the main mode involved in the quinidine‑induced apoptotic process. Furthermore, the concentration range of quinidine, which inhibited voltage‑gated K+ channel currents in electrophysiological assay, was consistent with that of quinidine inhibiting cell proliferation and inducing cell apoptosis. In U87‑MG cells treated with quinidine (100 µmol/l), 11 of 2,042 human microRNAs (miRNAs) were upregulated and 16 were downregulated as detected with the miRNA array analysis. The upregulation of miR‑149‑3p and downregulation of miR‑424‑5p by quinidine treatment were further verified by using quantitative real‑time PCR. In addition, using miRNA target prediction program, putative target genes related to cell prolif­eration and apoptosis for two differentially expressed miRNAs were predicted. Taken together, these data suggested that the anti‑proliferative and pro‑apoptosis effect of voltage‑gated K+ channel blocker quinidine in human glioma cells was mediated at least partly through regulating expression of miRNAs, and provided further support for the mechanisms of voltage‑gated K+ channels in mediating cell proliferation and apoptosis.

Introduction

Potassium channels (K+ channels) are the most diverse ion channels on the plasma membrane of mammalian cells (1). Accumulating evidence has proved that a variety of K+ channels, including voltage-gated (2), calcium-activated (3), two-pore domain (4) and inward rectifier (5) K+ channels are overexpressed in tumorous tissues compared to their healthy counterparts. They control the membrane potential as well as electrical signaling and are known to be involved in the regulation of proliferation, cell cycle progression and apoptosis of tumor cells (6).

Among all the K+ channels mentioned, most studies are directed at examining the impact of voltage-gated K+ channels on the proliferation of tumor cells (1). Voltage-gated K+ channel blockers, such as 4-aminopyridine, and tetraethyl-ammonium, have been shown to inhibit cell proliferation and growth of tumor via an arrest in the G0/G1 transition during the cell cycle (7). Quinidine, another commonly used voltage-gated K+ channel blocker, can reduce the proliferation of tumor cells, such as human malignant mesothelioma cells and rat C6 glioma cells (8,9). However, the precise cellular mechanisms by which voltage-gated K+ channel activity contributes to cell proliferation and apoptosis are not clear yet.

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through degradation of mRNA or translational inhibition of target mRNA (10). miRNAs act as key mediators in the progression and transformation of tumor through their regulation of proliferation, differentiation, and apoptosis (11). While many aspects of miRNA-induced protein regulation are known, there is a growing need to uncover the complex regulatory mechanisms governing the activation and suppression of miRNA expression (12). Interestingly, alterations in expression and function of ion channels/transporters have been shown to result in changes in expression of miRNAs (13). For example, some of the miRNAs, such as miR-155, -21, -27, -192 and -23, are regulated by cystic fibrosis transmembrane conductance regulator, a cAMP-activated anion channel conducting both Cl− and HCO3− (14). miR-21 and - 30a, both of which are implicated in cancer development (15,16), are regulated by L-type Ca2+ channels (17). However, there is scarce literature on the effect of voltage-gated K+ channels on miRNA expression.

In this study, we investigated the effect of quinidine on cell proliferation, apoptosis and expression of miRNAs of human glioma cell line U87-MG, and tried to find out whether quinidine affects cell proliferation and apoptosis by regulating miRNA expression. The results showed that the anti-proliferative and pro-apoptosis effect of quinidine in human glioma cells was mediated at least partly through regulating expression of miRNAs and provided further support for the mechanisms of voltage-gated K+ channels in mediating cell proliferation and apoptosis.

Materials and methods

Reagents

Quinidine, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and tetrodotoxin (TTX) were products of the Sigma-Aldrich Corp. (St. Louis, MO, USA). RPMI-1640 medium and fetal bovine serum (FBS) were obtained from Life Technologies (Carlsbad, CA, USA). Annexin V-fuorescein isothiocyanate/propidium iodide (Annexin V-FITC/PI) apoptosis detection kit was procured from Wuhan Antgene Biotechnology Co., Ltd. (Hubei, China). Caspase-3, -8 and -9 activity assay kits were obtained from Beyotime Institute of Biotechnology (Jiangsu, China). All other chemicals were of standard analytical grade.

Cell culture

Human glioma U87-MG cells were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA) and grown in RPMI-1640 supplemented with 10% FBS and 100 U penicillin/streptomycin in 5% CO2 at 37°C. Cells were passaged every three days and maintained at exponential growth to ~80% confluence for later experiments.

MTT cell proliferation assay

Briefly, cells were seeded at 5,000 cells/well into a 96-well plate and incubated overnight. After exposure to different concentrations of quinidine for 48 h, MTT solution (final concentration 0.5 mg/ml) was added to each well and the samples were incubated for another 4 h. Subsequently, the supernatant was removed and cells were dissolved in 150 μl DMSO. Finally, absorbance at 570 nm was measured by using a 96-well microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Annexin V-FITC/PI apoptosis assay

Cells were double-stained by using an Annexin V-FITC/PI apoptosis detection kit. Briefly, cells were seeded at 5×106 cells per flask into cultured flasks and incubated overnight. After exposure to different concentrations of quinidine for 48 h, cells were harvested and washed with cold PBS twice, and resuspended in Annexin V binding buffer. Then 5 μl of FITC-labeled Annexin V and 5 μl of PI were added. Cells were gently oscillated and incubated for 15 min at room temperature in the dark. After addition of 200 μl binding buffer to each tube, cells were analyzed on a flow cytometer (Becton-Dickinson, Franklin Lakes, NJ, USA) within 1 h.

Caspase activity assay

The activities of caspase-3, -8 and -9 were determined using the activity assay kits. To evaluate the activity of caspase, cell lysates were prepared after treatment with different concentrations of quinidine. Assays were performed on 96-well microtitre plates by incubating 10 μl protein of cell lysate per sample in 80 μl reaction buffer [1% NP-40, 20 mmol/l Tris-HCl (pH 7.5), 137 mmol/l Nad and 10% glycerol] containing 10 μl caspase substrate (Ac-DEVD-pNA for caspase-3, Ac-IETD-pNA for caspase-8, Ac-LEHD-pNA for caspase-9) (2 mmol/l). Lysates were incubated at 37°C for 4 h. Samples were measured with a microplate reader at an absorbance of 405 nm. The detail analysis procedure is described in the manufacturer’s protocol.

Electrophysiological assay

Membrane currents were recorded using a whole-cell voltage clamp and borosilicate glass pipettes (outer diameter, 1.5 mm; direct current resistance, 3–6 MΩ) constructed using a two-step puller (P-97; Sutter Instrument, Novato, CA, USA). To investigate the voltage-gated K+ currents, the pipette solution consisted of 140 mmol/l KCl, 2.5 mmol/l MgCl2, 10 mmol/l HEPES, 11 mmol/l EGTA and 5 mmol/l ATP, and the pH was adjusted to 7.2 (18). The cells were bathed in an extracellular solution containing 135 mmol/l NaCl, 5.4 mmol/l KCl, 1.0 mmol/l MgCl2, 0.33 mmol/l NaH2PO4, 1.8 mmol/l CaCl2, 10 mmol/l HEPES and 10 mmol/l D-glucose with 1 μmol/l TTX. The osmolarity was adjusted to 330 mosmol/l with sucrose, and the pH was adjusted to 7.4. Whole-cell patch clamp recordings were performed at room temperature using a patch clamp amplifier (Axon-200B; Axon Instruments, Union City, CA, USA) (19). Adjustments of capacitance and series resistance compensation were performed before the membrane currents were recorded. The membrane currents were filtered at 10 kHz (−3 dB), and the data were processed using Clampfit (Axon Instruments).

Microarray analysis of miRNAs gene expression

After treated with 100 μmol/l quinidine for 48 h, cells were harvested in PBS, collected by centrifugation, and total RNA extracted using the miRNeasy kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. The experiment was repeated three times. Quantity and quality of RNA was determined by absorbance (260 and 280 nm). LC Sciences (Houston, TX, USA) performed microarray assay using 5 mg total RNA which was size fractioned using a YM-100 Micron centrifugal filter (Millipore, Billerica, MA, USA) and the small RNAs (<300 nt) isolated were 3′-extended with a poly(A) tail using poly(A) polymerase. Three biological samples of RNA were pooled and array was performed using quadruplicate internal repeats of pooled RNA as previously described (12). Data were analyzed by first subtracting the background and normalization of array was to statistical mean of all detectable transcripts. System related variation of data was corrected using LOWESS filter (locally-weighted regression) method (12). Probes were single channel and detected signals greater than background plus thre times the standard deviation was derived.

Quantitative real-time PCR for miRNA expression

To confirm the miRNA levels obtained from the microarray results, expression of miRNAs was assessed using quantitative real-time PCR. Total cellular RNA was extracted from each of the experimental groups using Qiagen miRNeasy RNA purification system according to the manufacturer’s instructions. Quantity and quality of RNA was determined by absorbance (260 and 280 nm). Reverse transcription was performed using gene specific primers. The sequences of the primer pairs are shown in Table I. RNU6B was taken as an internal control. Quantitative real-time PCR was performed using Platinum SYBR-Green qPCR SuperMix-UDG (Invitrogen Life Technologies Carlsbad, CA, USA). The reactions were carried out in a 96-well optical plate at 95°C for 10 min and then amplified for 15 sec at 90°C, followed by 30 sec at 60°C for 40 cycles. The relative value of each miRNA was calculated using the 2−ΔΔCt method, where Ct is the number of cycles at which the application reaches a threshold, as determined by SDS software v1.2 (Applied Biosystems, Inc., Foster City, CA, USA). Thermal denaturation was administered at the conclusion of the qPCR to determine the number of the products that were present in the reaction. Each reverse transcription and qPCR assay was performed in triplicate.

Table I

Sequences of the primer pairs used in quantitative real-time PCR.

Table I

Sequences of the primer pairs used in quantitative real-time PCR.

miRNAReverse transcription (5′→3′)Forward (5′→3′)Reverse (5′→3′)
miR-149-3p CTATACCATAAGCGAGCAGTAGCGCGATGGTATAGGCACAGCC TTGACGAGGGAGGGACGG GCCATAAGCGAGCAGTAGCG
miR-25-3p GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGAC CGCGGCATTGCACTTGTCT CAGTGCAGGGTCCGAGGTATTC
miR-100-5p GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAG GCGAACCCGTAGATCCGAA CCAGTGCAGGGTCCGAGG
miR-424-5p CTATACCATAAGCGAGCAGTAGCGCGATGGTATAGTTCAAAAC CGGCGGCAGCAGCAAT GCCATAAGCGAGCAGTAGCG
miR-365a-3p GCGTGGTCCACACCACCTGAGCCGCCACGACCACGCATAAGGAT GCCGCCTAATGCCCCTAA TCCACACCACCTGAGCCG
RNU6B GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT CAAATTCGTGAAGCGTTCCATA AGTGCAGGGTCCGAGGTATTC

[i] miRNA, microRNA.

Bioinformatic analysis of miRNAs

Changes in expression of miRNAs between the control and quinidine-treated groups were selected and their putative cellular target genes were predicted using TargetScan (http://www.targetscan.org/). Using gene ontology (GO) (http://geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis tool (http://www.genome.jp/kegg/), the target genes were categorized into the following two groups: apoptosis and cell proliferation.

Statistical analysis

Data were expressed as mean ± standard error (mean ± SE). Statistical significance was assessed by using paired Student’s t-test. P<0.05 was considered to be statistically significant.

Results

Effect of quinidine on the proliferation of U87-MG cells

To measure the effect of quinidine on the proliferation of U87-MG cells, cells were treated with various concentrations of quinidine (12.5, 25, 50, 100, 200, 400 and 800 μmol/l) for 48 h, and MTT assay was used to determine the number of the live cells remaining after the drug treatment. As shown in Fig. 1A, quinidine significantly inhibited the cell proliferation of U87-MG cells in a dose-dependent manner (P<0.01). The value of IC50 was calculated to be 58.96 μmol/l at 48 h.

Figure 1

Effect of quinidine on cell proliferation and apoptosis in U87-MG cells. U87-MG cells were treated with the indicated concentrations of quinidine for 48 h. (A) Cell proliferation was suppressed in a dose-dependent manner. The suppression was significant in the range of 50–800 μmol/l of quinidine in U87-MG cells. (B) Quinidine-treated cells were labeled with both Annexin V-FITC and PI and subsequently assessed by flow cytometry. The results showed that quinidine could induce apoptosis in U87-MG cells in a dose-dependent manner, without causing obvious necrosis. (C) Caspase activity was determined with substrates appropriate for each caspase (caspase-3, Ac-DEVD-pNA; caspase-8, Ac-IETD-pNA; caspase-9, Ac-LEHD-pNA). The values represent mean ± SD. *P<0.05 and **P<0.01, compared to the group treated with a solvent control.

Effect of quinidine on the apoptosis of U87-MG cells

To determine whether the reduced cell viability by quinidine was related to apoptotic cell death, the effect of quinidine on apoptosis of U87-MG cells was studied by Annexin V-FITC/PI staining. As illustrated in Fig. 1B, quinidine increased the percentage of apoptotic cells in a concentration-dependent manner, and the apoptotic rates of U87-MG cells treated with 25, 50 and 100 μmol/l quinidine were 9.9, 29.6 and 53.1%, respectively. However, the effect of quinidine on necrosis was slight. At 100 μmol/l, quinidine only induced necrosis in ~2.5% of U87-MG cells, indicating that quinidine could induce apoptosis of U87-MG cells without causing obvious necrosis.

Apoptosis is always executed in a caspase-8-regulated plasma membrane extrinsic pathway and/or caspase-9-regulated mitochondrial intrinsic pathway (20). To determine whether caspases were activated by quinidine, we examined the activities of caspase-3, -8 and -9 in quinidine-treated U87-MG cells. As shown in Fig. 1C, quinidine treatment (25, 50 and 100 μmol/l) resulted in a dose-dependent activation of the initiator caspases-9, and the executor caspase-3. Additionally, activation of caspase-8 was also observed, but the activities of caspase-8 in quinidine-treated cells were not significantly different from that of control cells. These data implied that both mitochondrial and death receptor pathways were involved in the apoptotic process induced by quinidine in U87-MG cells, and the mitochondrial pathway was the main mode.

Effect of quinidine on K+ currents in U87-MG cells

To determine whether quinidine inhibited cell proliferation via blockage of voltage-gated K+ currents (21), we next studied the dose-dependent effects of quinidine on voltage-gated K+ currents in U87-MG cells. The voltage-gated K+ currents consisted of two components (transient and sustained K+ currents) in U87-MG cells, and representative recordings of the voltage-gated K+ currents were evoked with a step-up depolarization protocol (Fig. 2). Briefly, the membrane potential was pre-hyperpolarized from −50 to −110 mV for 100 msec, depolarized from −50 to +60 mV (10 mV increment per step, duration 200 msec), and subsequently restored to the original depolarizing potential of −50 mV (Fig. 2A). Depolarizing the voltage from −110 to −50 mV and maintaining the level of −50 mV for 100 msec inactivated transient K+ currents, and a further depolarization voltage step from −50 to +60 mV evoked sustained K+ currents (Fig. 2B). The transient component (Fig. 2C) was then visualized in isolation using point-by-point subtraction of the sustained component (Fig. 2B) from the total outward current (Fig. 2A). As illustrated in Fig. 2D and E, quinidine shifted the current-voltage curves of transient and sustained K+ currents downward at different depolarization potentials in a dose-dependent manner. Quinidine was more potent in suppressing sustained than transient K+ currents. For instance, at the depolarizing voltage of +60 mV, the percentage inhibition by 100 μmol/l quinidine of transient and sustained K+ currents were ~46.64 and 82.04%, respectively (Fig. 2D and E).

Figure 2

Effect of quinidine on K+ currents in U87-MG cells. (A) Representative traces of total voltage-gated K+ currents (bottom) evoked by voltage depolarizing step voltage protocol shown on the top. (B) The slow sustained K+ currents (bottom) recorded from the same cell evoked by depolarization protocol shown on the top. (C) The fast transient K+ currents were obtained by subtracting the sustained currents from the total voltage-gated K+ currents. (D) Quinidine suppressed current-voltage curve of sustained K+ currents. (E) Quinidine also suppressed current-voltage curve of transient K+ currents, and higher concentration of quinidine was required to have similar effect on transient K+ currents.

Effect of quinidine on miRNA expression in U87-MG cells

To examine the miRNAs involved in quinidine-induced cytotoxicity, total RNA was extracted from U87-MG cells treated with 100 μmol/l quinidine for 48 h. The μParaflo® miRNA microarray containing 2,042 mature human miRNA probes was used to identify the cellular miRNA expression profiles. We found that the expression of specifc miRNAs in quinidine-treated U87-MG cells was signifcantly altered when compared to that in untreated (control) cells. The results of quinidine-regulated miRNAs and their chromosomal locations are summarized in Table II. Of the 2,042 human miRNAs tested, 11 miRNAs were upregulated and 16 miRNAs were downregulated in our experiment.

Table II

Microarray analysis of miRNA expression in U87-MG cells treated with quinidine.

Table II

Microarray analysis of miRNA expression in U87-MG cells treated with quinidine.

miRNAFoldP-valueLocalizationUp-, downregulation
hsa-miR-1234-5p1.36±0.060.004chr8: 145625476–145625559 (−)Up
hsa-miR-44972.64±0.210.013chr12: 110271153–110271241 (+)Up
hsa-miR-4707-5p1.65±0.260.022chr14: 23426159–23426238 (−)Up
hsa-miR-149-3p2.00±0.150.023chr2: 241395418–241395506 (+)Up
hsa-miR-31961.64±0.060.008chr20: 61870131–61870194 (+)Up
hsa-miR-7621.47±0.060.035chr16: 30905224–30905306 (+)Up
hsa-miR-4655-5p3.22±0.420.037chr7: 883816–1883889 (−)Up
hsa-miR-45301.81±0.360.046chr19: 39900263–39900318 (−)Up
hsa-miR-23922.14±0.600.047chr14: 101280828–101280911 (+)Up
hsa-miR-4646-5p2.01±0.190.049chr6: 31668806–31668868 (−)Up
hsa-miR-204-3p2.28±0.570.049chr9: 73424891–73425000 (−)Up
hsa-let-7a-5p0.79±0.020.012chr9: 96938239–96938318 (+)Down
hsa-miR-25-3p0.58±0.020.014chr7: 99691183–99691266 (−)Down
hsa-let-7i-5p0.76±0.030.016chr12: 62997466–62997549 (+)Down
hsa-let-7d-5p0.75±0.030.020chr9: 96941116–96941202 (+)Down
hsa-miR-100-5p0.60±0.050.037chr11: 122022937–122023016 (−)Down
hsa-miR-10b-5p0.63±0.120.032chr2: 177015031–177015140 (+)Down
hsa-miR-9-5p0.80±0.070.036chr1: 156390133–156390221 (−)Down
hsa-miR-51000.68±0.010.038chr10: 43493011–43493129 (+)Down
hsa-miR-27a-3p0.81±0.040.038chr19: 13947254–13947331 (−)Down
hsa-miR-29b-3p0.76±0.090.048chr7: 130562218–130562298 (−)Down
hsa-let-7b-5p0.68±0.060.048chr22: 46509566–46509648 (+)Down
hsa-miR-424-5p0.51±0.020.002chrX: 133680644–133680741 (−)Down
hsa-miR-365a-3p0.55±0.060.024chr16: 14403142–14403228 (+)Down
hsa-miR-450a-5p0.69±0.060.025chrX: 133674371–133674461 (−)Down
hsa-let-7d-3p0.73±0.040.029chr9: 96941116–96941202 (+)Down
hsa-miR-495-5p0.16±0.060.031chr14: 101500092–101500173 (+)Down

[i] The results presented fold change of signal ratio of 100 μmol/l quinidine-treated cells to untreated control cells. The raw data were normalized and analyzed with software of MatLab version 7.4, which produced an average value of the three spot replications of each miRNA. Chromosome localization of miRNAs as refered in miRBase sequences (http://microrna.sanger.ac.uk). miRNA, microRNA.

Based on previous published reports (22,23), we selected the following five miRNAs: the upregulated miR-149-3p, the downregulated miR-25-3p, miR-100-5p, miR-424-5p and miR-365a-3p and measured their expression levels by quantitative real-time PCR. After individual miRNA level in each sample was quantified and normalized to U6 expression, quantitative PCR data confirmed that the expressions of miR-149-3p and miR-424-5p were up- and downregulated significantly in the quinidine-treated U87-MG cells, respectively (P<0.05). Although the expressions of miR-25-3p, miR-100-5p and miR-365a-3p were downregulated in microarray analysis, there were no statistically significant differences by real-time PCR analysis (Fig. 3).

Figure 3

Validation of microRNAs (miRNAs) expression by quantitative real-time PCR. The cells were treated with 100 μmol/l quinidine for 48 h. The expressions of upregulated miR-149-3p, as well as the downregulated miR-25-3p, miR-100-5p, miR-424-5p and miR-365a-3p in U87-MG cells were verified. The results of quantitative real-time PCR presented fold change of miRNA expression in 100 μmol/l quinidine-treated cells to untreated control cells. The results for the five selected miRNAs were consistent with the miRNA array results, and the expression of miR-149-3p and miR-424-5p were up-and downregulated significantly in the quinidine-treated U87-MG cells, respectively (P<0.05). Fold change of miRNA expression is presented in 2−ΔΔCt. *P<0.05, compared to the group treated with a solvent control.

Prediction of potential targets for verified miRNAs

Since the cellular functions of miRNAs are directly mediated by controlling their target gene expression, we further analyzed the putative target genes of the miRNAs and the functional relationship between the gene and anticancer properties using bioinformatic tools. First, the miRBase target database tool, MicroCosm, revealed that 3,803 genes were potentially targeted by quinidine-specific miRNAs. Moreover, since quinidine promotes the death of cancer cells through its anti-proliferative and pro-apoptotic activities, we selected genes with functions related to cell proliferation and apoptosis by using the GO and KEGG analysis tool. Consistent with the previous finding, the GO and KEGG analysis results showed that several target genes of the quinidine-responsive miRNAs were functionally involved in anticancer pathways. These sets of genes are shown in Fig. 4.

Figure 4

Network of differentially expressed microRNAs (miRNAs) and their putative targets. In the network, miRNAs are represented by rectangle shapes and targets are represented by oval shapes. Solid lines show target-target interactions, and dashed lines show miRNA-target interactions.

Discussion

Since the pioneering study in lymphocytes by DeCoursey et al in 1984 (24), accumulating evidence has indicated that K+ channels are relevant players in controlling cell proliferation and apoptosis of various tumor cells. Of all K+ channels, most studies are devoted to the impact of voltage-gated K+ channels on proliferation and apoptosis of tumor cells (6,25). Gliomas are the most common malignant brain tumors (26), the levels of expression of Kv1.5 and 1.3 channel subtypes discriminated between various glioma groups, and a clear differential expression of Kv1.5 was observed according to malignancy grade (27). We have shown previously that voltage-gated K+ channels play roles in controlling cell proliferation and apoptosis of glioma cells (7). However, the underlying mechanisms remain poorly understood.

It was reported that voltage-gated K+ channel blocker quinidine can inhibit the proliferation of human malignant mesothelioma cells and rat C6 glioma cells (8,9). However, the effects of quinidine on cell proliferation of human glioma cells and apoptosis of tumor cells have not been studied yet. In the present investigation, we found that quinidine could inhibit cell proliferation of human glioma U87-MG cells in a dose-dependent manner. The increased apoptosis rate was also observed after incubation of the cells with certain concentration of quinidine, and the cells displayed typical apoptotic features, including chromatin condensation, indicating that quinidine could induce apoptosis in U87-MG cells without causing conspicuous necrosis.

Apoptosis was determined as activation of crucial caspases, such as initiator caspase-9 of intrinsic apoptosis pathway, initiator caspase-8 of extrinsic death receptor pathway and executioner caspase-3 (28). We investigated whether one or both the caspase cascades were activated in quinidine-induced cell apoptosis, and found that caspase-9 activation was remarkably triggered in 100 μmol/l quinidine-treated cells through the mitochondria initiated caspase activation cascade.

Previous reports showed that pharmacological blockades of voltage-gated K+ channels lead to cell proliferation inhibition (29). Fraser et al have reported that the IC50 value of 4-aminopyridine in blocking voltage-gated K+ channel currents of rat prostate cancer AT-2 cells was 4±2 mmol/l (30), which was close to the IC50 value of 4-aminopyridine in inhibiting cell proliferation of human glioma U87-MG cells (7). Our electrophysiological and pharmacological results proved that quinidine inhibited cell proliferation and apoptosis in the concentration range required to block voltage-gated K+ channel currents, indicating that quinidine potentially inhibited cell proliferation and induced apoptosis by blocking voltage-gated K+ channel activities. These data provided further support for the roles of voltage-gated K+ channels in mediating cell proliferation and apoptosis.

Many miRNAs have been reported to have an oncogenic or a tumor suppressor function and to be involved in tumor cell proliferation and apoptosis. However, little is known about the relationship between miRNA expression and voltage-gated K+ channels of tumor cells. The present study demonstrated that quinidine significantly altered expression of miRNAs in U87-MG cells, including 11 upregulated and 16 downregulated miRNAs. Among the miRNAs regulated by quinidine, some have been reported to be tumor suppressors. For instance, miR-149 and -204 function as tumor suppressors and trigger growth inhibition in human glioma cells (23,31). In addition, some miRNAs have been reported to be oncogenic. For instance, knockdown or reduction of miR-10b led to glioma cell apoptosis, cell growth inhibition, and suppressed tumorigenicity (32).

miR-149 is considered to be a potential tumor suppressor. Suppression of miR-149 has been demonstrated in various human cancers, such as colorectal cancer (33) and HeLa cells (34). A recent miRNA microarray study has shown that miR-149 was downregulated significantly in grade I–IV astrocytomas, and overexpression of miR-149 inhibited glioblastoma cell proliferation and migration (35). miR-424 is considered to be a potential oncogenic miRNA. It is significantly upregulated and involved in proliferation, migration and invasion, and chemoresistant in different human cancers (23,36,37). Noteworthy, there are no reports regarding the role of miR-424 in glioma cells. In the current study, we verified that miR-149-3p was upregulated in 100 μmol/l quinidine-treated cells by quantitative real-time PCR, whereas miR-424-5p was downregulated. This is the first report to indicate that the blockade of voltage-gated K+ channels could affect the expression of miR-149-3p/miR-424-5p in tumor cells. The GO and KEGG analysis results showed that the predicted target genes of miR-149-3p and miR-424-5p were functionally involved in cell proliferation and apoptosis process. Future studies are needed to investigate the molecular mechanism of miR-149-3p and miR-424-5p in quinidine-induced anticancer effect.

In conclusion, the present study shows that voltage-gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis of U87-MG glioma cells in a dose-dependent manner. A subset of human miRNAs reveals significant changes in expression in response to quinidine in the U87-MG cell line. These results suggest that the antitumor effect of voltage-gated K+ channel blocker quinidine in human glioma cells was mediated at least partly through regulating miRNA expression, and provide new insight into the understanding of the molecular mechanisms of voltage-gated K+ channels in mediating cell proliferation and apoptosis.

Acknowledgements

This study was supported by the Natural Natural Science Foundation of China (81302203; Beijing, China) and the Wuhan Science and Technology Foundation (201250499145-31; Hubei, China).

References

1 

Pardo LA: Voltage-gated potassium channels in cell proliferation. Physiology (Bethesda). 19:285–292. 2004. View Article : Google Scholar

2 

Kunzelmann K: Ion channels and cancer. J Membr Biol. 205:159–173. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Abdullaev IF, Rudkouskaya A, Mongin AA and Kuo Y-H: Calcium-activated potassium channels BK and IK1 are functionally expressed in human gliomas but do not regulate cell proliferation. PLoS One. 5:e123042010. View Article : Google Scholar : PubMed/NCBI

4 

Mu D, Chen L, Zhang X, See LH, Koch CM, Yen C, Tong JJ, Spiegel L, Nguyen KC, Servoss A, Peng Y, Pei L, Marks JR, Lowe S, Hoey T, Jan LY, McCombie WR, Wigler MH and Powers S: Genomic amplification and oncogenic properties of the KCNK9 potassium channel gene. Cancer Cell. 3:297–302. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Huang L, Li B, Li W, Guo H and Zou F: ATP-sensitive potassium channels control glioma cells proliferation by regulating ERK activity. Carcinogenesis. 30:737–744. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Fiske JL, Fomin VP, Brown ML, Duncan RL and Sikes RA: Voltage-sensitive ion channels and cancer. Cancer Metastasis Rev. 25:493–500. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Ru Q, Tian X, Wu YX, Wu RH, Pi MS and Li CY: Voltage-gated and ATP-sensitive K+ channels are associated with cell proliferation and tumorigenesis of human glioma. Oncol Rep. 31:842–848. 2014.

8 

Utermark T, Alekov A, Lerche H, Abramowski V, Giovannini M and Hanemann CO: Quinidine impairs proliferation of neurofibromatosis type 2-deficient human malignant mesothelioma cells. Cancer. 97:1955–1962. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Weiger TM, Colombatto S, Kainz V, Heidegger W, Grillo MA and Hermann A: Potassium channel blockers quinidine and caesium halt cell proliferation in C6 glioma cells via a polyamine-dependent mechanism. Biochem Soc Trans. 35:391–395. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Bushati N and Cohen SM: microRNA functions. Annu Rev Cell Dev Biol. 23:175–205. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Visone R and Croce CM: MiRNAs and cancer. Am J Pathol. 174:1131–1138. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Martin EC, Bratton MR, Zhu Y, Rhodes LV, Tilghman SL, Collins-Burow BM and Burow ME: Insulin-like growth factor-1 signaling regulates miRNA expression in MCF-7 breast cancer cell line. PLoS One. 7:e490672012. View Article : Google Scholar : PubMed/NCBI

13 

Jiang X, Zhang JT and Chan HC: Ion channels/transporters as epigenetic regulators? - a microRNA perspective. Sci China Life Sci. 55:753–760. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Bhattacharyya S, Balakathiresan NS, Dalgard C, Gutti U, Armistead D, Jozwik C, Srivastava M, Pollard HB and Biswas R: Elevated miR-155 promotes inflammation in cystic fibrosis by driving hyperexpression of interleukin-8. J Biol Chem. 286:11604–11615. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Gao W, Lu X, Liu L, Xu J, Feng D and Shu Y: MiRNA-21: a biomarker predictive for platinum-based adjuvant chemotherapy response in patients with non-small cell lung cancer. Cancer Biol Ther. 13:330–340. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Kumarswamy R, Volkmann I and Thum T: Regulation and function of miRNA-21 in health and disease. RNA Biol. 8:706–713. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Carrillo ED, Escobar Y, González G, Hernández A, Galindo JM, García MC and Sánchez JA: Posttranscriptional regulation of the β2-subunit of cardiac L-type Ca2+ channels by MicroRNAs during long-term exposure to isoproterenol in rats. J Cardiovasc Pharmacol. 58:470–478. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Akamine T, Nishimura Y, Ito K, Uji Y and Yamamoto T: Effects of haloperidol on K(+) currents in acutely isolated rat retinal ganglion cells. Invest Ophthalmol Vis Sci. 43:1257–1261. 2002.PubMed/NCBI

19 

Liu YW and Li CY: Inhibition of N-methyl-D-aspartate-activated current by bis(7)-tacrine in HEK-293 cells expressing NR1/NR2A or NR1/NR2B receptors. J Huazhong Univ Sci Technolog Med Sci. 32:793–797. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Bao Q and Shi Y: Apoptosome: a platform for the activation of initiator caspases. Cell Death Differ. 14:56–65. 2007. View Article : Google Scholar

21 

Fishman MC and Spector I: Potassium current suppression by quinidine reveals additional calcium currents in neuroblastoma cells. Proc Natl Acad Sci USA. 78:5245–5249. 1981. View Article : Google Scholar : PubMed/NCBI

22 

Pan SJ, Zhan SK, Pei BG, Sun QF, Bian LG and Sun BM: MicroRNA-149 inhibits proliferation and invasion of glioma cells via blockade of AKT1 signaling. Int J Immunopathol Pharmacol. 25:871–881. 2012.

23 

Wu K, Hu G, He X, Zhou P, Li J, He B and Sun W: MicroRNA-424-5p suppresses the expression of SOCS6 in pancreatic cancer. Pathol Oncol Res. 19:739–748. 2013. View Article : Google Scholar : PubMed/NCBI

24 

DeCoursey TE, Chandy KG, Gupta S and Cahalan MD: Voltage-gated K+ channels in human T lymphocytes: a role in mitogenesis? Nature. 307:465–468. 1984. View Article : Google Scholar : PubMed/NCBI

25 

Jang SH, Kang KS, Ryu PD and Lee SY: Kv1.3 voltage-gated K(+) channel subunit as a potential diagnostic marker and therapeutic target for breast cancer. BMB Rep. 42:535–539. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Ru Q, Shang BY, Miao QF, Li L, Wu SY, Gao RJ and Zhen YS: A cell penetrating peptide-integrated and enediyne-energized fusion protein shows potent antitumor activity. Eur J Pharm Sci. 47:781–789. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Preussat K, Beetz C, Schrey M, Kraft R, Wölfl S, Kalff R and Patt S: Expression of voltage-gated potassium channels Kv1.3 and Kv1.5 in human gliomas. Neurosci Lett. 346:33–36. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Mutlu A, Gyulkhandanyan AV, Freedman J and Leytin V: Activation of caspases-9, -3 and -8 in human platelets triggered by BH3-only mimetic ABT-737 and calcium ionophore A23187: caspase-8 is activated via bypass of the death receptors. Br J Haematol. 159:565–571. 2012.PubMed/NCBI

29 

Le Guennec JY, Ouadid-Ahidouch H, Soriani O, Besson P, Ahidouch A and Vandier C: Voltage-gated ion channels, new targets in anti-cancer research. Recent Pat Anticancer Drug Discov. 2:189–202. 2007. View Article : Google Scholar

30 

Fraser SP, Grimes JA, Diss JK, Stewart D, Dolly JO and Djamgoz MB: Predominant expression of Kv1.3 voltage-gated K+ channel subunit in rat prostate cancer cell lines: electrophysiological, pharmacological and molecular characterisation. Pflugers Arch. 446:559–571. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Ying Z, Li Y, Wu J, Zhu X, Yang Y, Tian H, Li W, Hu B, Cheng SY and Li M: Loss of miR-204 expression enhances glioma migration and stem cell-like phenotype. Cancer Res. 73:990–999. 2013. View Article : Google Scholar :

32 

Gabriely G, Yi M, Narayan RS, Niers JM, Wurdinger T, Imitola J, Ligon KL, Kesari S, Esau C, Stephens RM, Tannous BA and Krichevsky AM: Human glioma growth is controlled by microRNA-10b. Cancer Res. 71:3563–3572. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Wang F, Ma YL, Zhang P, Shen TY, Shi CZ, Yang YZ, Moyer MP, Zhang HZ, Chen HQ, Liang Y and Qin HL: SP1 mediates the link between methylation of the tumour suppressor miR-149 and outcome in colorectal cancer. J Pathol. 229:12–24. 2013. View Article : Google Scholar

34 

Lin RJ, Lin YC and Yu AL: miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 49:719–727. 2010.PubMed/NCBI

35 

Li D, Chen P, Li XY, Zhang LY, Xiong W, Zhou M, Xiao L, Zeng F, Li XL, Wu MH and Li GY: Grade-specific expression profiles of miRNAs/mRNAs and docking study in human grade I–III astrocytomas. OMICS. 15:673–682. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Park YT, Jeong JY, Lee MJ, Kim KI, Kim TH, Kwon YD, Lee C, Kim OJ and An HJ: MicroRNAs overexpressed in ovarian ALDH1-positive cells are associated with chemoresistance. J Ovarian Res. 6:182013. View Article : Google Scholar : PubMed/NCBI

37 

Sand M, Skrygan M, Georgas D, Sand D, Hahn SA, Gambichler T, Altmeyer P and Bechara FG: Microarray analysis of microRNA expression in cutaneous squamous cell carcinoma. J Dermatol Sci. 68:119–126. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ru Q, Tian X, Pi MS, Chen L, Yue K, Xiong Q, Ma BM and Li CY: Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells. Int J Oncol 46: 833-840, 2015.
APA
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q. ... Li, C. (2015). Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells. International Journal of Oncology, 46, 833-840. https://doi.org/10.3892/ijo.2014.2777
MLA
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q., Ma, B., Li, C."Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells". International Journal of Oncology 46.2 (2015): 833-840.
Chicago
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q., Ma, B., Li, C."Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells". International Journal of Oncology 46, no. 2 (2015): 833-840. https://doi.org/10.3892/ijo.2014.2777
Copy and paste a formatted citation
x
Spandidos Publications style
Ru Q, Tian X, Pi MS, Chen L, Yue K, Xiong Q, Ma BM and Li CY: Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells. Int J Oncol 46: 833-840, 2015.
APA
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q. ... Li, C. (2015). Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells. International Journal of Oncology, 46, 833-840. https://doi.org/10.3892/ijo.2014.2777
MLA
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q., Ma, B., Li, C."Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells". International Journal of Oncology 46.2 (2015): 833-840.
Chicago
Ru, Q., Tian, X., Pi, M., Chen, L., Yue, K., Xiong, Q., Ma, B., Li, C."Voltage‑gated K+ channel blocker quinidine inhibits proliferation and induces apoptosis by regulating expression of microRNAs in human glioma U87‑MG cells". International Journal of Oncology 46, no. 2 (2015): 833-840. https://doi.org/10.3892/ijo.2014.2777
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team