Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Cortactin promotes colon cancer progression by regulating ERK pathway

  • Authors:
    • Qing-Feng Ni
    • Jia-Wei Yu
    • Fei Qian
    • Nai-Zhi Sun
    • Jian-Jia Xiao
    • Jian-Wei Zhu
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001, P.R. China
  • Pages: 1034-1042
    |
    Published online on: July 6, 2015
       https://doi.org/10.3892/ijo.2015.3072
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cortactin is upregulated in various cancers including breast cancer, head and neck squamous cell carcinoma and gastric cancer. However, the role of cortactin in the pathogenesis of colon cancer remains unclear. mRNA expression of cortactin in colon cancer samples and cell lines was detected by quantitative real-time PCR (qRT-PCR), while protein expression of cortactin in colon cancer tissues and adjacent non-cancer tissues was assessed by immunohistochemistry. The role of cortactin in regulation of the proliferation of colon cancer derived cells were investigated both in vitro and in vivo. In the total of 60 paired colon cancer specimens, compared with the adjacent non-cancer tissues, the expression of cortactin mRNA was upregulated in 45 (75.0%). Immunohistochemical analysis showed significantly increased cortactin expression in colon cancer (42/60, 70.0%) compared to control tissues (18/60, 30.0%). Overexpression of cortactin promoted HCT116 cellular colony formation and tumor growth. Conversely, cortactin knockdown inhibited these effects in SW480 cells. Mechanistic analyses indicated that cortactin was able to activate the EGFR-ERK signaling pathway. Additionally, cortactin expression was associated with tumor size, tumor stages and lymphatic invasion, increased cortactin expression predicts poor prognosis in patients with colon cancer. In summary, cortactin demonstrated the promotive effect in human colon cancer cell growth and tumorigenicity. These results indicated that cortactin may serve as an effective target for gene therapy.

Introduction

Colon cancer is the most common gastrointestinal cancer worldwide, with the incidence increasing in most countries over the past 20 years (1). Colon cancer is often diagnosed at an advanced stage, leading to a poor prognosis (2–5). As the current clinical procedures utilized for disease diagnosis are invasive, unpleasant, and inconvenient, the development of simple blood tests that can be used for early detection would be beneficial for ultimately controlling and preventing colon cancer (2,4,5). Serum tumor markers, such as carcinoembryonic antigen (CEA) and carbohydrate antigen 199 (CA19-9), greatly improve diagnosis. However, their application is limited to surveillance postsurgery, and they are not suitable for the early detection of colon cancer, as their sensitivity and specificity are very low (6–8). Therefore, it is vital to identify new clues to understand the pathogenesis of colon cancer and to explore effective therapeutic strategies.

Cortactin protein was first identified in chicken cells transformed by the src oncogene. Human cortactin, encoded by the CTTN/EMS1 gene, is a v-Src substrate localized with cortical actin at the plasma membrane (9), cortactin is enriched in cortical structures such as membrane ruffles and lamellipodia, and plays key roles in the microfilament-membrane interactions as well in transducing signals from the cell surface to the cytoskeleton (10,11). Cortactin overexpression results from the 11q11.3 chromosomal region amplification in various cancers, such as head and neck squamous carcinoma, hepatocellular carcinoma, breast and bladder cancer, and correlates with poor patient prognosis and decreased survival (12–15). Clark et al demonstrated that cortactin expression levels in HNSCC cells correlate with the formation of invadopodia and associated with the invasive potential of tumor cells (16). In addition, Wei et al revealed that cortactin overexpression promoted EGFR expression and confers a more malignant phenotype to gastric cancer cells (17).

Despite the many previous studies that were carried out, cotactin expression in colon cncer is still not completely known. Therefore, the present study examined the role of cortactin in colon cancer development, and our results indicated that cortactin is markedly upregulated in colon cancer and can significantly promote colon cancer cell proliferation both in vitro and in vivo.

These data may suggest that cortactin acts as a promoter of colon cancer cell growth and may constitute a potential therapeutic target in colon cancer.

Materials and methods

Tissue specimens

To examine the expression of cortactin in human colon cancers, sixty surgical resected colon cancers and adjacent non-tumor specimens were obtained from Department of General Surgery, Affiliated Hospital of Nantong University. Both colon cancers and adjacent non-tumor tissues were confirmed by pathological examination, and immediately stored in liquid nitrogen after surgery. The study protocols for the investigations involving human tissues were approved by the Ethics Committee of Nantong University.

Colon cancer cell lines

The human colon cancer cell lines (HCT116, HT29, DLD1, LS180, SW480 and SW620) and normal human colon epithelial cells (NCM460) were obtained from American Type Culture Collection (Manassas, VA, USA). HCT116 cells were cultured in McCoy's 5A medium supplemented with 10% fetal bovine serum, all the other cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum. The cell lines were propagated in a 37°C-humidified incubator with 5% CO2.

Quantitative real-time PCR

Total RNA from tissue samples and cultured cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then reverse transcribed into cDNA using the PrimeScript RT Reagent kit (Takara, Japan). Quantitative real-time PCR (qRT-PCR) assays were carried out to detect mRNA expression using SYBR Premix Ex Taq (Takara, Japan) according to the manufacturer's instructions. Cortactin primers used in qRT-PCR were as follows: forward primer, 5′-TCCCATGGCTATGGAGGGAA-3′; reverse primer, 5′-CGACTGATATTCGTGGCCGA-3′. β-actin was used as an internal control and amplified with forward primer, 5′-AGAGC CTCGCCTTTGCCGATCC-3′; and reverse primer, 5′-CTGGG CCTCGTCGCCCACATA-3′.

Immunohistochemical staining

All tissues were paraffin-embedded and were obtained from the Department of Pathology, Affiliated Hospital of Nantong University. The paraffin-embedded tissues were cut into 4-μm sections, and then incubated with rabbit anti-cortactin polyclonal antibody (dilution 1:200; Abcam, Cambridge, UK) at 4°C overnight, SP-9000 HistostainTM Plus kits (ZSGB-BIO) were used according to the manufacturer's protocol. Tumor slices were examined in a blinded manner. Ten fields were selected for examination of the cell-staining intensity and proportion of positive cells. Immunohistochemical staining was assessed according to the immunoreactive score (IRS) that evaluated the staining intensity and the proportion of positive cells. The staining intensity was graded as 0 (no staining), 1 (weak), 2 (moderate) and 3 (strong). The proportion of positive cells was scored as 0 (negative), 1 (<10%), 2 (10–50%) and 3 (>50%). Both of the scores were multiplied and the IRS was determined: values ≥3 were defined as cytoplasmic expression positive, and values <3 were regarded as negative.

shRNA preparation

SiRNA against cortactin was designed according to the Invitrogen Co. and chemically synthesized by Shanghai GenePharma Co. (Shanghai, China). The sequence of siRNA-410 was: CCUUAAGGAGAAGGAAC UUdTdT (sense) and AAGUUCCUUCUCCUUAAGGdTdT (antisense). Negative control (NC) siRNA synthesized by Shanghai GenePharma Co. was used as a control. The sequence of si-NC was as follows: UUCUCCGAACGUGUCACGUTT (sense) and ACGUGACACGUUCGGAGAATT (antisense). ShRNA duplexes against cortactin was designed according to the Invitrogen Co. and synthesized by GenePharma Co. The sequences were incorporated into the Vector p-SUPER (OligoEngine, USA) to generate p-SUPER-shRNA-cortactin. The sequence of shRNA-410 was as follows: GATCCCCCCTT AAGGAGAAGGAACTTTTCAAGAGAAAGTTCCTTCTC CTTAAGGTTTTTGGAAA (sense) and AGCTTTTCCAAA AACCTTAAGGAGAAGGAACTTTCTCTTGAAAAGTTC CTTCTCCTTAAGGGGG (antisense). The sequence of sh-NC was as follows: GATCCCCTTCT CCGAACGTGTCACGTTT CAAGAGAACGTGACACGTTCGGAGAATTTTTGGAAA (sense) and AGCTTTTCCAAAAATTCTCCGAACGTGT CACGTTCTCTTGAAACGTGACACGTTCGGAGAAGGG (antisense). The constructs were verified by sequencing.

Construction of cortactin expression vector

The cortactin open reading frame (ORF) was amplified from the human colon cDNA library (Genbank: NM_001184740.1) using Prime Star PCR and constructed into the expression vector pcDNA1.1B to generate pcDNA1.1B-cortactin. The sequence of the forward primer was as follows: 5′-EcoRI-AGAGAATTCATGTGGA AAGCTTCAGCA-3′ and reverse primer' 5′-BamHI-AGA GGATCCTCACGGGCACTCCGGGAC-3′. The construct was verified by sequencing.

Cell transfection

Both the shRNA and cortactin expression vector were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

Cell proliferation assay

Cells were seeded at a density of 2,000–5,000 cells/well in 100 μl complete medium in 96-well plates. The Cell Counting Kit-8 (Dojindo Labs) was used to measure cell viability according to the manufacturer's instructions. Each experiment was repeated at least 3 times.

Colony formation assay

To examine the effect of upregulated or downregulated cortactin expression on proliferation of colon cancer cell lines, cells transfected with different plasmids were used for the colony formation assay. Each type of cell was seeded into 10-cm plates (50,000 cells/well) and cultured for 3 weeks in medium containing 1,000 μg/ml G418. These cultures were stained with 0.4% crystal violet. Clones >2 mm were counted and the number of clones per well was averaged from three wells for each experiment. Each experiment was repeated at least 3 times.

Soft agar colony formation assay

Cells transfected with different plasmids were suspended in 0.5 ml 1% low melting point agarose with complete culture medium, and then layered on top of 0.5 ml 2% low melting agarose in 24-well plates. Cell numbers varied from 2,000 to 5,000 for different cell lines. The plates were incubated in a 5% CO2, 37°C-humidified incubator for 2 weeks. Colonies in at least 6 random microscopic fields were counted and photographed. All experiments were repeated 3 times.

Tumorigenicity assay in nude mice

Male BALB/c nude mice (3–4-week-old) were purchased from the Department of Laboratory Animal Center, Nantong University. Cells with differential cortactin expression were injected subcutaneously into the lateral root of the anterior limb of nude mice (500×106 cells/mouse, 4 mice in each experimental group). Tumor size was measured every third day after injection. Three weeks after injection, the mice were sacrificed and photographed. Tumor weight was then calculated. Care of experimental animals was in accordance with institutional animal care and use committee guidelines.

Western blot analysis

Cell lysates were prepared using cold lysis buffer containing 25 mmol/l Tris-Cl (pH 7.5), 5 mmol/l EDTA, 1% SDS and protease inhibitor cocktail (Sigma, USA). After boiling for 5 min, samples were subjected to electrophoresis in 10% SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane, and blocked for 1 h at room temperature with 5% blocking buffer. The membranes were washed three times with 0.1% Tris-buffered saline with Tween-20 (TBST) and incubated with the primary antibody overnight at 4°C. The membranes were washed again and then incubated with the secondary antibody at room temperature for 1 h. Primary antibodies used in this study included: rabbit anti-cortactin polyclonal antibody (1:1,000; Abcam), rabbit anti-EGFR polyclonal antibody (1:200; Abcam), rabbit anti-ERK polyclonal antibody (1:1,000; Abcam), rabbit anti-pERK polyclonal antibody (1:500; Abcam), rabbit anti-cyclin D1 polyclonal antibody (1:1,000; Abcam) and rabbit anti-β-actin polyclonal antibody (1:1,000; Abcam). Proteins were detected using an ECL Western blotting detection system (Pierce) by enhanced chemiluminescence.

Patient follow-up

The total of 60 patients underwent resection of colon cancer with curative intent at the Department of General Surgery, Affiliated Hospital of Nantong University between March 2009 and February 2010. Curative resection was considered as complete resection of tumor mass, with the tumor margins free, and resection of the regional lymph nodes. Patients with distant metastasis were eliminated from this study. The patients were followed from March 2010 to February 2015. The detailed clinicopathological characteristics of the 60 patients with colon cancer are listed in Table I.

Table I

Expression of cortactin in human colon cancer according to clinicopathological features of patients.

Table I

Expression of cortactin in human colon cancer according to clinicopathological features of patients.

Cortactin expression

Clinicopathological featuresStrong (+)
n=34
Weak (−)
n=26
χ2 valueP-value
Age (years)
 <501511
 ≥5019150.0200.889
Gender
 Male1814
 Female16120.0050.944
 Depth
Localized in subserosa118
Beyond subserosa23180.0170.896
Tumor size
 <3813
 ≥326134.5380.033
Stage
 I/II612
 III/IV28145.7010.017
Lymphatic invasion
 Absent513
 Present29138.7400.003

[i] Strong (+) cortactin expression, cortactin expression in colon cancers/cortactin expression in normal tissues ≥2; weak (−) cortactin expression, cortactin expression in colon cancers/cortactin expression in normal tissues <2; P<0.05, statistically significant difference.

Statistical analysis

Statistical analysis was performed using SPSS 18.0 and Graphpad Prism 5.0 software. Quantitative data were recorded as mean ± SD. Differences between two groups were assessed by Student's t-test (two-tailed). Categorical data were evaluated by the χ2 test. Survival rates were assessed by the Kaplan-Meier method. The log-rank test was used to compare significance. P<0.05 was considered statistically significant.

Results

Cortactin expression in colon cancer tissues and colon cancer cell lines

Quantitative real-time PCR was performed to measure the cortactin mRNA expression levels in colon cancer and adjacent non-cancerous tissues from 60 patients. The results indicated that cortactin mRNA was increased in 45 (75%) of 60 colon cancer specimens compared with the matched normal colon tissues (Fig. 1A). We performed immunohistochemistry (IHC) to evaluate cortactin protein expression in colon cancer specimens and paired normal colon tissues in the same 60 matched samples. Of these specimens, 42/60 (70.0%) of cancerous specimens showed positive staining, whereas 18/60 (30.0%) of normal colon tissues showed positive staining (Fig. 1C). Furthermore, we evaluated the expression of cortactin in 6 colon cancer cell lines using quantitative real-time PCR. Cortactin mRNA was significantly increased in all colon cancer derived cell lines (HCT116, HT29, DLD1, LS180, SW480 and SW620) compared with normal human colon epithelial cells (NCM460) (Fig. 1B). In summary, the collective data showed that cortactin is increased in colon cancer.

Figure 1

Upregulation of cortactin in clinical specimens and colon cancer derived cell lines. (A) The expression of cortactin mRNA in 60 paired colon cancer specimens by qRT-PCR (*P<0.05). (B) Cortactin mRNA was upregulated in 6 colon cancer derived cell lines. (C) Representative results of the upregulation of cortactin protein in colon cancer specimens by immunohistochemistry (x400 magnification). (D) Compared with the weak expression (−) cortactin group, the patients' overall survival (OS) was lower in the strong expression (+) cortactin group (*P<0.05).

Correlation of cortactin expression with the patient clinicopathological features

To investigate whether the increased expression of cortactin was associated with the clinicopathological features such as age, gender, depth, tumor size, tumor stages and lymphatic invasion, we classified the patients into two groups on the basis of our qRT-PCR results for cortactin: weak expression (−) and strong expression (+). As shown in Table I, those patients with tumor size (≥3 cm) had a significantly higher expression of cortactin compared with those patients with tumor size (<3 cm). In addition, in stages III/IV, expression of cortactin was dramatically higher than stages I/II. Furthermore, lymphatic invasion was significantly correlated with a strong cortactin expression, whereas no significant difference was observed in terms of the patient age, gender and tumor depth. In summary, cortactin functions as an oncogene accelerator in colon cancer.

Increased expression of cortactin predicts poor prognosis in patients with colon cancer

Out of the 60 cases, there were 52 patients with definite follow-ups. A total of 34 patients died, of whom 23 showed strong expression of cortactin, 11 showed weak expression of cortactin. The 5-year OS rates of patients with strong cortactin expression were 16.9%, which were lower than those of patients with weak cortactin expression (51.1%) (Fig. 1D).

Overexpression of cortactin promotes proliferation and colony formation in HCT116 cells

To overexpress cortactin, the recombinant pcDNA1.1B-cortactin was transfected into the HCT116 cells. We performed western blotting to evaluate cortactin protein expression in HCT116 cells transfected with pcDNA1.1B-cortactin 48 h post-transfection. Cortactin protein expression in pcDNA1.1B-cortactin transfected cell was significantly higher than in pcDNA1.1B transfected cell (Fig. 2A). To investigate the promotive effects in pcDNA1.1B-cortactin transfected cell, cellular growth was monitored for 5 days. The pcDNA1.1B-cortactin transfected HCT116 cells showed a significant increase in cellular growth compared with pcDNA1.1B transfected cells (Fig. 2B). HCT116 cells with upregulated cortactin expression were subjected to colony formation assay. As shown in Fig. 2C, overexpression of cortactin in HCT116 cells resulted in significant promotion of colony formation as compared with HCT116 cells transfected with pcDNA1.1B, and the majority of clones were larger than those of control cells. We then used a soft agar assay for colony formation, which is the most stringent assay for detecting the proliferative ability of cells. We observed enhanced formation of colonies in soft agar (Fig. 2D) that had been seeded with HCT116 cells transfected with pcDNA1.1B-cortactin compared with pcDNA1.1B transfected cells.

Figure 2

Overexpression of cortactin promotes proliferation and colony formation. (A) HCT116 cells transfected with pcDNA1.1B-cortactin stably increased cortactin expression shown by western blotting. (B) Overexpression of cortactin promotes proliferation of HCT116 cells (*P<0.05). (C) Overexpression of cortactin promotes colony formation of HCT116 cells (*P<0.05). (D) Overexpression of cortactin promotes soft agar colony formation of HCT116 cells (**P<0.01).

Knockdown of cortactin inhibits proliferation and colony formation in SW480 cell line

To knockdown cortactin, the recombinant p-SUPER-shRNA-cortactin was transfected into SW480 cells. Western blot analyses were performed to assess the efficiency of cortactin knockdown in SW480 cells transfected with p-SUPER-shRNA-cortactin 48 h post-transfection. Cortactin protein expression in p-SUPER-shRNA-cortactin transfected cells was significantly lower than that in sh-NC transfected cells (Fig. 3A). The p-SUPER-shRNA-cortactin transfected SW480 cells showed significant suppression of cellular growth compared with sh-NC transfected cells (Fig. 3B). SW480 cells with downregulated cortactin expression were subjected to colony formation assay. As shown in Fig. 3C, decreased expression of cortactin in SW480 cells resulted in significant suppression of colony formation as compared with cells transfected with sh-NC. We also observed inhibited formation of colonies in soft agar (Fig. 3D) when seeded with SW480 cells transfected with p-SUPER-shRNA-cortactin compared with sh-NC transfected cells.

Figure 3

Knockdown of cortactin inhibits proliferation and colony formation. (A) SW480 cells transfected with p-SUPER-shRNA-cortactin stably decreased cortactin expression shown by western blotting. (B) Knockdown of cortactin inhibits proliferation of SW480 cell (*P<0.05). (C) Knockdown of cortactin inhibits colony formation of SW480 cells (*P<0.05). (D) Knockdown of cortactin inhibits soft agar colony formation of SW480 cells (*P<0.05).

Differential expression of cortactin influences tumorigenesis in nude mice

The effects of differential cortactin expression on the tumorigenic potential of colon cancer cells in vivo were also evaluated. HCT116 cells overexpressing cortactin and SW480 with downregulated cortactin expression were injected subcutaneously into BALB/c nude mice (500×106 cells/mouse, 4 mice in each experimental group). Tumor size was measured every third day after injection. After 3 weeks, mice were sacrificed and photographed, and the tumors were removed and weighed. In comparison with the mice injected with HCT116 cells transfected with pcDNA1.1B, the mice injected with HCT116 cells transfected with pcDNA1.1B-cortactin displayed larger tumors during the same time period, and the average tumor volumes and weights were significantly higher than those in the control group (Fig. 4A, C and E). Compared with the mice injected with SW480 cells transfected with p-SUPER-sh-NC, the mice injected with SW480 cells transfected with p-SUPER-shRNA-cortactin showed an obvious decreased capacity for tumorigenesis (Fig. 4B, D and F). Taken together, these results strongly suggest that cortactin acts as an promotor of tumor cell growth and tumorigenicity in vivo.

Figure 4

The effect of cortactin expression on tumorigenesis in nude mice. (A and B) Tumors were excised 21 days after injection. (C and D) Tumor volume was measured every third day after injection (*P<0.05). (E and F) The average weight of tumors in each group was assessed (*P<0.05).

Differential expression of cortactin influences the EGFR-ERK signaling pathway related proteins

To study the mechanism by which cortactin enhances the growth of colon cancer, the EGFR, ERK, p-ERK, cyclin D1 protein levels were detected by western blotting. As shown in Fig. 5, the levels of EGFR, p-ERK and cyclin D1 were increased in the pcDNA1.1B-cortactin transfected HCT116 cells compared with the pcDNA1.1B transfected HCT116 cells, and no difference in the tERK protein levels were observed between the two cell groups. The levels of EGFR, p-ERK, cyclin D1 were decreased in the p-SUPER-shRNA-cortactin transfected SW480 cells compared with the sh-NC transfected SW480 cells. Similarly, the expression of tERK was not different between the cell groups. These results indicate that cortactin overexpression enhances the EGFR expression and in turn constitutively activates the EGFR-ERK signaling pathway.

Figure 5

Western blot analysis of EGFR-ERK signaling pathway related proteins showed upregulation of EGFR, p-ERK, cyclin D1 in cortactin-overexpressed HCT116 cells and downregulation of EGFR, pERK, cyclin D1 in cortactin-silenced SW480 cell, tERK protein level was unchanged.

Discussion

Recurrence and metastasis remain the major causes of treatment failure and poor prognosis in patients with colon cancer, and it is a multistage process that involves the motility and migration of cells and proliferation in a new site (18). Cortactin is a multidomain protein consisting of an NH2-terminal acidic region, which binds the actin related protein (Arp)2/3 complex, a repeat region, which associates with filamentous actin, and a COOH-terminal src homology (SH)3 domain, which recruits a variety of cellular proteins (19). One cellular role for cortactin is to bridge the endocytic machinery with components and regulators of the actin cytoskeleton (20). This interaction has recently been shown to participate in receptor-mediated endocytosis (20–22). The gene encoding cortactin, EMS1, localizes to chromosomal locus 11q13, a region commonly amplified in breast cancers and head and neck squamous cell carcinoma (23,24). Since cortactin overexpression increases the motility of fibroblasts and endothelial cells (25,26), enhances bone metastasis of MDA-MB-231 breast cancer cells in a nude mouse model (27) and promotes gastric cancer cell SGC-7901 proliferation (17).

In the present study, we first determined the expression of cortactin in colon cancer, and further investigated its role in colon cancer cell proliferation and tumorigenicity both in vitro and in vivo.

EGFR is frequently implicated in cancer cell proliferation, inhibition of apoptosis and tumor-induced neovascularization via the activation of downstream signaling pathways. EGFR is often overexpressed in various types of tumors, such as salivary gland carcinomas, non-small cell lung cancer, biliary tract cancer, and gastric cancer (28–32). One of the most frequent targets downstream of EGFR and other receptor tyrosine kinases is the extracellular signal-regulated kinase (ERK) kinase signal transduction pathway. This pathway is involved in proliferation, differentiation, apoptosis, and angiogenesis (33). It is constitutively active in a variety of solid tumor models, including lung, pancreas, and breast (33). Elevated levels of activated ERK are frequently seen in carcinoma cell lines (34,35). Activation of the ERK pathway regulates the activity of a number of substrates through phosphorylation (36).

In this study, we first determined the expression of EGFR and ERK in colon cancer cells, it revealed that cortactin enhances EGFR expression and ERK phosphorylation. Sustained ERK activity can upregulate cyclin D1 expression.

In conclusion, our findings show that cortactin is significantly upregulated in colon cancer, while ectopic cortactin expression promotes cell proliferation, colony formation, soft agar colony formation and tumorigenicity. Further investigation revealed that cortactin stimulates the EGFR-ERK signaling pathway. This study is the first to discover that cortactin expression plays an important role in colon cancer progression, but further studies are required to identify the detailed interaction between cortactin and EGFR-ERK signaling pathway in colon cancer, and whether cortactin could act as a therapeutic agent for colon cancer patients should be investigated.

References

1 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar

2 

Fan NJ, Kang R, Ge XY, Li M, Liu Y, Chen HM and Gao CF: Identification alpha-2-HS-glycoprotein precursor and tubulin beta chain as serology diagnosis biomarker of colorectal cancer. Diagn Pathol. 9:532014. View Article : Google Scholar : PubMed/NCBI

3 

Thomson DMP, Krupey J, Freedman SO and Gold P: The radio-immunoassay of circulating carcinoembryonic antigen of the human digestive system. Proc Natl Acad Sci USA. 64:161–167. 1969. View Article : Google Scholar

4 

Duffy MJ: Role of tumor markers in patients with solid cancers: A critical review. Eur J Intern Med. 18:175–184. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Roulston JE: Limitations of tumour markers in screening. Br J Surg. 77:961–962. 1990. View Article : Google Scholar : PubMed/NCBI

6 

Bagaria B, Sood S, Sharma R and Lalwani S: Comparative study of CEA and CA19-9 in esophageal, gastric and colon cancers individually and in combination (ROC curve analysis). Cancer Biol Med. 10:148–157. 2013.

7 

Tan E, Gouvas N, Nicholls RJ, Ziprin P, Xynos E and Tekkis PP: Diagnostic precision of carcinoembryonic antigen in the detection of recurrence of colorectal cancer. Surg Oncol. 18:15–24. 2009. View Article : Google Scholar

8 

Flamini E, Mercatali L, Nanni O, Calistri D, Nunziatini R, Zoli W, Rosetti P, Gardini N, Lattuneddu A, Verdecchia GM, et al: Free DNA and carcinoembryonic antigen serum levels: An important combination for diagnosis of colorectal cancer. Clin Cancer Res. 12:6985–6988. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Wu H, Reynolds AB, Kanner SB, Vines RR and Parsons JT: Identification and characterization of a novel cytoskeleton-associated pp60src substrate. Mol Cell Biol. 11:5113–5124. 1991.PubMed/NCBI

10 

Wu H and Parsons JT: Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J Cell Biol. 120:1417–1426. 1993. View Article : Google Scholar : PubMed/NCBI

11 

Weed SA and Parsons JT: Cortactin: Coupling membrane dynamics to cortical actin assembly. Oncogene. 20:6418–6434. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Bringuier PP, Tamimi Y, Schuuring E and Schalken J: Expression of cyclin D1 and EMS1 in bladder tumours; relationship with chromosome 11q13 amplification. Oncogene. 12:1747–1753. 1996.PubMed/NCBI

13 

Yuan BZ, Zhou X, Zimonjic DB, Durkin ME and Popescu NC: Amplification and overexpression of the EMS 1 oncogene, a possible prognostic marker, in human hepatocellular carcinoma. J Mol Diagn. 5:48–53. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Rothschild BL, Shim AH, Ammer AG, Kelley LC, Irby KB, Head JA, Chen L, Varella-Garcia M, Sacks PG, Frederick B, et al: Cortactin overexpression regulates actin-related protein 2/3 complex activity, motility, and invasion in carcinomas with chromosome 11q13 amplification. Cancer Res. 66:8017–8025. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Hofman P, Butori C, Havet K, Hofman V, Selva E, Guevara N, Santini J and Van Obberghen-Schilling E: Prognostic significance of cortactin levels in head and neck squamous cell carcinoma: Comparison with epidermal growth factor receptor status. Br J Cancer. 98:956–964. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Clark ES, Whigham AS, Yarbrough WG and Weaver AM: Cortactin is an essential regulator of matrix metalloproteinase secretion and extracellular matrix degradation in invadopodia. Cancer Res. 67:4227–4235. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Wei J, Zhao Z-X, Li Y, Zhou Z-Q and You T-G: Cortactin expression confers a more malignant phenotype to gastric cancer SGC-7901 cells. World J Gastroenterol. 20:3287–3300. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Zhang YY, Chen B and Ding YQ: Metastasis-associated factors facilitating the progression of colorectal cancer. Asian Pac J Cancer Prev. 13:2437–2444. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Daly RJ: Cortactin signalling and dynamic actin networks. Biochem J. 382:13–25. 2004. View Article : Google Scholar : PubMed/NCBI

20 

McNiven MA, Kim L, Krueger EW, Orth JD, Cao H and Wong TW: Regulated interactions between dynamin and the actin-binding protein cortactin modulate cell shape. J Cell Biol. 151:187–198. 2000. View Article : Google Scholar : PubMed/NCBI

21 

Cao H, Orth JD, Chen J, Weller SG, Heuser JE and McNiven MA: Cortactin is a component of clathrin-coated pits and participates in receptor-mediated endocytosis. Mol Cell Biol. 23:2162–2170. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Engqvist-Goldstein AE, Zhang CX, Carreno S, Barroso C, Heuser JE and Drubin DG: RNAi-mediated Hip1R silencing results in stable association between the endocytic machinery and the actin assembly machinery. Mol Biol Cell. 15:1666–1679. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Hui R, Campbell DH, Lee CS, McCaul K, Horsfall DJ, Musgrove EA, Daly RJ, Seshadri R and Sutherland RL: EMS1 amplification can occur independently of CCND1 or INT-2 amplification at 11q13 and may identify different phenotypes in primary breast cancer. Oncogene. 15:1617–1623. 1997. View Article : Google Scholar : PubMed/NCBI

24 

Rodrigo JP, García LA, Ramos S, Lazo PS and Suárez C: EMS1 gene amplification correlates with poor prognosis in squamous cell carcinomas of the head and neck. Clin Cancer Res. 6:3177–3182. 2000.PubMed/NCBI

25 

Patel AS, Schechter GL, Wasilenko WJ and Somers KD: Overexpression of EMS1/cortactin in NIH3T3 fibroblasts causes increased cell motility and invasion in vitro. Oncogene. 16:3227–3232. 1998. View Article : Google Scholar : PubMed/NCBI

26 

Huang C, Liu J, Haudenschild CC and Zhan X: The role of tyrosine phosphorylation of cortactin in the locomotion of endothelial cells. J Biol Chem. 273:25770–25776. 1998. View Article : Google Scholar : PubMed/NCBI

27 

Li Y, Tondravi M, Liu J, Smith E, Haudenschild CC, Kaczmarek M and Zhan X: Cortactin potentiates bone metastasis of breast cancer cells. Cancer Res. 61:6906–6911. 2001.PubMed/NCBI

28 

Clauditz TS, Gontarewicz A, Lebok P, Tsourlakis MC, Grob TJ, Münscher A, Sauter G, Bokemeyer C, Knecht R and Wilczak W: Epidermal growth factor receptor (EGFR) in salivary gland carcinomas: Potentials as therapeutic target. Oral Oncol. 48:991–996. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Gazdar AF: Epidermal growth factor receptor inhibition in lung cancer: The evolving role of individualized therapy. Cancer Metastasis Rev. 29:37–48. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Pirker R, Pereira JR, von Pawel J, Krzakowski M, Ramlau R, Park K, de Marinis F, Eberhardt WE, Paz-Ares L, Störkel S, et al: EGFR expression as a predictor of survival for first-line chemotherapy plus cetuximab in patients with advanced non-small-cell lung cancer: Analysis of data from the phase 3 FLEX study. Lancet Oncol. 13:33–42. 2012. View Article : Google Scholar

31 

Harder J, Waiz O, Otto F, Geissler M, Olschewski M, Weinhold B, Blum HE, Schmitt-Graeff A and Opitz OG: EGFR and HER2 expression in advanced biliary tract cancer. World J Gastroenterol. 15:4511–4517. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Galizia G, Lieto E, Orditura M, Castellano P, Mura AL, Imperatore V, Pinto M, Zamboli A, De Vita F and Ferraraccio F: Epidermal growth factor receptor (EGFR) expression is associated with a worse prognosis in gastric cancer patients undergoing curative surgery. World J Surg. 31:1458–1468. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Sebolt-Leopold JS and Herrera R: Targeting the mitogen-activated protein kinase cascade to treat cancer. Nat Rev Cancer. 4:937–947. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Hoshino R, Chatani Y, Yamori T, Tsuruo T, Oka H, Yoshida O, Shimada Y, Ari-i S, Wada H, Fujimoto J, et al: Constitutive activation of the 41-/43-kDa mitogen-activated protein kinase signaling pathway in human tumors. Oncogene. 18:813–822. 1999. View Article : Google Scholar : PubMed/NCBI

35 

Amundadottir LT and Leder P: Signal transduction pathways activated and required for mammary carcinogenesis in response to specific oncogenes. Oncogene. 16:737–746. 1998. View Article : Google Scholar : PubMed/NCBI

36 

Alessi DR, Cuenda A, Cohen P, Dudley DT and Saltiel AR: PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem. 270:27489–27494. 1995. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ni Q, Yu J, Qian F, Sun N, Xiao J and Zhu J: Cortactin promotes colon cancer progression by regulating ERK pathway. Int J Oncol 47: 1034-1042, 2015.
APA
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., & Zhu, J. (2015). Cortactin promotes colon cancer progression by regulating ERK pathway. International Journal of Oncology, 47, 1034-1042. https://doi.org/10.3892/ijo.2015.3072
MLA
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., Zhu, J."Cortactin promotes colon cancer progression by regulating ERK pathway". International Journal of Oncology 47.3 (2015): 1034-1042.
Chicago
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., Zhu, J."Cortactin promotes colon cancer progression by regulating ERK pathway". International Journal of Oncology 47, no. 3 (2015): 1034-1042. https://doi.org/10.3892/ijo.2015.3072
Copy and paste a formatted citation
x
Spandidos Publications style
Ni Q, Yu J, Qian F, Sun N, Xiao J and Zhu J: Cortactin promotes colon cancer progression by regulating ERK pathway. Int J Oncol 47: 1034-1042, 2015.
APA
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., & Zhu, J. (2015). Cortactin promotes colon cancer progression by regulating ERK pathway. International Journal of Oncology, 47, 1034-1042. https://doi.org/10.3892/ijo.2015.3072
MLA
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., Zhu, J."Cortactin promotes colon cancer progression by regulating ERK pathway". International Journal of Oncology 47.3 (2015): 1034-1042.
Chicago
Ni, Q., Yu, J., Qian, F., Sun, N., Xiao, J., Zhu, J."Cortactin promotes colon cancer progression by regulating ERK pathway". International Journal of Oncology 47, no. 3 (2015): 1034-1042. https://doi.org/10.3892/ijo.2015.3072
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team