Hypoxia upregulates Malat1 expression through a CaMKK/AMPK/HIF-1α axis

  • Authors:
    • Sandrine Sallé-Lefort
    • Stéphanie Miard
    • Marc-André Nolin
    • Louise Boivin
    • Marie-Ève Paré
    • Richard Debigaré
    • Frédéric Picard
  • View Affiliations

  • Published online on: July 25, 2016     https://doi.org/10.3892/ijo.2016.3630
  • Pages: 1731-1736
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Increased expression levels of the long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (Malat1) have been associated with enhanced proliferation and metastasis of several cancer cell types. Hypoxia, a hallmark characteristic of solid tumors, has been linked to an increase in the activity of the ATP-generating AMPK protein. Since Malat1 was recently shown to be upregulated during hypoxia, the objective of this study was to determine the contribution of AMPK in the mechanistic pathways regulating Malat1 expression in low oxygen conditions. Compared to those cultured in 21% O2 conditions, HeLa cells incubated in 1.5% O2 expressed more Malat1 transcripts. This observation was mimicked in HEK293T cells using a synthetic reporter construct containing 5.6 kb of the human Malat1 promoter, suggesting that hypoxia directly impacted Malat1 gene transcription. Interestingly, pharmacological stimulation of AMPK increased Malat1 promoter transactivation in 21% O2 conditions, whereas inhibition of either AMPK or its upstream activator CaMKK completely abolished the augmentation of Malat1 under hypoxia. Pharmacological modulation of LKB1, another major regulator of AMPK, had no impact on Malat1 promoter transactivation, suggesting that calcium inputs are important in the control of Malat1 expression by AMPK. Overexpression of hypoxia-inducible factor-1α (HIF-1α) increased Malat1 expression in 21% O2 conditions, whereas pharmacological inhibition of HIF-1α blocked the impact of hypoxia on the Malat1 promoter. Taken together, these findings strongly suggest that Malat1 expression is regulated in hypoxic conditions by a CaMKK/AMPK/HIF-1α axis. More research is needed in physiological settings to test the clinical relevance of this pathway.

Introduction

During cancer development, cell proliferation rates exceed blood vessel formation, leading to hypoxia in solid tumor microenvironment, which is a hallmark of highly proliferative tumor cells (1). Proliferating cancer cells proliferate using ‘the Warburg effect’, which consists in increased glucose uptake and metabolism through anaerobic glycolysis instead of oxidative phosphorylation (2), a process in part controlled by the AMP-activated protein kinase (AMPK), a master regulator of cellular energy pools (3). In addition, AMPK is tightly linked to cancer by its ability to induce the phosphorylation of the tumor suppressor p53, leading to DNA synthesis inhibition (4) and cell cycle arrest through inhibition of the mammalian target of rapamycin (mTOR) (5).

Hypoxic exposure leads to an increase in hypoxia-inducible factor 1α (HIF-1α), a transcription factor essential in cell adaptation/survival (6). Whereas the HIF-1α protein is rapidly degraded under normal (21%) oxygen conditions, hypoxia increases HIF-1α levels and transcriptional activity, which then promotes the expression of a number of genes necessary for cancer cell survival (7).

Metastasis-associated lung adenocarcinoma transcript 1 (Malat1), also named nuclear-enriched abundant transcript 2, is a conserved long non-coding RNA (lncRNA) ubiquitously expressed (8). High levels of Malat1 were initially associated to the severity of lung metastasis (8), but this observation has since been extended to many other types of tumors (913). Malat1 appears to stimulate cell proliferation at the expense of differentiation and senescence (1315). Malat1−/− mouse xenografts show a nearly 80% lower tumor development in vivo (10), possibly through modification of serine/arginine splicing factors (16).

Genetic loss of Malat1 does not affect mouse viability (17); however, Malat1 has been suggested to modulate angiogenesis in vivo (18). Interestingly, hypoxia upregulates Malat1 in vitro (18,19), and mice directly exposed to hypoxia also show increased Malat1 expression levels in specific tissues such as proximal tubules (19). Based on these findings, it is thus likely that the increase in Malat1 expression is part of an adaptive response to hypoxia. The aim of this study was thus to mechanistically investigate the pathways that contribute to the transcriptional stimulation in Malat1 levels in cells under hypoxia. Our results show that AMPK, through its upstream calcium/calmodulin-dependent protein kinase kinase (CaMKK), is a major node triggering Malat1 transcription upon hypoxia in a HIF-1α-dependent manner.

Materials and methods

Cell culture and reagents

HeLa and HEK293T cells were from ATCC (Manassas, VA, USA). Cells were grown in DMEM containing 1 g/l glucose, 10% FBS, 2 mM glutamine, and 1% penicillin-streptomycin. Compounds (Sigma-Aldrich, Oakville, ON, USA) were suspended in the appropriate vehicle (DMSO or medium without FBS). A pCDNA3 expression plasmid containing the human HIF-1α cDNA was purchased from Addgene (Cambridge, MA, USA).

Oxygen conditions

Hypoxic conditions were maintained in a humidified variable aerobic workstation (Coy Laboratory) at 37°C. To induce hypoxia, oxygen concentrations were reduced from 21 to 1.5%, while carbon dioxide remained at 5%. Oxygen sensor continuously monitored and adjusted the oxygen level during experiments.

Cloning of the human Malat1 promoter

The Malat1 promoter was amplified from human genomic DNA by PCR using primers 5′-TGTGGGAGCTTTTCAGTATTC-3′ and 5′-CTGGAATGGCCAGCCTATAA-3′, effectively resulting in a fragment containing a sequence of 5.6 kb directly upstream of the Malat1 gene initiation site. The fragment was first subcloned in TOPO®XL vector (Thermofisher) according to the manufacturer’s instructions, and then cloned in KpnI/XhoI-digested pGL3 luciferase reporter vector (Promega). Validity of this construct was confirmed by sequencing.

Gene reporter assays

HEK293T cells were seeded in 24-well plates at 80% confluence. Six hours later, cells were transfected for 12 h with 250 ng of the reporter vector (hMALAT1_prom-pGL3 or p(HA)HIF-1α-pCDNA3) and 50 ng of a β-galactosidase expression vector as described previously (20). Transfected cells were FBS-starved for 2 h before any pharmacological treatment. Luciferase activity and β-galactosidase activity were measured as described previously (20) using a Luminoskan™ Ascent microplate luminometer or a Multiskan Spectrum (Thermo Scientific), respectively. Luciferase activity levels were normalized against β-galactosidase activity levels. The figures represent the mean fold activation ± SEM of at least three independent gene reporter experiments.

RNA isolation and quantitative PCR

Whole cell RNA extracts were prepared as recommended by the manufacturer (GE Healthcare). DNA reverse transcription was prepared with 0.5 μg of total RNA using qScript™ cDNA Synthesis kit (Quanta Biosciences). Quantitative PCR were performed on a 7900HT Applied Biosystems, using Sybr™-Green detection (Sigma-Aldrich), normalized to a housekeeping gene. The following nucleotide pairs were used to amplify Malat1: forward, GTAATGGAAAGTAAAGCCCTGAAC and reverse, CCCCGGAACTTTTAAAATACCTCT.

Western blot analysis

Whole cell proteins were extracted by lysis with an extraction buffer containing NP40 0.04%, Tween 0.02%, sodium orthovanadate 1.5 mM and 10% protease inhibitors (Roche), and incubated 10 min on ice. After centrifugation, the supernatant was collected and considered as whole cell extract. Protein concentrations were determined with DC™ Protein Assay Reagent (Bio-Rad). Proteins (50 μg) per lane were loaded onto a 7.5% SDS-polyacrylamide gel, and then blotted with Trans-Blot® Turbo™ (Bio-Rad) on PVDF membranes. Membranes were saturated in fat-free dry milk for 1 h, and then incubated with primary antibodies overnight at 4°C in recommended buffer at recommended dilutions (anti-HIF-1α from R&D, anti-phospho-Thr172 AMPK and anti-AMPK total from Cell Signaling, anti-β-actin from Millipore). Membranes were then incubated with secondary antibodies coupled with HRP for 1 h (from Santa-Cruz for anti-goat-HRP, from GE Healthcare for anti-mouse-HRP and anti-rabbit-HRP). Signals were detected with ECL™ Western Blotting Detection Reagents (GE Healthcare) on Kodak film.

Statistical analyses

Data are presented as mean ± SEM of at least three independent experiments performed in triplicate. Data were analyzed by one or two-way ANOVA as appropriate. A value of p<0.05 was considered statistically significant.

Results

Hypoxia induces Malat1 expression through AMPK

In adenocarcinoma HeLa cells, hypoxia (1.5% O2) induced a time-dependent increase in Malat1 RNA levels (Fig. 1A). To determine that this effect was due to an impact on Malat1 gene transcription, this experiment was repeated in HEK293T cells transfected with a construct containing 5.6 kb of the human Malat1 promoter cloned upstream of the luciferase gene. In this setting, hypoxia stimulated Malat1 promoter transactivation to a similar time-dependent extent, resulting in 2- and 4-fold increases after 24 and 48 h of incubation in low oxygen conditions, respectively (Fig. 1B). This suggested a direct impact of hypoxia on the Malat1 promoter.

Remarkably, the induction of the Malat1 promoter by hypoxia was completely blocked by compound C (Fig. 1C), an ATP-competitive inhibitor of AMPK (21), suggesting that AMPK mediates the effect of 1.5% O2 conditions on Malat1 expression. Consistent with this concept, pharmacological activation of AMPK with the 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) was sufficient to stimulate Malat1 promoter transactivation in normal oxygen conditions (21% O2) (Fig. 1D). This effect was preventable by co-treatment with compound C (Fig. 1D). Interestingly, the anti-diabetic drug metformin, an indirect AMPK activator shown to lower carcinogenesis (22), also induced the activation of the Malat1 promoter, albeit to a lower extent (Fig. 1E). Taken together, these findings indicate that hypoxia stimulates Malat1 expression through the activation of AMPK.

Inhibition of CaMKK blocks hypoxia-induced Malat1 promoter transactivation

The activity of AMPK is mainly regulated by two upstream kinases, namely the calcium-dependent kinase CaMKK and LKB1, itself activated by EPAC (23,24). In 21% O2 conditions, treatment of HEK293T cells with the specific EPAC activator 8-CTP-2me-cAMP (25) did not result in the expected increase in Malat1 promoter transactivation (Fig. 2A). In contrast, incubation with the pharmacological CaMKK inhibitor STO-609 (26) completely prevented the induction of the Malat1 promoter under hypoxia (Fig. 2B). These findings suggest that hypoxia induces the CaMKK/AMPK cascade to stimulate Malat1 expression.

Hypoxia induces Malat1 via the induction of HIF-1α

Analysis of protein extracts from cells incubated under 21% and 1.5% O2 conditions indicated that hypoxia induced the phosphorylation of AMPK at its Thr-172 residue within 60 min (Fig. 3A). In the same conditions, an increase in HIF-1α was observed within 120 min under hypoxia (Fig. 3A). This suggests that the stimulation of HIF-1α protein levels occurs after AMPK-activating events. Supporting this hypothesis, the hypoxia-induced upregulation of HIF-1α levels was blocked in cells incubated with the CaMKK inhibitor STO-609 (Fig. 3B). This further indicates that the increase in HIF-1α levels is downstream of the CaMKK/AMPK complex.

To investigate the possibility of a direct impact of HIF-1α in the hypoxia-induced stimulation of Malat1 expression, HEK293T cells containing the 5.6-kb human Malat1 promoter reporter construct were treated with YC-1, a pharmacological inhibitor of HIF-1α activity (27). Whereas hypoxia increased Malat1 promoter transactivation in control cells as expected, this effect was dose-dependently attenuated in cells treated with YC-1 (Fig. 3C). Consistent with this finding, transient overexpression of HIF-1α under 21% O2 conditions was sufficient to transactivate the Malat1 promoter (Fig. 3D). This effect was completely abolished by co-treatment with YC-1 (Fig. 3D).

Discussion

The lncRNA Malat1 appears ubiquitously present in cells during nonpathogenic conditions (8), however, several studies have reported its high levels in many cancer types. Yet, the metabolic pathways regulating its transcription in these conditions remain elusive. This study focused on hypoxia, a powerful physiologic input in solid tumors. This study strongly suggests that hypoxia triggers a robust increase in Malat1 expression through the enhanced activity of the CaMKK/AMPK/HIF-1α axis.

Although most studies on the stimulating impact of Malat1 on cancer cell proliferation and migration have been obtained in normoxic conditions (18), upregulation of Malat1 expression during hypoxia has been recently observed in vitro and in vivo (19). Our study confirmed that hypoxia is an initial signal leading to increased Malat1 expression level (Fig. 1). Oxygen deprivation triggers several cellular processes required for survival, including modulation of energy sensors such as AMPK (3). Indeed, in hypoxic environments, AMPK is phosphorylated (28), triggering the activation of its downstream effector acetyl coenzyme A carboxylases 1 and 2 (ACC1/2). Such adaptive phenomenon is not observed in AMPK-null mouse embryo fibroblasts (MEFs) (28), highlighting the importance of AMPK in the regulation of energy upon hypoxia. This study also found that AMPK phosphorylation occurs early after oxygen deprivation, and that this event is necessary for a full augmentation in Malat1 expression (Fig. 1). Thus, it is likely that Malat1 overexpression is part of the global adaptive response to low oxygen conditions.

The upstream mechanisms leading to hypoxia-driven AMPK activation are unclear. In response to low energy status, AMPK activation has been linked to phosphorylation of LKB1, a serine/threonine kinase also associated with tumor suppression (29). However, incubation of cells with the LKB1 upstream kinase activator 8-CTP-2me-cAMP suggests that LKB1 does not robustly modify Malat1 expression in our model (Fig. 2A), which is consistent with the absence of impact of PKA activators on the same system (data not shown).

More recently, other studies indicated that CaMKK may play an important role in hypoxia-induced AMPK stimulation (30). Indeed, knockdown of LKB1 in MEFs cultured in hypoxic conditions had no impact on ACC1/2 phosphorylation, suggesting that LKB1 is not the upstream kinase leading to AMPK activation under hypoxia (30). In contrast, knockdown of CaMKK in the same system clearly diminished AMPK and ACC1/2 phosphorylation status (30). This is in agreement with the fact that hypoxia increases intracellular calcium concentrations (31), which has been recently shown to be regulated by the effects of STIM1-mediated store-operated calcium entry (32). Our study is consistent with these studies, since the specific CaMKK inhibitor STO-609 abolished the activation of Malat1 under hypoxia (Fig. 2). The possible control of Malat1 by STIM1 remains to be investigated.

Calcium plays major functions in the regulation of gene expression. Notably, calcium chelation modulates HIF-1α activity (3335). Moreover, calcium entry rapidly stimulates CaMKK-induced p300 phosphorylation, which stabilizes HIF-1α (32,36). Our study also corroborates that hypoxia-induced HIF-1α protein stabilization is under CaMKK regulation, as it occurred after AMPK phosphorylation (Fig. 3), and that cells treated with STO-609 did not show high levels of HIF-1α under hypoxic conditions (Fig. 3). More importantly, this study shows that Malat1 overexpression upon hypoxia is dependent of HIF-1α, and that an increase in HIF-1α levels is sufficient to stimulate Malat1 transcription to a similar extent as did hypoxia (Fig. 3). Further supporting the large contribution of HIF-1α in the increase in Malat1 in low oxygen conditions, loss of HIF-1α activity by YC-1 treatment completely blocked hypoxia-induced Malat1 transcription. Interestingly, bioinformatics analysis indicated four putative HIF-1α binding sites, corresponding to the consensus hypoxia response element ([A/G]CGTG), within 5.6 kb of the human Malat1 promoter, at positions −2246, −1687, −1317, and −259 from the initiation start of the Malat1 coding sequence. The relative importance of each of these binding sites in the transactivation of the Malat1 promoter by HIF-1α remains to be tested.

Interestingly, a recent study reported a possible involvement of p53 as a transcriptional repressor of Malat1 expression in early stage of hematopoietic cell proliferation (37). It is established that oxygen deprivation modulates the levels and activity of p53, a major transcription regulator of cellular fate under intensive stress (38). Depending on oxygen availability (39), it is thus possible that p53 influenced the action of HIF-1α in this study, since reciprocal transcriptional effects by HIF-1α and p53 have been reported (1,40). At the molecular level, this is a likely event as they share and compete for the nuclear cofactor p300 (41).

In conclusion, this study was conducted to understand the mechanisms regulating Malat1 expression levels upon hypoxia, an important characteristic of cancer tissues. This study indicates that the enhanced transcription of the Malat1 gene upon low oxygen conditions is under the control of HIF-1α, itself regulated by the activation of the CaMKK/AMPK complex, a master regulator of cellular energy. Our results also support and extend published literature that calcium influx is an early signal in the adaptive response to hypoxic stress. Finally, since Malat1 induces angiogenesis in cancer (18,42), it would be of interest to determine its role in physiological processes in which increased tissue mass is associated with high demand for oxygen and energy substrates, such as exercise-induced myogenesis, or cold-induced brown adipose tissue hyperplasia.

References

1 

Harris AL: Hypoxia - a key regulatory factor in tumour growth. Nat Rev Cancer. 2:38–47. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Vander Heiden MG, Cantley LC and Thompson CB: Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science. 324:1029–1033. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Hardie DG and Carling D: The AMP-activated protein kinase - fuel gauge of the mammalian cell? Eur J Biochem. 246:259–273. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Imamura K, Ogura T, Kishimoto A, Kaminishi M and Esumi H: Cell cycle regulation via p53 phosphorylation by a 5′-AMP activated protein kinase activator, 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside, in a human hepatocellular carcinoma cell line. Biochem Biophys Res Commun. 287:562–567. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Inoki K, Zhu T and Guan KL: TSC2 mediates cellular energy response to control cell growth and survival. Cell. 115:577–590. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW and Ratcliffe PJ: Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc Natl Acad Sci USA. 94:8104–8109. 1997. View Article : Google Scholar : PubMed/NCBI

7 

Salceda S and Caro J: Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J Biol Chem. 272:22642–22647. 1997. View Article : Google Scholar : PubMed/NCBI

8 

Ji P, Diederichs S, Wang W, Böing S, Metzger R, Schneider PM, Tidow N, Brandt B, Buerger H, Bulk E, et al: MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031–8041. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Lin R, Maeda S, Liu C, Karin M and Edgington TS: A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene. 26:851–858. 2007. View Article : Google Scholar

10 

Gutschner T, Hämmerle M, Eissmann M, Hsu J, Kim Y, Hung G, Revenko A, Arun G, Stentrup M, Gross M, et al: The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res. 73:1180–1189. 2013. View Article : Google Scholar

11 

Lai MC, Yang Z, Zhou L, Zhu QQ, Xie HY, Zhang F, Wu LM, Chen LM and Zheng SS: Long non-coding RNA MALAT-1 overexpression predicts tumor recurrence of hepatocellular carcinoma after liver transplantation. Med Oncol. 29:1810–1816. 2012. View Article : Google Scholar

12 

Xu C, Yang M, Tian J, Wang X and Li Z: MALAT-1: A long non-coding RNA and its important 3′ end functional motif in colorectal cancer metastasis. Int J Oncol. 39:169–175. 2011.PubMed/NCBI

13 

Ying L, Chen Q, Wang Y, Zhou Z, Huang Y and Qiu F: Upregulated MALAT-1 contributes to bladder cancer cell migration by inducing epithelial-to-mesenchymal transition. Mol Biosyst. 8:2289–2294. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Tano K, Mizuno R, Okada T, Rakwal R, Shibato J, Masuo Y, Ijiri K and Akimitsu N: MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett. 584:4575–4580. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Tripathi V, Shen Z, Chakraborty A, Giri S, Freier SM, Wu X, Zhang Y, Gorospe M, Prasanth SG, Lal A, et al: Long noncoding RNA MALAT1 controls cell cycle progression by regulating the expression of oncogenic transcription factor B-MYB. PLoS Genet. 9:e10033682013. View Article : Google Scholar : PubMed/NCBI

16 

Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al: The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 39:925–938. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Eissmann M, Gutschner T, Hämmerle M, Günther S, Caudron-Herger M, Gross M, Schirmacher P, Rippe K, Braun T, Zörnig M, et al: Loss of the abundant nuclear non-coding RNA MALAT1 is compatible with life and development. RNA Biol. 9:1076–1087. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Michalik KM, You X, Manavski Y, Doddaballapur A, Zörnig M, Braun T, John D, Ponomareva Y, Chen W, Uchida S, et al: Long noncoding RNA MALAT1 regulates endothelial cell function and vessel growth. Circ Res. 114:1389–1397. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Lelli A, Nolan KA, Santambrogio S, Gonçalves AF, Schönenberger MJ, Guinot A, Frew IJ, Marti HH, Hoogewijs D and Wenger RH: Induction of long non coding RNA MALAT1 in hypoxic mice. Hypoxia (Auckl). 2015:45–52. 2015.

20 

Miard S, Dombrowski L, Carter S, Boivin L and Picard F: Aging alters PPARgamma in rodent and human adipose tissue by modulating the balance in steroid receptor coactivator-1. Aging Cell. 8:449–459. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, et al: Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest. 108:1167–1174. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Evans JM, Donnelly LA, Emslie-Smith AM, Alessi DR and Morris AD: Metformin and reduced risk of cancer in diabetic patients. BMJ. 330:1304–1305. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Fu D, Wakabayashi Y, Lippincott-Schwartz J and Arias IM: Bile acid stimulates hepatocyte polarization through a cAMP-Epac-MEK-LKB1-AMPK pathway. Proc Natl Acad Sci USA. 108:1403–1408. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Lo B, Strasser G, Sagolla M, Austin CD, Junttila M and Mellman I: Lkb1 regulates organogenesis and early oncogenesis along AMPK-dependent and -independent pathways. J Cell Biol. 199:1117–1130. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Enserink JM, Christensen AE, de Rooij J, van Triest M, Schwede F, Genieser HG, Døskeland SO, Blank JL and Bos JL: A novel Epac-specific cAMP analogue demonstrates independent regulation of Rap1 and ERK. Nat Cell Biol. 4:901–906. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Tokumitsu H, Inuzuka H, Ishikawa Y, Ikeda M, Saji I and Kobayashi R: STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. J Biol Chem. 277:15813–15818. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Yeo EJ, Chun YS, Cho YS, Kim J, Lee JC, Kim MS and Park JW: YC-1: A potential anticancer drug targeting hypoxia-inducible factor 1. J Natl Cancer Inst. 95:516–525. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Laderoute KR, Amin K, Calaoagan JM, Knapp M, Le T, Orduna J, Foretz M and Viollet B: 5′-AMP-activated protein kinase (AMPK) is induced by low-oxygen and glucose deprivation conditions found in solid-tumor microenvironments. Mol Cell Biol. 26:5336–5347. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Shaw RJ, Kosmatka M, Bardeesy N, Hurley RL, Witters LA, DePinho RA and Cantley LC: The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proc Natl Acad Sci USA. 101:3329–3335. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Mungai PT, Waypa GB, Jairaman A, Prakriya M, Dokic D, Ball MK and Schumacker PT: Hypoxia triggers AMPK activation through reactive oxygen species-mediated activation of calcium release-activated calcium channels. Mol Cell Biol. 31:3531–3545. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Arnould T, Michiels C, Alexandre I and Remacle J: Effect of hypoxia upon intracellular calcium concentration of human endothelial cells. J Cell Physiol. 152:215–221. 1992. View Article : Google Scholar : PubMed/NCBI

32 

Li Y, Guo B, Xie Q, Ye D, Zhang D, Zhu Y, Chen H and Zhu B: STIM1 mediates hypoxia-driven hepatocarcinogenesis via interaction with HIF-1. Cell Rep. 12:388–395. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Mottet D, Michel G, Renard P, Ninane N, Raes M and Michiels C: ERK and calcium in activation of HIF-1. Ann NY Acad Sci. 973:448–453. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Mottet D, Michel G, Renard P, Ninane N, Raes M and Michiels C: Role of ERK and calcium in the hypoxia-induced activation of HIF-1. J Cell Physiol. 194:30–44. 2003. View Article : Google Scholar

35 

Berchner-Pfannschmidt U, Petrat F, Doege K, Trinidad B, Freitag P, Metzen E, de Groot H and Fandrey J: Chelation of cellular calcium modulates hypoxia-inducible gene expression through activation of hypoxia-inducible factor-1alpha. J Biol Chem. 279:44976–44986. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Hui AS, Bauer AL, Striet JB, Schnell PO and Czyzyk-Krzeska MF: Calcium signaling stimulates translation of HIF-alpha during hypoxia. FASEB J. 20:466–475. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Ma XY, Wang JH, Wang JL, Ma CX, Wang XC and Liu FS: Malat1 as an evolutionarily conserved lncRNA, plays a positive role in regulating proliferation and maintaining undifferentiated status of early-stage hematopoietic cells. BMC Genomics. 16:6762015. View Article : Google Scholar : PubMed/NCBI

38 

Koumenis C, Alarcon R, Hammond E, Sutphin P, Hoffman W, Murphy M, Derr J, Taya Y, Lowe SW, Kastan M, et al: Regulation of p53 by hypoxia: Dissociation of transcriptional repression and apoptosis from p53-dependent transactivation. Mol Cell Biol. 21:1297–1310. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Zhou CH, Zhang XP, Liu F and Wang W: Modeling the interplay between the HIF-1 and p53 pathways in hypoxia. Sci Rep. 5:138342015. View Article : Google Scholar : PubMed/NCBI

40 

Sermeus A and Michiels C: Reciprocal influence of the p53 and the hypoxic pathways. Cell Death Dis. 2:e1642011. View Article : Google Scholar : PubMed/NCBI

41 

Schmid T, Zhou J, Köhl R and Brüne B: p300 relieves p53-evoked transcriptional repression of hypoxia-inducible factor-1 (HIF-1). Biochem J. 380:289–295. 2004. View Article : Google Scholar : PubMed/NCBI

42 

Tee AE, Liu B, Song R, Li J, Pasquier E, Cheung BB, Jiang C, Marshall GM, Haber M, Norris MD, et al: The long noncoding RNA MALAT1 promotes tumor-driven angiogenesis by up-regulating pro-angiogenic gene expression. Oncotarget. 7:8663–8675. 2016.PubMed/NCBI

Related Articles

Journal Cover

October 2016
Volume 49 Issue 4

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Sallé-Lefort, S., Miard, S., Nolin, M., Boivin, L., Paré, M., Debigaré, R., & Picard, F. (2016). Hypoxia upregulates Malat1 expression through a CaMKK/AMPK/HIF-1α axis. International Journal of Oncology, 49, 1731-1736. https://doi.org/10.3892/ijo.2016.3630
MLA
Sallé-Lefort, S., Miard, S., Nolin, M., Boivin, L., Paré, M., Debigaré, R., Picard, F."Hypoxia upregulates Malat1 expression through a CaMKK/AMPK/HIF-1α axis". International Journal of Oncology 49.4 (2016): 1731-1736.
Chicago
Sallé-Lefort, S., Miard, S., Nolin, M., Boivin, L., Paré, M., Debigaré, R., Picard, F."Hypoxia upregulates Malat1 expression through a CaMKK/AMPK/HIF-1α axis". International Journal of Oncology 49, no. 4 (2016): 1731-1736. https://doi.org/10.3892/ijo.2016.3630