Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
March-2018 Volume 52 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2018 Volume 52 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma

  • Authors:
    • Lei Wang
    • Zhichao Hou
    • Ayshamgul Hasim
    • Abulajiang Abuduerheman
    • Haiping Zhang
    • Madiniyat Niyaz
    • Idiris Awut
    • Halmurat Upur
    • Ilyar Sheyhidin
  • View Affiliations / Copyright

    Affiliations: Department of Thoracic Surgery, Τhe First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang Uygur Autonomous Region 830054, P.R. China, Department of Pathology, Medical University of Xinjiang, Urumqi, Xinjiang Uygur Autonomous Region 830054, P.R. China, Clinical Medical Research Institute, Τhe First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang Uygur Autonomous Region 830054, P.R. China, Department of Uyghur Medicine, Xinjiang Medical University, Urumqi, Xinjiang Uygur Autonomous Region 830054, P.R. China
  • Pages: 861-871
    |
    Published online on: January 24, 2018
       https://doi.org/10.3892/ijo.2018.4253
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Ring finger protein 113A (RNF113A) possesses a C3HC4 zinc finger domain and this domain is found in E3 ubiquitin ligase and is involved in tumorigenesis. To date, and at least to the best of our knowledge, there are no studies available which have investigated RNF113A in cancer. Thus, this study aimed to explore the role of RNF113A in the development of esophageal squamous cell carcinoma (ESCC). For this purpose, paraffin-embedded samples from 117 patients with ESCC were selected, as well as 41 pairs of fresh-frozen ESCC and adjacent normal tissue samples. RNF113A expression was examined by immunohistochemistry and reverse transcription-quantitative PCR (RT-qPCR). RNF113A was overexpressed or silenced in the EC9706 and Eca109 cells. The cells were examined for cell cycle progression, apoptosis, invasiveness and migration. Xenograft tumors were also created in mice using the Eca109 cells. Tumor differentiation (P=0.008) and T classification (P<0.001) were found to be significantly associated with RNF113A expression. No statistically significant association was observed between RNF113A expression and sex, age, histological type, tumor location and lymph node metastasis (N classification). Kaplan-Meier analysis revealed that the patients with ESCC with ahigh expression of RNF113A had a lower survival rate than those with a low expression (P=0.002). Multivariate analysis revealed that RNF113A expression (HR=2.406; 95% CI, 1.301-4.449, P=0.005) was independently associated with overall survival in patients with ESCC. The overexpression of RNF113A promoted proliferation, migration, and invasiveness of ESCC cell lines in vitro, and RNF113A silencing reversed these malignant behaviors. RNF113A knockdown inhibited tumor growth in vivo. Thus, these results indicate that RNF113A promotes the proliferation, migration and invasiveness of ESCC cell lines. RNF113A expression in ESCC is this associated with a poor prognosis of affected patients.

Introduction

Esophageal cancer (EC) is the sixth leading cause of cancer-related mortality worldwide (1). In China, EC is ranked as the fourth leading cause of cancer-related mortality, and an estimated 218,957 individuals succumbed to the disease in China in 2011 (2). In China, the majority of EC cases are esophageal squamous cell carcinoma (ESCC) (3). ESCC is usually diagnosed at an advanced stage and its prognosis is poor (4). Approximately 80% of ESCC cases occur in the Central and South-East Asian region. China alone contributes to more than half of the global cases (53%, 210,000 cases) (5). A distinctive characteristic of EC in China is its uneven burden between rural and urban areas. Indeed, the rates of EC are 2- to 10-fold higher in rural areas compared with urban areas (2).

Kazakh patients show particularly high morbidity (68.88/100,000) and mortality rates from ESCC, particularly in the Tuoli (Xinjiang) Province, which exhibits the highest incidence (155.8/100,000) of EC worldwide. The incidence of ESCC among Kazakh patients is 4-fold higher than the general incidence in China (14.95/100,000) (6).

The treatment of ESCC involves a multidisciplinary approach combining surgery, chemotherapy and radiation therapy (7). Nevertheless, even in developed countries, the 5-year overall survival (OS) of patients with ESCC is only 15% (4), stressing the need for novel markers for screening and prognosis of ESCC.

The ubiquitin-proteasome pathway (UPP) consists of enzyme 1 (E1; or ubiquitin activating enzyme), enzyme 2 (E2; or ubiquitin-conjugating enzyme), enzyme 3 (E3; or ubiquitin ligase) and 26S proteasome (8). The UPP influences and regulates apoptosis and plays a central role in the regulation of ubiquitin binding and substrate specificity (9). To date, only E3 ligases of the RING-type have been found to participate in Snail and Twist ubiquitination, which play important roles in epithelial-mesenchymal transition (EMT) (10,11). The degradation of most EMT factors is strictly dependent upon multi-subunit RING-type E3s (11).

Ring finger protein 113A (RNF113A), previously known as ZNF183, is located on chromosome Xq24.9 (12). RNF113A has two conserved zinc finger domains: AC3H1-type zinc finger domain and a C3HC4 zinc finger domain. Zinc finger domains are shared by various tumor suppressors, DNA repair proteins and cytokine receptor-associated molecules (13). The C3H1-type RNF113A zinc finger domain is often found in RNA-binding proteins involved in splicing, while zf-C3HC4 is considered to be an ubiquitin-related structural domain (14) and is often found in E3 ubiquitin ligases (15).

A number of studies have indicated that there are close associations between ubiquitin ligase and the occurrence, development and metastasis of cancer (16,17). Previous studies have found that the disruption of RNF113A in zebrafish (Danio rerio) by transgenic insertional mutagenesis results in a small and slightly necrotic head, small eyes, pericardial edema and an underdeveloped liver and gut (12,18). In Caenorhabditis elegans, the knockdown of RNF113 has been shown to sensitize the cells to ultraviolet A (UVA)-induced DNA damage and is required for RAD51 focus formation during DNA interstrand crosslink repair (19). Corbett et al (12) and Pellagatti et al (20) reported that RNF113A mutations are associated with non-photosensitive trichothiodystrophy (TTD). RNF113A may regulate neuronal differentiation in the human central nervous system (15). Pellagatti et al (20) studied gene expression profiles in the neutrophils of 21 patients with myelodysplastic syndrome (MDS) using cDNA microarrays comprising 6,000 human genes, and found that ZNF183 was one of the most upregulated genes in MDS (20). Therefore, it can be hypothesized RNF113A is associated with the development and progression of ESCC.

To date, and at least to the best of our knowledge, there are no available studies on the role of RNF113A in cancer. Therefore, this study aimed to explore the role of RNF113A in the development of ESCC by comparing the expression of RNF113A in Kazakh patients with ESCC and paired adjacent non-tumor tissues. The biological roles of RNF113A were also investigated by inducing either the overexpression or knockdown of RNF113A in the ESCC cell lines, Eca109 and EC9706. Finally, xenograft tumors in athymic nude mice were created out to assess the tumorigenic effect of RNF113A in vivo.

Materials and methods

Study design, patients and specimens

This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University, Urumqi, China. Informed consent was obtained from all subjects prior to obtaining the samples. Paraffin-embedded samples from 117 Kazakh patients with ESCC treated at our hospital from March 2010 to December 2014, were selected. Paired ESCC and adjacent normal tissues were available for 41 patients. None of the patients had received chemoradiotherapy or radiotherapy prior to surgery. ESCC was staged and graded according to the International Union Against Cancer (21). The patients were followed-up by consulting their charts and through telephonic monitoring. Follow-up data were available for periods ranging from 3 months to 6.8 years (median, 20.8 months).

Immunohistochemistry (IHC)

The samples were incubated with anti-human RNF113A antibody (1:50 dilution, HPA000160; Sigma, St. Louis, MO, USA) overnight at 4°C, and then with biotinylated secondary antibody (PV6001; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China). IHC analysis was carried out according to previously described methods (22). The staining intensity was assessed using 5 randomly selected high-power fields (×400 magnification). The staining was evaluated by two independent pathologists who were blinded to the clinical characteristics of the patients. Any differences in opinion were resolved by consensual agreement, based on the criteria by Sinicrope et al (23). Staining was assessed with regard to intensity (0, no intensity; 1, weak intensity; 2, moderate intensity; and 3, strong intensity) and the percentage of positive cells (0, <5%; 1, between 5 and 25%; 2, between 26 and 50%; and 3, >50%). The patients were classified into 2 groups according to the total score (i.e., staining intensity score + positive cell score): the low expression group (total score of 0–2) and the high expression group (total score of 3–9).

Cell culture

The human ESCC cell lines, EC9706 and Eca109, were provided by Wuhan University (originally obtained from the China Center for Type Culture Collection, Wuhan, China). These two cell lines are frequently used to study the the malignant behavior of ESCC cells (3,16,24–28). The cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% fetal bovine serum (FBS) (both from Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin/streptomycin at 37°C in a 5% CO2 humidified incubator.

shRNA synthesis and lentivirus packaging and transduction

The shRNA sequences against RNF113A (GenBank no. NC_000023) (Table I) and the scramble sequence (5′-TTC TCC GAA CGT GTC ACG T-3′) were synthesized by GeneChem (Shanghai, China). Lentiviral vectors of RNF113A were constructed by GeneChem using the GV248 vector (GeneChem). This vector (batch #CON077) contains hU6, MCS, ubiquitin, EGFP, IRES and puromycin sequences. The ESCC cells (3–5×104/ml) were transduced with lentivirus-mediated RNF113A shRNA or scramble-shRNA [multiplicity of infection (MOI) of 20], according to the manufacturer's instructions. The cells were harvested 72 h after transduction for western blot analysis. For the subsequent experiments, we selected RNF113A-shRNA2 as it was more effective than RNF113A-shRNA1 in decreasing the expression of RNF113A (Fig. 2A).

Figure 2

Effects of the knockdown or overexpression of ring finger protein 113A (RNF113A) on RNF113A protein expression in human esophageal squamous cell carcinoma (ESCC) Eca109 and EC9706 cells. (A) Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA1, RNF113A-shRNA2, and scramble-shRNA for 72 h. (B) Eca109 and EC9706 cells were transfected with empty vector (pcDNA3.1) or RNF113A overexpression vector for 72 h. Protein expression was determined by western blot analysis. β-actin was used as an internal control. Data are presented as the means ± SD of 3 independent experiments performed in triplicate. **P<0.01 and ***P<0.001 vs. blank group; ##P<0.01 and ###P<0.001 vs. scramble-shRNA or empty vector group.

Table I

Oligonucleotide shRNA sequences of RNF113A.

Table I

Oligonucleotide shRNA sequences of RNF113A.

RNF113A-shRNA5′StemLoopStem3′
RNF113A-shRNA1Ccgg GCGTCTTCAATCCAGCGAAAGAATTCTCGAG AATTCTTTCGCTGGATTGAAGACGCTTTTTg
RNF113A-shRNA2aattcaaaaa GCGTCTTCAATCCAGCGAAAGAATTCTCGAG AATTCTTTCGCTGGATTGAAGACGC

[i] RNF113A, ring finger protein 113A.

pcDNA3.1-RNF113A overexpression

The eukaryotic expression vector, pcDNA3.1, overexpressing RNF113A (sense, 5′-TCC GCTCGAGATGATGGACTTGGAGCTGCC-3′ and antisense, 5′-ATGGGGTACCGAGTTTTTCTTAACATCTGGC-3′) was constructed by GeneChem. Polymerase chain reaction (PCR) was used to identify the recombinant clones. Sequencing was used to confirm the presence of the insert as well as the sequence and orientation of the insert. The ESCC cells were transfected with pcDNA3.1 (empty vector) and pcDNA3.1-RNF113A over-expression vector using Lipofectamine 2000 (Thermo Fisher Scientific).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from 41 pairs of frozen ESCC and adjacent normal tissue samples, and from tumor xenografts (please see description of mouse model below) using TRIzol reagent (Thermo Fisher Scientific). The concentration and purity of the RNA in each sample was determined by measuring he absorbance at 260 and 280 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Total RNA was reverse transcribed into single-stranded cDNA using the RT reagent kit (Takara Bio, Otsu, Japan). The PCR primers were as follows: RNF113A forward, 5′-TCC GCT CGA GAT GAT GGA CTT GGA GCT GCC-3′ and reverse, 5′-ATG GGG TAC CGA GTT TTT CTT AAC ATC TGG C-3′. Quantitative PCR was performed using the IQ5 system (Bio-Rad, Hercules, CA, USA) and SYBR Premix Ex Taq (Takara Bio), according to the manufacturer's instructions. The relative expression levels of RNF113A were normalized to those of β-actin (primers used were: forward, 5′-CTA AGT CAT AGT CCG CCT AGA AGC A-3′ and reverse, 5′-TGG CAC CCA GCA CAA TGA A-3′). The reaction conditions for RNF113A were as follows: 95°C for 3 min, and 40 cycles at 95°C for 10 sec followed by 59.2°C for 30 sec. The 2−ΔΔCt method was used to calculate the relative mRNA expression of the target gene.

Western blot analysis

The cells were harvested 72 h after transduction in radio-immunoprecipitation assay (RIPA) lysis buffer (Bioteke, Beijing, China). Proteins were quantified by BCA assay (Beyotime Institute of Biotechnology, Shanghai, China), and 50 µg of proteins were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto polyvinylidene fluoride (PVDF) microporous membranes (Millipore Corp., Billerica, MA, USA) and the blots were probed with rabbit polyclonal antibody against RNF113A (ab85797; Abcam, Cambridge, MA, USA) at a concentration of 1 µg/ml. β-actin (BA2305; Wuhan Boster Bio-Engineering Co., Ltd., Wuhan, China) was used as an internal control. Mouse anti-rabbit secondary antibody (31464; Thermo Fisher Scientific). Chemiluminescence substrate (Thermo Fisher Scientific) was added to visualize the bands, as previously described (22). The integrated optical density of the target proteins was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Analysis of the cell cycle and apoptosis

Cell cycle progression and apoptosis were analyzed by flow cytometry (FCM). For cell cycle analysis, the cells were washed with pre-iced phosphate-buffered saline (PBS) twice and fixed with 70% cold ethanol at 4°C overnight. Following incubation with RNase for 1 h at 4°C, the cells were stained with 2 µl of propidium iodide (PI) (500 mg/ml) for 15 min, and analyzed using a Cytomics FC500 flow cytometer (Beckman Coulter, Brea, CA, USA). For apoptosis analysis, an Annexin V-FITC apoptosis detection kit was used (Thermo Fisher Scientific). Briefly, the cells were washed twice with iced PBS and resuspended in 400 µl of 1X binding buffer at a concentration of 1×106 cells/ml. A volume of 5 µl of the Annexin V-FITC solution and 2 µl of PI was then mixed with the cells. The cells were then incubated 15 min at 4°C in the dark. Cell staining was detected using a Cytomics FC500 flow cytometry system (Beckman Coulter).

Cell invasion and migration

The cells at 5×105 cells/well were seeded on a fibronectin-coated polycarbonate membrane insert in a Transwell chamber (Corning Inc., Corning, NY, USA). RPMI-1640 supplemented with 10% FBS was added to the lower chamber. The cells that adhered to the upper surface of the chamber were wiped with a cotton swab. The number of migrated cells was counted under a light microscope (Olympus, Tokyo, Japan) in 5 random fields. For the Matrigel invasion assay, inserts pre-coated with Matrigel (40 µl, 1 mg/ml; BD Biosciences, Franklin Lakes, NJ, USA) were used for invasion assays and incubated at 37°C for 6 h.

Wound healing assay

The wound healing assay was carried out to analyze cell migration. The cells were plated in a 6-well plate at 5×105 cells/well. Upon confluent growth, scrape wounds were made using a 10-µl pipette tip. The cells were photographed at 0, 24, 48 and 72 h using an inverted fluorescence microscope (Olympus). The wound closure rate was calculated as follows: [Cell-free distance (0 h)-cell-free distance (24/48/72 h)]/cell-free distance (0 h), as previously described (29,30).

Xenograft tumor assays using athymic nude mice

All animal experiments were approved by the Animal Ethics Committee of our hospital. Female 4–6-week-old BALB/c nude mice (weighing, 14–16 g) (n=12) were purchased from Charles River Laboratories (Beijing, China) and raised in a sterile environment. The mice were divided into 3 groups (n=4/group) as follows: the group injected with Eca109 cells, the group injected with Eca109 cells transduced with RNF113A-shRNA2, and the group injected with Eca109 cells transduced with scramble-shRNA. The cells were injected at 4×106 cells/mouse into the right flank. Tumor dimensions were measured by calipers every 7 days, and tumor volume (TV) was calculated each week according to the formula: TV (mm3) = length × width2 × 0.5. Tumors were removed and weighed 28 days after cell injection. Part of the tumor tissue was cryopreserved in liquid nitrogen for the analysis of RNF113A mRNA expression by RT-qPCR. The remaining tissues were paraffin-embedded for immunohistochemical analysis of RNF113A.

Statistical analysis

Data were analyzed using SPSS 17.0 software (IBM, Armonk, NY, USA). The results are presented as the means ± standard deviation (SD). The Student's t test and one-way ANOVA were used to evaluate the differences among groups. The LSD test was used following ANOVA. The Chi-square test and Fisher's exact test were used to analyze the association between RNF113A expression and clinicopatho-logical characteristics. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. Univariate and multivariate analyses of survival were performed by Cox regression. Two-sided P-values <0.05 were considered to indicate statistically significant differences.

Results

RNF113A is significantly upregulated inESCC and is associated with a poor prognosis

RNF113A was mainly localized in the cytoplasm and nucleus of the cancer cells (Fig. 1A). RNF113A expression was positive in 64.1% (75/117) of the ESCC samples. Moreover, RNF113A expression was extremely low or hardly detectable in the adjacent non-tumor tissues. In addition, RNF113A mRNA expression in the 41 fresh-frozen ESCC cases was higher (cancer/normal ratio >1.0) in 73% (30/41) of the samples when compared with the adjacent non-tumor tissues, with the mean expression level of 1.15±0.66 in ESCC and 0.67±0.66 in their counterparts (P<0.001) (Fig. 1B).

Figure 1

Ring finger protein 113A (RNF113A) expression in esophageal squamous cell carcinoma (ESCC) compared with adjacent normal tissues. RNF113A expression was significantly associated with a poor prognosis. (A) RNF113A expression in ESCC and adjacent normal tissues was determined by immunohistochemistry. The insets with yellow dotted lines the areas which are magnified from the panels on the left. (B) Relative RNF113A mRNA expression in ESCC (n=41) and adjacent normal tissues (n=41) was assessed by RT-qPCR. Data are presented as the means ± standard deviation (SD). ***P<0.001. (C) Kaplan-Meier analysis demonstrated that patients with ESCC and with a high RNF113A expression had a lower overall survival than those with a low RNF113A expression (log-rank test, P=0.0023).

The associations between RNF113A expression and the clinicopathological characteristics were analyzed (Table II). Tumor differentiation (P=0.008) and T classification (P<0.001) were significantly associated with RNF113A expression. RNF113A was predominantly upregulated in late-stage, but not early-stage tumor tissues. No statistically significant association was observed between RNF113A expression and sex, age, histological type, tumor location and lymph node metastasis (N classification) (all P>0.05).

Table II

Association between RNF113A expression and clinicopathological characteristics of patients with ESCC.

Table II

Association between RNF113A expression and clinicopathological characteristics of patients with ESCC.

VariableRNF113A expression
P-value
No.Positive (n=75)Negative (n=42)
Age (years)0.086
 <605338 (71.7)15 (28.3)
 ≥606437 (57.8)27 (42.2)
Sex0.457
 Male8755 (63.2)32 (36.8)
 Female3020 (66.7)10 (33.3)
Differentiation0.008
 Well2612 (46.2)14 (53.8)
 Moderate5734 (59.6)23 (40.4)
 Poor2421 (87.5)3 (12.5)
T classification <0.001
 T1-T25419 (35.2)35 (64.8)
 T3-T46356 (88.9)7 (11.1)
N classification0.11
 N07643 (56.6)33 (43.4)
 N12415 (62.5)9 (37.5)
 N21110 (90.9)1 (9.1)
 N365 (83.3)1 (16.7)
Histological type0.416
 Protruding type178 (47.1)9 (52.9)
 Ulcerative type6945 (65.2)24 (34.8)
 Fungating type139 (69.2)4 (30.8)
 Medullary type1813 (72.2)5 (27.8)
Tumor locationa0.762
 Upper118 (72.7)3 (27.3)
 Middle5939 (66.1)20 (33.9)
 Lower4729 (61.7)18 (38.3)

{ label (or @symbol) needed for fn[@id='tfn2-ijo-52-03-0861'] } It should be noted that only the cases with clear information were included.

a For tumor location, 'upper' indicates the plane of the upper edge of the sternum handle to the bifurcation plane of the trachea; 'middle' indicates the upper part of the whole length from the bifurcation plane of the trachea to the junction of the esophagus and the stomach; and 'lower' indicates the lower part of the whole length from the bifurcation plane of the trachea to the junction of the esophagus and stomach. All data are presented as n (%). Values in bold font indicate statistical significance. RNF113A, ring finger protein 113A; ESCC, esophageal squamous cell carcinoma.

Fig. 1C shows that survival was improved among patients with a low RNF113A expression in their tumors compared with patients with a high RNF113A expression in their tumors (P=0.002). Multivariate analysis revealed that RNF113A expression (HR=2.406; 95% CI, 1.301-4.449, P=0.005) and lymph node metastasis (HR=3.219, 95% CI, 1.894–5.469, P<0.001) were independently associated with overall survival in Kazakh patients with ESCC (Table III).

Table III

Univariate and multivariate Cox regression analyses of the clinicopathological variables and cumulative survival of the patients with ESCC.

Table III

Univariate and multivariate Cox regression analyses of the clinicopathological variables and cumulative survival of the patients with ESCC.

CovariantUnivariate analysis
Multivariate analysis
HR95% CIP-valueHR95% CIP-value
RNF113A expression2.4491.351–4.4390.0032.4061.301–4.4490.005
Sex0.8820.465–1.6700.6990.8260.420–1.6270.581
Age0.6850.410–1.1440.1481.3870.720–2.6750.328
Tumor location1.6240.716–3.6850.4571.0680.578–1.9700.593
Histological type1.1870.476–2.9560.7110.0790.205–1.1910.254
Tumor differentiation1.4910.840–3.0120.1321.2540.563–2.7930.748
T classification1.7981.040–3.1100.0361.2050.564–2.5770.63
Lymph node metastasis3.1541.882–5.285 <0.0013.2191.894–5.469 <0.001

[i] ESCC, esophageal squamous cell carcinoma; RNF113A, ring finger protein 113A; HR, hazard ratio; 95% CI, 95% confidence interval. Values in bold font indicate statistical significance (P<0.05).

Effects of knockdown or the overexpression of RNF113A on cell cycle distribution and the apoptosis of Eca109 and EC9706 cells

Fig. 2 shows the effects of the knockdown or overexpression of RNF113A on RNF113A protein expression in human Eca109 and EC9706ESCC cells. RNF113A protein expression was lower in the cells transfected with RNF113A-shRNA1 and RNF113A-shRNA2 than in the untransfected Eca109 and EC9706 cells and scramble-shRNA cells (all P<0.01) (Fig. 2A). RNF113A protein expression was higher in the RNF113A-overexressing cells than in the untransfected Eca109 and EC9706 cells and empty vector-transfected cells (all P<0.001) (Fig. 2B).

Fig. 3 shows that cell numbers were significantly increased in the G0/G1 phase and decreased in the S phase and G2/M phase in the cells transfected with RNF113A-shRNA compared with the untransfected Eca109 and EC9706 cells and scramble-shRNA cells (all P<0.05). It can be seen that the cell numbers were significantly decreased in the G0/G1 phase and increased in the G2/M phase in the cells transfected with the pCDNA3.1-RNF113A overexpression vector compared with the empty vector-transfected group and untransfected Eca109 and EC9706 cells. Therefore, the overexpression of RNF113A promoted ESCC cell proliferation.

Figure 3

Effects of the knockdown or overexpression of ring finger protein 113A (RNF113A) on cell cycle distribution in Eca109 and EC9706 cells. Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA1, RNF113A-shRNA2, and scramble-shRNA for 72 h. Eca109 and EC9706 cells were transfected with empty vector (pcDNA3.1) or RNF113A overexpression vector for 72 h. Cell cycle distribution was determined by flow cytometry using propidium iodide (PI) staining. Data are presented as the means ± SD of 3 independent experiments performed in triplicate. *P<0.05 vs. blank group; #P<0.05 vs. scramble-shRNA or empty vector.

Apoptosis was also increased when RNF113A was knocked down (all P<0.050) (Fig. 4). The overexpression of RNF113A did not lead to changes in apoptosis compared with the controls (P>0.05) (Fig. 4).

Figure 4

Effects of the knockdown or overexpression of ring finger protein 113A (RNF113A) on the apoptosis of Eca109 and EC9706 cells. The Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA1, RNF113A-shRNA2, and scramble-shRNA for 72 h. Eca109 and EC9706 cells were transfected with empty vector (pcDNA3.1) or RNF113A overexpression vector for 72 h. Cell apoptosis was determined by flow cytometry using Annexin V/PI staining. The quadrants in the flow cytometry plots are as follows: Upper left, necrotic cells; bottom left, live cells; upper right, late apoptotic cells; and lower right, early apoptotic cells. Data are presented as mean ± SD of 3 independent experiments performed in triplicate. *P<0.05 vs. blank group; #P<0.05 vs. scramble-shRNA or empty vector group.

Effects of the knockdown and overexpression of RNF113A on the migration and invasion of ESCC cells in vitro

In the Transwell assay, the numbers of migrating cells were decreased in the RNF113A-shRNA1 and RNF113A-shRNA2 groups compared with the untransfected Eca109 and EC9706 cells and scramble-shRNA-transfected cells (all P<0.001) (Fig. 5). However, the numbers of migrating cells were increased in the RNF113A-overexressing cells compared with the untransfected Eca109 and EC9706 cells and empty vector-transfected cells (all P<0.001) (Fig. 5).

Figure 5

Effect of the knockdown and the overexpression of ring finger protein 113A (RNF113A) on the migration of Eca109 and EC 9706 cells. Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA1, RNF113A-shRNA2, and scramble-shRNA for 72 h. Eca109 and EC9706 cells were transfected with empty vector (pcDNA3.1) or RNF113A overexpression vector for 72 h. Migration was assessed by Transwell assay. Data are presented as the means ± SD of 3 independent experiments performed in triplicate. ***P<0.001 vs. blank group; ###P<0.001 vs. scramble-shRNA or empty vector group.

The knockdown of RNF113A led to a marked decrease in the invasiveness of the Eca109 (P<0.01) and EC9706 (P<0.001) cells (Fig. 6). The overexpression of RNF113A significantly increased the invasiveness of the Eca109 and in EC9706 cells (all P<0.001) (Fig. 6).

Figure 6

Effects of the knockdown or overexpression of ring finger protein 113A (RNF113A) on the invasion of Eca109 and EC 9706 cells. Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA1, RNF113A-shRNA2, and scramble-shRNA for 72 h. Eca109 and EC9706 cells were transfected with empty vector (pcDNA3.1) or RNF113A overexpression vector for 72 h. Invasion was assessed by Transwell assay. Data are presented as the means ± SD of 3 independent experiments performed in triplicate. **P<0.01 and ***P<0.001 vs. blank group; ##P<0.01 and ###P<0.001 vs. scramble-shRNA or empty vector group.

The wound healing assay also revealed that the knockdown of RNF113A inhibited the migration of the Eca109 (P<0.05) and EC9706 (P<0.05) cells, compared with the untransfected Eca109 and EC9706 cells and scramble-shRNA-transfected cells (Fig. 7).

Figure 7

Effects of ring finger protein 113A (RNF113A) knockdown on the migration of Eca109 and EC 9706 cells. Eca109 and EC9706 cells were transfected with lentivirus-mediated RNF113A-shRNA and scramble-shRNA for 72 h. Then migration was assessed by the wound healing assay at 0, 24, 48 and 72 h. Data are presented as mean ± SD of 3 independent experiments performed in triplicate. *P<0.05 vs. blank group; #P<0.05 vs. scramble-shRNA.

Knockdown of RNF113A suppresses tumor growth in a nude mouse tumor xenograft model with Eca109 cells

All nude mice developed tumors; however, the tumors formed from the scramble-shRNA-transfected cells grew more rapidly than those from the RNF113A-shRNA-transfected cells. The tumors formed from the RNF113A-shRNA-transfected cells were significantly lighter and smaller than those from the scramble-shRNA-transfected cells and Eca109-transfected cells (all P<0.05) (Fig. 8A and B). RT-qPCR and IHC confirmed that the RNF113A mRNA and protein levels were downregulated in the sections of the subcutaneous tumors of nude mice inoculated with RNF113A-shRNA-transfected cells, compared with the untransfected Eca109 cells and scramble-shRNA-transfected cells (Fig. 8C and D).

Figure 8

Effects of ring finger protein 113A (RNF113A) knockdown on tumor growth in vivo. Eca109cells transfectedwith lentivirus-mediated RNF113A-shRNA and scramble-shRNA (4×106 cells) were subcutaneously inoculated into the right dorsal flanks of BALB/c nude mice. Eca109 cells were used as a blank control group. (A) Tumor size and weight (g) was measured 28 days after inoculation. (B) Tumor volume (mm3) was assessed by calipers each week. (C) RNF113A mRNA expression in the tumor tissues was determined by RT-qPCR. (D) RNF113A protein expression in the tumor tissues was determined by immunohistochemistry. Data are presented as the means ± SD (n=4/group). *P<0.05 vs. blank group; #P<0.05 vs. scramble-shRNA.

Discussion

The UPP influences and regulates apoptosis and plays a central role in the binding of ubiquitin and substrate specificity (9). E3 ligases are involved in Snail and Twist ubiquitination, which play important roles in EMT (10,11). RNF113A has a RING domain (14), which is frequently found in E3 ubiquitin ligases. Previous studies have indicated that there are close associations between ubiquitin ligase and the occurrence, development and metastasis of cancer (16,17). In C. elegans, the knockdown of RNF113 sensitizes the cells to UVA-induced DNA damage and is required for RAD51 during repair (19). Pellagatti et al (20) showed that ZNF183 was one of the most upregulated genes in MDS (20). Therefore, it can be hypothesized that RNF113A is associated with the progression/development of ESCC. Nevertheless, little is known about the expression of RNF113A in ESCC and its significance.

The present study demonstrated that RNF113A expression was associated with the T stage, suggesting that it may be associated with tumorigenesis, as well as tumor progression. RT-qPCR revealed that the overexpression of RNF113A in 73% of ESCC samples, supporting the results of IHC. Kaplan-Meier analysis revealed a poorer survival rate in patients with ahigh RNF113A expression. Furthermore, multivariate analysis revealed that the RNF113A levels could be used as an independent prognostic factor for patients with ESCC. Therefore, RNF113A may be a novel diagnostic and prognostic biomarker for ESCC, although this requires further validation. Nevertheless, these results are supported by previous studies of various RING finger proteins in various cancer types (31–34).

Cell cycle progression, the inhibition of apoptosis, and cell migration and invasion are central features of ESCC progression (26,35–37). Supporting the role of RNF113A in ESCC aggressiveness, the present study demonstrated that the overexpression of RNF113A was associated with cell cycle progression and an increased migration and invasiveness of Eca109 and EC9706 cells. These results are similar to those observed with various RING finger proteins in various cancer types. Yonemori et al (38) showed that ZFP36L2 promoted cancer cell proliferation, migration and invasion in pancreatic ductal adenocarcinoma. Zhang and Yang (39) showed that silencing tripartite motif containing 59 (TRIM59) inhibited the proliferation, migration and invasion of breast cancer cells. Similar results were also observed in gastric cancer with RNF180 (40) and colorectal cancer with RNF216 (41). These results support the roles of RING finger proteins in carcinogenesis. Tumor metastasis is one of the most important biological characteristics of malignant tumors, and metastasis is a strong independent prognostic factor for ESCC (42). In this study, RNF113A expression was not associated with lymph node metastasis as revealed the examination of tumor samples; however, in vitro experiments suggested that RNF113A may promote the migration and invasiveness of ESCC cell lines. The exact role of RNF113A in the advanced stage of ESCC remains to be through analyzed in the future, based on clinical studies with an enlarged sample size and in vitro studies using a greater number of cell lines.

The exact mechanisms responsible for the effects of RNF113A on cancer progression are poorly understood and further investigations are warranted. Nevertheless, some previous studies may provide some clues. The normal expression of RNF113A plays an important role in the differentiation of cells of the central nervous system during embryogenesis (15). RNF113A participates in the regulation of the stability of proteins of the E2 and E3 families (15). EMT is a hallmark of cancer invasiveness and the regulation of the stability of the transcription factors involved in EMT is essential to this process (10,11). Among others, ubiquitin ligases controlling Snail and Twist stability plays crucial role in EMT (11). Indeed, Snail and Twist are short-lived due to rapid polyubiquitination in normal cells and E3 is involved in this process (11). The degradation of most EMT factors depends upon RING-type E3s. In addition, RNF113A has a C3HC4 zinc finger domain, which is found in E3 ubiquitin ligase and is involved in tumorigenesis (11,43,44). Furthermore, other proteins of the family are known to be involved in tumorigenesis. Indeed, RNF183 promotes the proliferation and metastasis of colorectal cancer cells via the activation of the NF-κB-IL-8 axis (45). RNF125 is a potential biomarker for the highly aggressive and unfavorable prognosis of gallbladder cancers by promoting the invasion and metastasis of human gallbladder cancers via the activation of the TGF-β1-SMAD3-ID1 signaling pathway (46). Cancer progression and cell proliferation, migration and invasion are orchestrated by a very complex and interwoven array of molecules. Two approaches are available to study these interactions: Either the use of bioinformatics to grasp a global view of the processes, or the study of a single specific factor. The present study aimed to assess the effect of RNF113A on the progression of ESCC. The results indeed demonstrated that RNF113A plays an important role in ESCC progression; however, the mechanisms through which this factor interacts with other factors remain to be elucidated.

The present study is not without limitations. The sample size was small and from a single center. In addition, all patients were Kazakh, which is a Chinese minority that has the highest incidence of ESCC worldwide (6); however, this limits the generalizability of the results. It is probable that this high incidence is due to a number of environmental and genetic factors that may influence the results of the present study. Additional studies on various populations are warranted to confirm these results. The mechanisms through which RNF113A promotes malignant behaviors in vitro required further investigation.

In conclusion, the present study strongly suggests that RNF113A promotes the proliferation, migration and invasion of ESCC cells, and that RNF113A is associated with a poor prognosis of ESCC in Kazakh patients.

Abbreviations:

EC

esophageal cancer

ESCC

esophageal squamous cell carcinoma

OS

overall survival

UPP

ubiquitin-proteasome pathway

EMT

epithelial-mesenchymal transition

TTD

trichothiodystrophy

MDS

myelodysplastic syndrome

IHC

immunohistochemistry

FBS

fetal bovine serum

MOI

multiplicity of infection

RIPA

radio-immunoprecipitation assay

PVDF

polyvinylidene fluoride

FCM

flow cytometry

PBS

phosphate-buffered saline

PI

propidium iodide

TV

tumor volume

UVA

ultraviolet A

Acknowledgments

This study was funded by Major Projects in the Xinjiang Uygur Autonomous Region (no. 2016B03054).

Notes

[1] Competing interests

The authors declare that they have no competing interests.

References

1 

Parkin DM, Pisani P and Ferlay J: Global cancer statistics. CA Cancer J Clin. 49:33–64. 311999. View Article : Google Scholar : PubMed/NCBI

2 

Chen W, Zheng R, Zeng H, Zhang S and He J: Annual report on status of cancer in China, 2011. Chin J Cancer Res. 27:2–12. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Yang CS, Chen X and Tu S: Etiology and prevention of esophageal cancer. Gastrointest Tumors. 3:3–16. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Siegel RL, Miller KD and Jemal A: Cancer Statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Arnold M, Soerjomataram I, Ferlay J and Forman D: Global incidence of oesophageal cancer by histological subtype in 2012. Gut. 64:381–387. 2015. View Article : Google Scholar

6 

Ainiwaer J, Li DS and Zhang L: Investigation on prevalence of esophageal cancer during 2005–2008 in Yili of Xinjiang, China. Xinjiang Medical J. 41:112–114. 2011.

7 

NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines): Esophageal and Esophagogastric Junction Cancers. (Version 2.2017). National Comprehensive Cancer Network; Fort Washington: 2017

8 

Mukhopadhyay D and Riezman H: Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science. 315:201–205. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Sullivan JA, Shirasu K and Deng XW: The diverse roles of ubiquitin and the 26S proteasome in the life of plants. Nat Rev Genet. 4:948–958. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Xue Z, Wu X, Chen X, Liu Y, Wang X, Wu K, Nie Y and Fan D: Mesenchymal stem cells promote epithelial to mesenchymal transition and metastasis in gastric cancer though paracrine cues and close physical contact. J Cell Biochem. 116:618–627. 2015. View Article : Google Scholar

11 

Díaz VM, Viñas-Castells R and García de Herreros A: Regulation of the protein stability of EMT transcription factors. Cell Adhes Migr. 8:418–428. 2014. View Article : Google Scholar

12 

Corbett MA, Dudding-Byth T, Crock PA, Botta E, Christie LM, Nardo T, Caligiuri G, Hobson L, Boyle J, Mansour A, et al: A novel X-linked trichothiodystrophy associated with a nonsense mutation in RNF113A. J Med Genet. 52:269–274. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Frattini A, Faranda S, Bagnasco L, Patrosso C, Nulli P, Zucchi I and Vezzoni P: Identification of a new member (ZNF183) of the Ring finger gene family in Xq24-25. Gene. 192:291–298. 1997. View Article : Google Scholar : PubMed/NCBI

14 

Korneta I, Magnus M and Bujnicki JM: Structural bioinformatics of the human spliceosomal proteome. Nucleic Acids Res. 40:7046–7065. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Carney TD, Struck AJ and Doe CQ: midlife crisis encodes a conserved zinc-finger protein required to maintain neuronal differentiation in Drosophila. Development. 140:4155–4164. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Bromberg KD, Kluger HM, Delaunay A, Abbas S, DiVito KA, Krajewski S and Ronai Z: Increased expression of the E3 ubiquitin ligase RNF5 is associated with decreased survival in breast cancer. Cancer Res. 67:8172–8179. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Chen C, Sun X, Guo P, Dong XY, Sethi P, Zhou W, Zhou Z, Petros J, Frierson HF Jr, Vessella RL, et al: Ubiquitin E3 ligase WWP1 as an oncogenic factor in human prostate cancer. Oncogene. 26:2386–2394. 2007. View Article : Google Scholar

18 

Amsterdam A, Nissen RM, Sun Z, Swindell EC, Farrington S and Hopkins N: Identification of 315 genes essential for early zebrafish development. Proc Natl Acad Sci USA. 101:12792–12797. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Lee H, Alpi AF, Park MS, Rose A and Koo HS: C. elegans ring finger protein RNF-113 is involved in interstrand DNA crosslink repair and interacts with a RAD51C homolog. PLoS One. 8:e600712013. View Article : Google Scholar : PubMed/NCBI

20 

Pellagatti A, Esoof N, Watkins F, Langford CF, Vetrie D, Campbell LJ, Fidler C, Cavenagh JD, Eagleton H, Gordon P, et al: Gene expression profiling in the myelodysplastic syndromes using cDNA microarray technology. Br J Haematol. 125:576–583. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Heath-Brown N: International Union Against Cancer. The Stateman's Yearbook 2016. Palgrave MacMillan; London: 2015

22 

Ma JQ, Tuersun H, Jiao SJ, Zheng JH, Xiao JB and Hasim A: Functional role of NRF2 in cervical carcinogenesis. PLoS One. 10:e01338762015. View Article : Google Scholar : PubMed/NCBI

23 

Sinicrope FA, Ruan SB, Cleary KR, Stephens LC, Lee JJ and Levin B: Bcl-2 and p53 oncoprotein expression during colorectal tumorigenesis. Cancer Res. 55:237–241. 1995.PubMed/NCBI

24 

Zhu J, Li H, Ma J, Huang H, Qin J and Li Y: PTPN9 promotes cell proliferation and invasion in Eca109 cells and is negatively regulated by microRNA-126. Oncol Lett. 14:1419–1426. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Chen HX, Wang S, Wang Z, Zhang ZP and Shi SS: Overexpression of RUNX3 inhibits malignant behaviour of Eca109 cells in vitro and in vivo. Asian Pac J Cancer Prev. 15:1531–1537. 2014. View Article : Google Scholar

26 

Li S, Wang F, Qu Y, Chen X, Gao M, Yang J, Zhang D, Zhang N, Li W and Liu H: HDAC2 regulates cell proliferation, cell cycle progression and cell apoptosis in esophageal squamous cell carcinoma EC9706 cells. Oncol Lett. 13:403–409. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Sun Z, Ji N, Bi M, Wang S, Liu X and Wang Z: PTEN gene is infrequently hypermethylated in human esophageal squamous cell carcinoma. Tumour Biol. 36:5849–5857. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Wang T, Xuan X, Pian L, Gao P, Hu H, Zheng Y, Zang W and Zhao G: Notch-1-mediated esophageal carcinoma EC-9706 cell invasion and metastasis by inducing epithelial-mesenchymal transition through Snail. Tumour Biol. 35:1193–1201. 2014. View Article : Google Scholar

29 

Cory G: Scratch-wound assay. Methods Mol Biol. 769:25–30. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Jonkman JE, Cathcart JA, Xu F, Bartolini ME, Amon JE, Stevens KM and Colarusso P: An introduction to the wound healing assay using live-cell microscopy. Cell Adhes Migr. 8:440–451. 2014. View Article : Google Scholar

31 

Sugiura T, Yamaguchi A and Miyamoto K: A cancer-associated RING finger protein, RNF43, is a ubiquitin ligase that interacts with a nuclear protein, HAP95. Exp Cell Res. 314:1519–1528. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Zhu J, Zhao C, Zhuang T, Jonsson P, Sinha I, Williams C, Strömblad S and Dahlman-Wright K: RING finger protein 31 promotes p53 degradation in breast cancer cells. Oncogene. 35:1955–1964. 2016. View Article : Google Scholar :

33 

Horie K, Urano T, Ikeda K and Inoue S: Estrogen-responsive RING finger protein controls breast cancer growth. J Steroid Biochem Mol Biol. 85:101–104. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Oyanagi H, Takenaka K, Ishikawa S, Kawano Y, Adachi Y, Ueda K, Wada H and Tanaka F: Expression of LUN gene that encodes a novel RING finger protein is correlated with development and progression of non-small cell lung cancer. Lung Cancer. 46:21–28. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Zhang Y, Zhang Y, Yun H, Lai R and Su M: Correlation of STAT1 with apoptosis and cell-cycle markers in esophageal squamous cell carcinoma. PLoS One. 9:e1139282014. View Article : Google Scholar : PubMed/NCBI

36 

Bozzuto G, Ruggieri P and Molinari A: Molecular aspects of tumor cell migration and invasion. Ann Ist Super Sanita. 46:66–80. 2010.PubMed/NCBI

37 

Friedl P and Wolf K: Tumour-cell invasion and migration: Diversity and escape mechanisms. Nat Rev Cancer. 3:362–374. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Yonemori K, Seki N, Kurahara H, Osako Y, Idichi T, Arai T, Koshizuka K, Kita Y, Maemura K and Natsugoe S: ZFP36L2 promotes cancer cell aggressiveness and is regulated by antitumor microRNA-375 in pancreatic ductal adenocarcinoma. Cancer Sci. 108:124–135. 2017. View Article : Google Scholar :

39 

Zhang Y and Yang WB: Down-regulation of tripartite motif protein 59 inhibits proliferation, migration and invasion in breast cancer cells. Biomed Pharmacother. 89:462–467. 2017. View Article : Google Scholar : PubMed/NCBI

40 

Deng J, Liang H, Zhang R, Hou Y, Liu Y, Ying G, Pan Y and Hao X: Clinical and experimental role of ring finger protein 180 on lymph node metastasis and survival in gastric cancer. Br J Surg. 103:407–416. 2016. View Article : Google Scholar : PubMed/NCBI

41 

Wang H, Wang Y, Qian L, Wang X, Gu H, Dong X, Huang S, Jin M, Ge H, Xu C, et al: RNF216 contributes to proliferation and migration of colorectal cancer via suppressing BECN1-dependent autophagy. Oncotarget. 7:51174–51183. 2016.PubMed/NCBI

42 

Ando N, Kato H, Igaki H, Shinoda M, Ozawa S, Shimizu H, Nakamura T, Yabusaki H, Aoyama N, Kurita A, et al: A randomized trial comparing postoperative adjuvant chemotherapy with cisplatin and 5-fluorouracil versus preoperative chemotherapy for localized advanced squamous cell carcinoma of the thoracic esophagus (JCOG9907). Ann Surg Oncol. 19:68–74. 2012. View Article : Google Scholar

43 

Lazzari E and Meroni G: TRIM32 ubiquitin E3 ligase, one enzyme for several pathologies: From muscular dystrophy to tumours. Int J Biochem Cell Biol. 79:469–477. 2016. View Article : Google Scholar : PubMed/NCBI

44 

Cai W and Yang H: The structure and regulation of Cullin 2 based E3 ubiquitin ligases and their biological functions. Cell Div. 11:72016. View Article : Google Scholar : PubMed/NCBI

45 

Geng R, Tan X, Wu J, Pan Z, Yi M, Shi W, Liu R, Yao C, Wang G, Lin J, et al: RNF183 promotes proliferation and metastasis of colorectal cancer cells via activation of NF-κB-IL-8 axis. Cell Death Dis. 8:e29942017. View Article : Google Scholar

46 

Liu ZY, Cao J, Zhang JT, Xu GL, Li XP, Wang FT, Ansari KH, Mohamed H and Fan YZ: Ring finger protein 125, as a potential highly aggressive and unfavorable prognostic biomarker, promotes the invasion and metastasis of human gallbladder cancers via activating the TGF-β1-SMAD3-ID1 signaling pathway. Oncotarget. 8:49897–49914. 2017.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang L, Hou Z, Hasim A, Abuduerheman A, Zhang H, Niyaz M, Awut I, Upur H and Sheyhidin I: RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma. Int J Oncol 52: 861-871, 2018.
APA
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M. ... Sheyhidin, I. (2018). RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma. International Journal of Oncology, 52, 861-871. https://doi.org/10.3892/ijo.2018.4253
MLA
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M., Awut, I., Upur, H., Sheyhidin, I."RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma". International Journal of Oncology 52.3 (2018): 861-871.
Chicago
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M., Awut, I., Upur, H., Sheyhidin, I."RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma". International Journal of Oncology 52, no. 3 (2018): 861-871. https://doi.org/10.3892/ijo.2018.4253
Copy and paste a formatted citation
x
Spandidos Publications style
Wang L, Hou Z, Hasim A, Abuduerheman A, Zhang H, Niyaz M, Awut I, Upur H and Sheyhidin I: RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma. Int J Oncol 52: 861-871, 2018.
APA
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M. ... Sheyhidin, I. (2018). RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma. International Journal of Oncology, 52, 861-871. https://doi.org/10.3892/ijo.2018.4253
MLA
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M., Awut, I., Upur, H., Sheyhidin, I."RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma". International Journal of Oncology 52.3 (2018): 861-871.
Chicago
Wang, L., Hou, Z., Hasim, A., Abuduerheman, A., Zhang, H., Niyaz, M., Awut, I., Upur, H., Sheyhidin, I."RNF113A promotes the proliferation, migration and invasion, and is associated with a poor prognosis of esophageal squamous cell carcinoma". International Journal of Oncology 52, no. 3 (2018): 861-871. https://doi.org/10.3892/ijo.2018.4253
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team