Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2018 Volume 53 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 53 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer

  • Authors:
    • Xuewen Liu
    • Zhiting Sun
    • Jikun Deng
    • Jun Liu
    • Kaihuai Ma
    • Yuan Si
    • Te Zhang
    • Tingting Feng
    • Ying Liu
    • Yan Tan
  • View Affiliations / Copyright

    Affiliations: School of Basic Sciences, Hubei University of Medicine, Shiyan, Hubei 442000, P.R. China, Laboratory of Molecular Target Therapy of Cancer, Institute of Basic Medical Sciences, Hubei University of Medicine, Shiyan, Hubei 442000, P.R. China, School of Basic Medical Sciences, Anhui Medical University, Hefei, Anhui 230032, P.R. China
  • Pages: 1279-1288
    |
    Published online on: June 29, 2018
       https://doi.org/10.3892/ijo.2018.4464
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Polyphyllin I (PPI) is a natural compound extracted from the rhizomes of Paris polyphylla and has been used to treat fevers and headaches in China. In the present study, the antitumor activity of PPI in prostate cancer (PC) cells was evaluated. At low doses, PPI decreased proliferation, invasion and epithelial-mesenchymal transition (EMT) in PC cells. PPI decreased the expression of matrix metalloproteinase 7 (MMP7), an enzyme that is critical for tumor metastasis. PPI also decreased the expression of Snail and vimentin, which are EMT-associated factors. Additionally, PPI suppressed AP-1 transcriptional activity and AP-1 binding to the MMP7 and vimentin promoters. The results demonstrated that PPI downregulated the phosphorylation of extracellular signaling‑related kinase (ERK), which is upstream modulator of AP-1. The results of the present study demonstrated that PPI may inhibit the cancerous inhibitor of protein phosphatase 2A (CIP2A)/protein phosphatase 2A (PP2A)/ERK axis, downregulate the expression of MMP7, vimentin, and Snail, and suppress tumor invasion and EMT. A PC xenograft mouse model was employed and the results revealed that PPI may decrease tumor growth and weight. Additionally, PPI may inhibit proliferating cell nuclear antigen expression and CIP2A/PP2A/ERK signaling pathway in PPI-treated tumors. Therefore, the results of the present study suggest that PPI may suppress the growth, invasion and EMT of PC cells via inhibition of CIP2A/PP2A/ERK signaling axis. As a result, PPI may be a novel target for the treatment of PC.

Introduction

Prostate cancer (PC) is a common malignancy diagnosed in men. In 2012, a total of ~1,1111,700 cases of PC were newly diagnosed, and 307,500 mortality cases have been estimated worldwide (1). The morbidity of PC is increasing in China in recent years (2). Although patients diagnosed with localized PC exhibit a survival rate of >5 years, the majority of patients with PC will progress to castration-resistant PC, and eventually, relapse (3). Therefore, novel drugs that may suppress the tumor initiation, progression and metastasis of PC are required.

Oncogenes and anti-oncogenes serve pivotal roles in the pathogenesis of several cancer types. Cancerous inhibitor of protein phosphatase 2A (CIP2A) is an oncoprotein that suppresses protein phosphatase 2A (PP2A) activity in the degradation of c-Myc protein in cancer cells (4). CIP2A is overexpressed in numerous types of human cancer, including PC, gastric, colon, breast, head and neck, lung and ovarian cancer (4–10). Additionally, CIP2A overexpression is associated with malignant proliferation and aggressiveness (11). De et al suggested a role of oncogenic nexus of CIP2A in carcinogenesis (12). This nexus is created by CIP2A-mediated inhibition of PP2A, which activates oncogenic signal factors including Akt, extracellular signaling-related kinase (ERK) and c-Myc, and thus may serve as a biomarker and therapeutic target for the treatment of cancer. Recently, Wu et al reported that CIP2A physically associates with H-Ras and activates the MEK/ERK signaling pathway, thus promoting epithelial-mesenchymal transition (EMT) and progression of cervical cancer (13). Therefore, targeting CIP2A may be a promising therapeutic strategy for cancer.

Increasing evidences has shown that natural products not only serve key roles in the detection and evolvement of novel drugs, but they may be used as molecular probes for screening treatment targets (14,15). Paris polyphyllin is a medicinal herb in the Shennongjia National Nature Reserve of China, which may treat fevers, headaches, burns, wounds, and exhibit immune-regulatory and antitumor abilities (16,17). Polyphyllin I (PPI), a bioactive phytochemical isolated from the rhizoma of P. polyphylla, exhibits preclinical antitumor efficacy in several cancer types, including breast, lung, gastric, and ovarian cancer, as well as osteosarcoma (16,18,19). Recently, PPI was found to increase the sensitivity of liver cancer HepG2 cells to cisplatin, and activate autophagy via the PI3K/Akt/mTOR signaling pathway (20). The antitumor activity of PPI on PC cells has not previously been evaluated. The aim of the present study is to evaluate the antitumor effects and potential molecular mechanisms of PPI in PC.

Materials and methods

Reagents

PPI with a purity of 98% was purchased from Shanghai YuanYe Bio-Technology Co., Ltd. (Shanghai, China). PPI was dissolved in dimethylsulfoxide (DMSO; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at a stock solution of 4 mM and stored at −20°C. Okadaic acid (OA) was purchased from Sigma-Aldrich; Merck KGaA.

Cell culture

Human PC cancer cell lines PC3 and DU145 were purchased from American Type Culture Collection (ATCC; Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM; high glucose; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (both from Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified atmosphere containing 5% CO2.

MTT assay

A total of 6×104 cells were seeded into a 96-well plate and pre-cultured with DMEM for 24 h, then treated with PPI (0.4–3 µM) for 24 h at 37°C in a humidified atmosphere containing 5% CO2. Cell cytotoxicity was determined using MTT assay. The absorbance was measured at 490 nm using an automated microplate reader (BioTek Instruments, Inc., Winooski, VT, USA), and the inhibition rate was calculated as follows: Inhibition rate (%) = (average A490 of the control group-average A490 of the experimental group)/(average A490 of the control group-average A490 of the blank group) ×100%. Cell viability was estimated using trypan blue dye exclusion.

Soft agar colony formation assay

A total of 1×103 cells were suspended in 1 ml of DMEM containing 0.3% agarose (Amresco, Cleveland, OH, USA) and 10% FBS, and plated on a bottom layer containing 0.6% agarose and 10% FBS in each of the triplicate wells of a 6-well plate. Colonies formed on the soft agar plates were stained with 0.2% crystal violet and counted under light microscope (IX70; Olympus Corporation, Tokyo, Japan) after 2 weeks.

Invasion assay

Invasion assays were performed using a 24-well Transwell chamber (Corning Incorporated, Corning, NY, USA). Polyvinylpyrrolidone-free polycarbonate filters (8 µm pore size) (Corning Incorporated) were coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). The lower chamber contained medium supplemented with 20% FBS. Cells (1×104 cells/well) were placed into the upper chamber with the coated membrane. After incubation for 20 h at 37°C, the invaded cells at the bottom of the membrane were fixed and stained with 2% ethanol containing 0.2% crystal violet (15 min) at room temperature for 20 min and observed under light microscope (×10 objective). For quantification, the invaded stained cells on the other side of the membrane were extracted with 33% acetic acid. The absorbance of the eluted stain was determined at 570 nm.

Wound healing assay

Cells (4×105 cells/2 ml) were seeded in a 6-well plate and incubated at 37°C until they reach 90–100% confluence. Confluent cells were scratched using a 200 µl pipet tip. After washing with PBS, cells were treated with serum-free medium for 24 h. Then, the cells were fixed and stained with 2% ethanol containing 0.2% crystal violet powder at room temperature for 20 min.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. A total of 2 µg RNA was reverse-transcribed into cDNA using ReverTra Ace qPCR RT Kit (Toyobo Life Science, Osaka, Japan), according to the manufacturer's protocol. The reverse transcription steps as follow: 37°C for 15 min and 98°C for 5 min. The samples were stored at −20°C. qPCR was performed using the SYBR® Green Real-Time PCR Master Mix (Toyobo Life Science) and the ABI StepOnePlus™ Real-Time PCR System (ABI; Thermo Fisher Scientifc, Inc.), according to the manufacturer's protocol. GAPDH was used as an endogenous control. The PCR thermocycling conditions were as follows: Initial denaturation at 95°C for 3 min followed by 40 cycles of 95°C for 15 sec and extension at 60°C for 1 min. The threshold cycle for each sample was selected from the linear range and converted to a starting quantity by interpolation from a standard curve generated on the same plate for each set of primers (Table I). Epithelial (E)-cadherin, vimentin, matrix metalloproteinase 7 (MMP7), MMP9 and CIP2A mRNA levels were normalized for each well to GAPDH mRNA levels using the 2−ΔΔCq method (21). Each experiment was repeated three times.

Table I

Primer sequences for reverse transcription quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription quantitative polymerase chain reaction.

GenePrimer sequence (5′-3′)
E-cadherinF: CAGGTCTCCTCATGGCTTTGC
R: CTTCCGAAAAGAAGGCTGTCC
VimentinF: ACTACGTCCACCCGCACCTA
R: CAGCGAGAAGTCCACCGAGT
MMP7F: GAGGCATGAGTGAGCTACAGTG
R: ACATCTGGGCTTCTGCATTATT
MMP9F: CCGGACCAAGGATACAGTT
R: CGGCACTGAGGAATGATCTA
CIP2AF: TGCGGCACTTGGAGGTAATTTC
R: AGCTCTACAAGGCAACTCAAGC
GAPDHF: TGTTGCCATCAATGACCCCTT
R: CTCCACGACGTACTCAGCG

[i] F, forward; R, reverse; E-cadherin, epithelial cadherin; MMP, matrix metalloproteinase; CIP2A, cancerous inhibitor of protein phosphatase 2A.

Western blot analysis

Cells were lysed in radioimmunoprecipitation assay buffer containing 50 mM Tris, pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP-40, 1 mM DTT, 1 mM NaF, 1 mM sodium orthovanadate, 1 mM phenyl-methylsulfonyl fluoride (PMSF; Sigma-Aldrich; Merck KGaA) and 1% protease inhibitors cocktail (EMD Millipore, Billerica, MA, USA). Protein concentration was determined using the Bradford method. Equal amounts of sample (25 µg) were separated by SDS-PAGE (8–12% gels). Electrophoresed proteins were then transferred onto polyvinylidene fluoride membranes (EMD Millipore). The membranes were blocked with 5% skimmed milk in Tris-buffered saline at room temperature for 1 h. Following blocking, membranes were incubated overnight at 4°C with primary antibodies and then rinsed with Tris-buffered saline with Tween-20. The following primary antibodies were used: anti-E-cadherin (1:2,000; 20874-1-AP), anti-vimentin (1:5,000; 10366-1-AP), anti-Snail (1:3,000; 13099-1-AP), anti-MMP7 (1:1,000; 10374-2-AP), anti-insulin-like growth factor-binding protein 3 (IGFBP3; 1:1,000; 10189-2-AP), anti-proliferating cell nuclear antigen (PCNA; 1:5,000; 10205-2-AP) (both from ProteinTech Group, Inc., Chicago, IL, USA); anti-MMP9 (1:500; sc-6840), anti-CIP2A (1:500; sc-80662); anti-Fos-related antigen 1 (FRA-1; 1:500; sc-271657) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-PP2A (1:1,000; 2038), anti-ERK1/2 (1:1,000; 9102), anti-phospho-ERK1/2 (Thr202/Tyr204) (1:1,000; 9101), anti-c-Fos (1:1,000; 2250; Cell Signaling Technology, Inc., Danvers, MA, USA), and anti-GAPDH (1:5,000; M20006; Abmart, Shanghai, China). Membranes were then washed, and incubated with horseradish peroxidase-conjugated secondary antibody (1:1,000; E030120-01 and E030110-01; EarthOx, LLC, San Francisco, CA, USA) for 1.5 h at room temperature. The protein bands were visualized using SuperSignal® West Pico PLUS Chemiluminescent substrate (34579; Pierce; Thermo Fisher Scientific, Inc.) (22). Densitometric quantification of the western blots was determined using ImageJ software (version 1.4.3.67; National Institutes of Health, Bethesda, MD, USA).

Luciferase reporter assay

DU145 and PC3 cells were seeded in 12-well culture plates. When cells reached 70% confluence, they were transfected with pAP-1-Luc plasmids (Beyotime Institute of Biotechnology, Haimen, China) using Lipofectamine 3000 (Thermo Fisher Scientifc, Inc.), according to manufacturer's protocol. Following transfection for 4 h, the cells were treated with PPI (0.6–1.8 µM) for 20 h. Firefly luciferase activities were assayed using the Luciferase Assay System (Promega Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol.

Chromatin immunoprecipitation (ChIP) assay

DU145 and PC3 cells (2×105 cells/ml) treated with PPI for 24 h were used for ChIP assay using a ChIP-IT® Express Enzymatic Shearing kit (Active Motif, Beijing, China), according to the manufacturer's protocol. DNA-bound protein was immunoprecipitated using an anti-c-Fos (component of AP-1) antibody or rabbit IgG as a control. The AP-1 binding site of MMP7 promoter was detected by RT-qPCR using the following primers: 5′-CCAGATGTTGCAGAATACTCACTA-3′ (forward) and 5′-GATCCACTGTAATATGCGGTAAGT-3′ (reverse). The AP-1 binding site of vimentin promoter was detected by RT-qPCR using the following primers: 5′-CGAGCTGGGCAGTAGAGAGT-3′ (forward) and 5′-CCAAGACATGGAGGGAGTGT-3′ (reverse).

PP2A activity assay

PP2A immunoprecipitation phosphatase assay kit (Upstate Biotechnology, Inc., Lake Placid, NY, USA) was used according to the manufacturer's protocol in order to evaluate phosphate release as an index of phosphatase activity. Briefly, 100 µg protein isolated from cells was incubated with 4 µg anti-PP2A monoclonal antibody overnight. A total of 4 µl protein A agarose beads were added and the mixture was incubated at 4°C for 2 h. Subsequently, the beads were collected and washed three times with 700 µl ice-cold TBS and one time with 500 µl Ser/Thr assay buffer. The beads were further incubated with 750 mM phosphopeptide in Ser/Thr assay buffer for 10 min at 30°C with constant agitation. A total of 100 µl Malachite Green Phosphate Detection solution was added and the absorbance at 650 nm was measured using a microplate reader.

Xenograft studies

Male nude immunodeficient mice (nu/nu) (weighing ~16 g, 5-week-old) were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, China), and maintained under specific pathogen-free conditions. Mice were given free access to sterile water and to a standard diet, and maintained under controlled conditions of temperature (22–24°C), humidity (40–70%), light (12-h light-dark cycle). The present study was approved by the Hubei University of Medicine Animal Care and Use Committee (Hubei, China) and performed in compliance with the Regulations for the Administration of Affairs Concerning Experimental Animals. The mice were subcutaneously injected with human PC DU145 cells (6×106 cells which were suspended in 100 µl DMEM media) into the right flank of each mouse. Treatments started when tumors reached a palpable size (0.5 cm in diameter). Mice were randomly divided into the following two groups: control group (vehicle; 0.8% DMSO, 12% cremophor and 8% ethanol in normal saline; n=8) and PPI-treated group (intraperitoneal injection of 1 mg/kg PP1; n=8). The mice were treated 5 times per week for a total of 30 weeks. Caliper measurements of the longest perpendicular tumor diameters were performed twice a week to estimate the tumor volume, using the following formula: 4π/3 × (width/2)2 × (length/2), representing the 3-dimensional volume of an ellipse. Animals were sacrificed when tumors reached 1.5 cm or if the mice appeared moribund to prevent unnecessary morbidity to the mice.

Statistical analysis

All experiments were repeated at least three times and the data are presented as the mean ± standard deviation (SD). All statistical analyses were conducted using GraphPad Prism5 (GraphPad Software, Inc., La Jolla, CA, USA) and SPSS 22.0 (IBM Corp., Armonk, NY, USA). Results were analyzed using unpaired Student's t-test or one-way analysis of variance followed by Bonferroni post-test. P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated at least three times.

Results

Effects of PPI on the viability of PC cell lines

DU145 and PC3 cells were seeded into 96-well plates for 24 h and then treated with PPI (Fig. 1). After 24 or 48 h, the cell survival rate was detected using the MTT assay. The results suggested that PPI exhibited moderate cytotoxicity to PC cells. The IC50 values of PPI against DU145 and PC3 cells were 1.03 µM and 2.13 µM, respectively (Fig. 2A and B). Trypan blue exclusion assay showed that PPI decreased viable DU145 and PC3 cells in a dosage- and time-dependent manner (Fig. 2C and D). Next, colony formation assay showed that PPI markedly suppressed the clonogenic ability of DU145 cells (Fig. 2E and F). These results suggest that PPI may decrease anchorage-dependent (cell viability) and anchorage-independent (colony formation) growth of PC cells.

Figure 1

Chemical structure of Polyphyllin I.

Figure 2

Effect of PPI treatment on viability and colony formation of DU145 and PC3 cells. MTT assay was used to examine the inhibitory effects of PPI treatment on (A) DU145 and (B) PC3 cells. Trypan blue exclusion assay was used to test the inhibitory effects of PPI treatment on cell viability of (C) DU145 and (D) PC3 cells. (E) Images display the colonies stained with crystal violet. (F) The graph represents the number of colonies of DU145 cells treated with PPI. **P<0.01 and ***P<0.001 vs. 0 µM. PPI, polyphyllin I; con, control.

PPI suppresses the invasion and migration of PC cells as well as reverses EMT

In the present study the effects of PPI on the invasion and migration of PCs (DU145 and PC3) cells were investigated. The results demonstrated that PPI suppressed the invasion of DU145 and PC3 cells (Fig. 3A). Additionally, cell migration was assessed using a wound healing assay. DU145 and PC3 cells were treated with PPI for 24 h. The results revealed that PPI decreased DU145 and PC3 cell migration (Fig. 3B). These results suggest that PPI may exhibit an anti-invasive effect on PCs at low concentrations.

Figure 3

PPI inhibits invasive behavior and epithelial-mesenchymal transition of DU145 and PC3 cells. (A) Cells were pretreated with PPI (DU145 cells, 0.5 µM; PC3 cells 1.5 µM) for 30 min. Invasion assay was performed using modified 24-well microchemotaxis chambers (magnification, ×100). **P<0.01 vs. con. (B) Confluent cells were scratched and then treated with PPI (DU145 cells, 0.5 µM; PC3 cells, 1.5 µM) for 24 h. Migrated cells were examines (magnification, ×40). (C) Relative expression of E-cadherin and vimentin using reverse transcription quantitative polymerase chain reaction in DU145 and PC3 cells. *P<0.05. (D) DU145 and PC3 cells were treated with various concentrations of PPI for 24 h. Western blot analysis were carried out using the indicated antibodies. PPI, polyphyllin I; con, control; E-cadherin, epithelial cadherin.

EMT is an important process in tumor metastasis. During EMT, cells lose their polarized immotile epithelial characteristics and acquire motile mesenchymal features leading to increased invasion and motility (23). Moreover, the transition is characterized by a decrease in the expression of epithelial markers (including E-cadherin) as well as an increase in the expression of mesenchymal markers (including Snail and vimentin) (23,24). To determine whether PPI treatment may reverse EMT and inhibit PC metastasis in vitro, the expression of EMT-associated markers were assessed in PPI-treated DU145 and PC3 cells. The results demonstrated an increased expression of E-cadherin and a decreased expression of vimentin in PPI-treated DU145 and PC3 cells compared with the control cells (Fig. 3C and D). These results indicate that PPI treatment may suppress EMT. The effects of PPI treatment on EMT-associated transcription factors were investigated and it was revealed that PPI treatment decreased the expression levels of Snail (Fig. 3C and D). Therefore, these results suggest that PPI upregulates E-cadherin expression, and downregulates the expression of Snail and vimentin.

PPI inhibits the invasion and EMT in PC cells by downregulating MMP7, vimentin and Snail via the ERK signaling pathway

Tumor invasion and migration are associated with increased expression levels of matrix MMPs. MMP7 and MMP9 are two critical enzymes which contribute to cell invasion and migration (25,26). Thus, mRNA and protein expression levels of MMP7 and MMP9 were assessed (Fig. 4A–D). PPI treatment decreased MMP7 expression but it had no effect on MMP9 expression in DU145 and PC3 cells, suggesting that PPI may inhibit the invasion and migration of PC cells, by inhibiting MMP7.

Figure 4

PPI suppresses PC cell invasion through the downregulation of MMP7 via ERK/AP-1 pathway. Western blot analysis for MMP7 and MMP9 expression in (A) DU145 and (B) PC3 cells were treated with PPI for 24 h. RT-qPCR analysis of mRNA levels of MMP7 and MMP9 in (C) DU145 and (D) PC3 cells treated with PPI for 24 h. *P<0.05 and **P<0.01 vs. 0 µM. Western blot analysis of pERK, ERK and pAkt expression in (E) DU145 and (F) PC3 cells were incubated with PPI at the indicated concentrations for 24 h. (G) DU145 and PC3 cells were transfected with the AP-1 luciferase reporter construct for 4 h and then treated with PPI. Luciferase activity was measured using the luciferase assay system. *P<0.05 vs. 0 µM. (H) PPI inhibited binding of c-Fos to MMP7 promoter. Chromatins were extracted from DU145 and PC3 cells treated with or without PPI (DU145 cells, 0.7 µM PPI; PC3 cells, 1.7 µM PPI). Chromatin immunoprecipitation was performed by using anti-c-Fos antibody, and the amplification was carried out by RT-qPCR. *P<0.05. (I) PPI inhibited binding of FRA-1 to vimentin promoter. Chromatins were extracted from DU145 and PC3 cells treated with or without PPI (DU145 cells, 0.7 µM PPI; PC3 cells, 1.7 µM PPI). Chromatin immunoprecipitation was performed by using anti-FRA-1 antibody, and the amplification was carried out by RT-qPCR. RT-qPCR, reverse transcription quantitative polymerase chain reaction; PPI, polyphyllin I; ERK, extracellular signaling-related kinase; p, phosphorylated; MMP, matrix metal-loproteinase; FRA, Fos-related antigen 1.

Expression of MMP7, vimentin, and Snail may be regulated by the ERK signaling pathway, which serves an important role in invasion and EMT of PC cells (26–28). Therefore, the activation of ERK in PC cells treated with various PPI concentrations was assessed. The results demonstrated that PPI decreased the phosphorylation levels of ERK in a dose-dependent manner without affecting the total ERK expression and Akt phosphorylation in DU145 and PC3 cells (Fig. 4E and F). AP-1, a key transcription factor that promotes MMP7 and vimentin transcription, is regulated by MAPKs (including ERK, JNK and P38 kinases) (27,29). Luciferase reporter assay was performed to investigate the effect of PPI on the transcriptional activity of AP-1 and the results indicated that PPI decreased AP-1 transcription activity (Fig. 4G). ChIP assays showed that PPI decreased c-Fos binding to the MMP7 promoter (Fig. 4H). Additionally, PPI decreased FRA-1 (component of AP-1) binding to the vimentin promoter (Fig. 4I). These results demonstrate that PPI may inhibit invasion and EMT in PC cells through the ERK/AP-1 signaling pathway.

Effects of PPI treatment on the CIP2A/PP2A/ERK signaling axis

CIP2A is an oncogenic PP2A inhibitor, which is highly expressed in PC cells and mediates PC progression and castration-resistance (30). Western blot analysis was used to evaluate the effects PPI treatment on CIP2A protein expression. Fig. 5A shows that the expression of CIP2A was decreased in DU145 cells treated with 0.7 µM PPI and could not be detected in response to 0.8 µM PPI. Additionally, the expression of CIP2A was downregulated in response to treatment with 1.7 µM PPI in PC3 cells, and treatment with 1.8 µM PPI led to an elimination of CIP2A expression (Fig. 5B). In addition, the results indicated that PPI treatment may downregulates CIP2A expression in a time-dependent manner (Fig. 5C and D). The dephosphorylation of ERK is frequently regulated by PP2A, which is the downstream factor of CIP2A, therefore whether PPI may affect PP2A activity was assessed. Fig. 5E showed that the activity of PP2A was increased in PPI-treated PC cells, indicating that PPI may influence the CIP2A/PP2A/ERK signaling axis. Moreover, a PP2A inhibitor, OA, was used for the in vitro experiments. The results indicated that OA reversed the cell growth and invasion that were inhibited by PPI treatment (Fig. 5F and G). Additionally, combined treatment with OA and PPI increased the expression levels of phosphorylated ERK and upregulated MMP7, Snail, vimentin expression compared with those in PPI-treated cells (Fig. 5H and I). In conclusion, these results demonstrate that reactivation of PP2A may be required for PPI-inhibited invasion, MMP7, Snail, vimentin expression and ERK phosphorylation via CIP2A inhibition.

Figure 5

Effects of PPI on CIP2A/PP2A/ERK signaling axis. Western blot analysis of CIP2A expression in (A) DU145 and (B) PC3 cells treated with PPI for 24 h. Western blot analysis of CIP2A expression in PPI-treated (C) DU145 and (D) PC3 cells for the indicated time-points. PP2A activity in (E) DU145 and PC3 cells treated with indicated concentrations of PPI for 24. *P<0.05. (F) MMT assay in DU145 and PC3 cells were treated with PPI (0.7 or 1.7 µM) and/or OA (50 nM) for 24 h. *P<0.05. (G) DU145 cells were treated with PPI (0.6 µM) and/or OA (50 nM) for 20 h and their invasive ability was examined. Western blot analysis of MMP7, Snail, vimentin, pERK and ERK in (H) DU145 and (I) PC3 cells treated with PPI and/or OA for 24 h. PPI, polyphyllin I; ERK, extracellular signaling-related kinase; p, phosphorylated; MMP, matrix metalloproteinase; CIP2A, cancerous inhibitor of protein phosphatase 2A; OA, okadaic acid; PP2A, protein phosphatase 2A.

PPI suppresses tumor growth in vivo

To investigate the antitumor effect of PPI on PC in vivo, 6×106 DU145 cells in 100 µl of DMEM medium were subcutaneously inoculated in the right flank of nude mice. The mice were divided into vehicle or PPI-treated groups. The results indicated that PPI treatment significantly suppressed tumor growth compared to the vehicle control (P<0.05; Fig. 6A and B). PPI treatment also decreased the tumor weight of the mice (Fig. 6C). PPI treatment did not affect the body weight of the mice (Fig. 6D). Western blot analysis and PP2A activity assay revealed that the expression levels of pERK, MMP7, CIP2A and PCNA were decreased in the PPI-treated group (Fig. 6E). IGFBP3 is a critical biomarker involved in biological pathways thought to be important in pathogenesis and progression of PC (31). IGFBP3 expression was detected in tumor specimens and it was found that PPI decreased IGFBP3 expression (Fig. 6E). The PP2A activity of PPI-treated group was significantly upregulated (Fig. 6F).

Figure 6

PPI suppresses tumor growth in a xenograft mouse model. (A) Mice were treated with vehicle or 1.5 mg/kg PPI and the tumor volumes were evaluated twice a week. *P<0.05 vs. vehicle. (B) Images of xenograft tumors separated from mice treated with vehicle or 1.5 mg/kg PPI after 4 weeks. (C) Weight of the tumor from vehicle or 1.5 mg/kg PPI-treated mice. **P<0.01 vs. vehicle. (D) Body weight of the vehicle or 1.5 mg/kg PPI-treated mice. (E) The expression of indicated proteins in xenograft tumors was detected using western blot analysis. (F) Tumor tissues were isolated from mice, and PP2A activity was detected using PP2A phosphatase assay. *P<0.05. PPI, polyphyllin I; ERK, extracellular signaling-related kinase; p, phosphorylated; MMP, matrix metalloproteinase; CIP2A, cancerous inhibitor of protein phosphatase 2A; PP2A, protein phosphatase 2A; IGFBP3, insulin-like growth factor-binding protein 3; PCNA, proliferating cell nuclear antigen.

Based on these results, PPI may suppress PC viability, invasion and EMT by inhibiting the CIP2A/PP2A/ERK signaling cascade (Fig. 7).

Figure 7

Diagram of PPI blockage possible mechanism in prostate cancer cells. PPI, polyphyllin I; ERK, extracellular signaling-related kinase; p, phosphory-lated; MMP, matrix metalloproteinase; CIP2A, cancerous inhibitor of protein phosphatase 2A; PP2A, protein phosphatase 2A; EMT, epithelial-mesenchymal transition; E-cadherin, epithelial cadherin.

Discussion

PC is the second major cause of cancer mortality in males worldwide, which is due to late-stage diagnosis and inefficient therapy, especially for recurrent disease (25,32). In Chinese traditional medicine, various compounds which are present in natural herbs may have an anticancer potential due to their ability to inhibit tumor growth, metastasis and angiogenesis without having significant side effects. Therefore, TCM may be an important approach for reducing the tumor incidence and mortality by preventing, reversing or delaying the process of tumorigenesis (22,33,34). PPI is a compound found in Paris polyphylla rhizomes. PPI has been reported to exhibit antiproliferative and anticancer activities according to previous studies (16,18,19). Therefore, the mode of action and potential utility of PPI was explored in PC cells in search of a novel, effective anticancer agent.

In the present study, the effects of PPI were investigated using DU145 and PC3 cell lines. MTT and trypan blue dye exclusion assays suggested that PPI may suppress the growth of PC cells. Furthermore, PPI may inhibit the colony formation ability of PC cells. Therefore, PPI was shown to exert anti-proliferative effects in human PC cells.

Inhibition of tumor metastasis and invasion is critical to improving the prognosis of patients with PC (26). Therefore, treatment strategies for prevention or suppression of tumor metastasis and invasion may ameliorate the survival of patients with PC. The results of the present study suggest that PPI may suppress the invasive and migratory abilities of DU145 and PC3 cells. Tumor metastasis is a multifactor, multistage and multistep process regulated by multiple factors and genes. EMT serves a key role in cancer metastasis (35). Therefore, in the present study the expression of EMT-associated markers was investigated and it was found that PPI-mediated mobility inhibition was associated with EMT reversion.

Another finding of the present study was that PPI may inhibit the expression of MMP7. Metastasis and invasion of tumor cells involves the following processes: adhesion, enzymolysis and movement. MMP7 is a membrane protein in the MMP family (29). This type of protease degrades the extracellular matrix and basement membrane, which are important mediators for the metastasis and invasion of cancer cells (26). Previous studies have confirmed that transcription factors, including Snail, Slug and ZEB1, which act as E-cadherin repressors, are involved in promoting EMT (36). And MMP7, vimentin and Snail expression is regulated by the ERK signaling pathway (27–29). In the present study the effects of PPI on the phosphorylation level of ERK were examined. The results demonstrated that PPI may inhibit ERK phosphorylation in DU145 and PC3 cells. The transcription factor AP-1 may form either a homo- or hetero- complex which can bind as c-fos/c-fos, c-jun/c-jun or c-fos/c-jun to activate endogenous or exogenous motivation (37). AP-1 is also a critical transcriptional modulator in ERK signal transduction (15). Moreover, the MMP7 and vimentin promoter region contains a cis-regulatory element of one AP-1 binding site. Thus, the effects of PPI on the AP-1 transcription activity and binding ability to the MMP7 or vimentin promoter was assessed. The results revealed that PPI may suppress AP-1 transcriptional activity and AP-1 binding ability to the MMP7 and vimentin promoter. In conclusion, these results suggest that the anti-invasive effect of PPI may be mediated by suppressing AP-1 transcription activities and the ERK/MMP7 and ERK/EMT signal.

CIP2A is a oncogene that may facilitate cell transformation and tumorigenesis via inhibiting PP2A activities, as it is a protein phosphatase that regulates several critical oncogenic signal proteins including Akt, c-Myc, ERK and p70S6K (38–40). The results of the present study revealed that PPI may downregulate CIP2A expression and upregulate PP2A activity. It was speculated that PPI may inhibit CIP2A/PP2A signal to downregulate ERK phosphorylation and the expression of MMP7, vimentin, and Snail, and then decrease PC cell EMT and invasion. To further determine the effect of PP2A activation in PPI-mediated inhibition of invasion and downregulation of MMP7, PCs were treated with PPI and OA, an inhibitor of PP2A. The results showed that inactivation of PP2A may antagonize the effect of PPI in EMT and invasion through the ERK pathway. These results confirmed that the CIP2A/PP2A signaling axis serves a crucial function in PC proliferation, invasion, and EMT that is mediated by inhibiting ERK activity. ERK activation may be induced by PPI. In a xenograft mouse model, PPI significantly repressed tumor growth, whereas the body weight of the mice remained unaffected. The results also demonstrated that PPI suppressed pERK, MMP7, IGFBP3 and CIP2A expression. Therefore, PPI may be considered a novel anticancer agent in preventing and treating PC.

Acknowledgments

Not applicable.

References

1 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ and He J: Cancer statistics in China, 2015. CA Cancer J Clin. 66:115–132. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Siegel RL, Miller KD and Jemal A: Cancer Statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Junttila MR, Puustinen P, Niemelä M, Ahola R, Arnold H, Böttzauw T, Ala-aho R, Nielsen C, Ivaska J, Taya Y, et al: CIP2A inhibits PP2A in human malignancies. Cell. 130:51–62. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Khanna A, Böckelman C, Hemmes A, Junttila MR, Wiksten JP, Lundin M, Junnila S, Murphy DJ, Evan GI, Haglund C, et al: MYC-dependent regulation and prognostic role of CIP2A in gastric cancer. J Natl Cancer Inst. 101:793–805. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Teng HW, Yang SH, Lin JK, Chen WS, Lin TC, Jiang JK, Yen CC, Li AF, Chen PC, Lan YT, et al: CIP2A is a predictor of poor prognosis in colon cancer. J Gastrointest Surg. 16:1037–1047. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Vaarala MH, Väisänen MR and Ristimäki A: CIP2A expression is increased in prostate cancer. J Exp Clin Cancer Res. 29:1362010. View Article : Google Scholar : PubMed/NCBI

8 

Böckelman C, Lassus H, Hemmes A, Leminen A, Westermarck J, Haglund C, Bützow R and Ristimäki A: Prognostic role of CIP2A expression in serous ovarian cancer. Br J Cancer. 105:989–995. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Tseng LM, Liu CY, Chang KC, Chu PY, Shiau CW and Chen KF: CIP2A is a target of bortezomib in human triple negative breast cancer cells. Breast Cancer Res. 14:R682012. View Article : Google Scholar : PubMed/NCBI

10 

Liu Z, Ma L, Wen ZS, Hu Z, Wu FQ, Li W, Liu J and Zhou GB: Cancerous inhibitor of PP2A is targeted by natural compound celastrol for degradation in non-small-cell lung cancer. Carcinogenesis. 35:905–914. 2014. View Article : Google Scholar

11 

Côme C, Laine A, Chanrion M, Edgren H, Mattila E, Liu X, Jonkers J, Ivaska J, Isola J, Darbon JM, et al: CIP2A is associated with human breast cancer aggressivity. Clin Cancer Res. 15:5092–5100. 2009. View Article : Google Scholar : PubMed/NCBI

12 

De P, Carlson JH, Leyland-Jones B and Dey N: Role of 'oncogenic nexus' of CIP2A in breast oncogenesis: How does it work? Am J Cancer Res. 5:2872–2891. 2015.

13 

Wu Y, Gu TT and Zheng PS: CIP2A cooperates with H-Ras to promote epithelial-mesenchymal transition in cervical-cancer progression. Cancer Lett. 356:646–655. 2015. View Article : Google Scholar

14 

Cai F, Zhang L, Xiao X, Duan C, Huang Q, Fan C, Li J, Liu X, Li S and Liu Y: Cucurbitacin B reverses multidrug resistance by targeting CIP2A to reactivate protein phosphatase 2A in MCF-7/adriamycin cells. Oncol Rep. 36:1180–1186. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Xiao X, He Z, Cao W, Cai F, Zhang L, Huang Q, Fan C, Duan C, Wang X, Wang J, et al: Oridonin inhibits gefitinib-resistant lung cancer cells by suppressing EGFR/ERK/MMP-12 and CIP2A/Akt signaling pathways. Int J Oncol. 48:2608–2618. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Li GB, Fu RQ, Shen HM, Zhou J, Hu XY, Liu YX, Li YN, Zhang HW, Liu X, Zhang YH, et al: Polyphyllin I induces mitophagic and apoptotic cell death in human breast cancer cells by increasing mitochondrial PINK1 levels. Oncotarget. 8:10359–10374. 2017.PubMed/NCBI

17 

Chen JC, Hsieh MJ, Chen CJ, Lin JT, Lo YS, Chuang YC, Chien SY and Chen MK: Polyphyllin G induce apoptosis and autophagy in human nasopharyngeal cancer cells by modulation of AKT and mitogen-activated protein kinase pathways in vitro and in vivo. Oncotarget. 7:70276–70289. 2016.PubMed/NCBI

18 

He H, Zheng L, Sun YP, Zhang GW and Yue ZG: Steroidal saponins from Paris polyphylla suppress adhesion, migration and invasion of human lung cancer A549 cells via downregulating MMP-2 and MMP-9. Asian Pac J Cancer Prev. 15:10911–10916. 2014. View Article : Google Scholar

19 

Yue G, Wei J, Qian X, Yu L, Zou Z, Guan W, Wang H, Shen J and Liu B: Synergistic anticancer effects of polyphyllin I and evodiamine on freshly-removed human gastric tumors. PLoS One. 8:e651642013. View Article : Google Scholar : PubMed/NCBI

20 

Shi YM, Yang L, Geng YD, Zhang C and Kong LY: Polyphyllin I induced-apoptosis is enhanced by inhibition of autophagy in human hepatocellular carcinoma cells. Phytomedicine. 22:1139–1149. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

22 

Cao W, Liu Y, Zhang R, Zhang B, Wang T, Zhu X, Mei L, Chen H, Zhang H, Ming P, et al: Homoharringtonine induces apoptosis and inhibits STAT3 via IL-6/JAK1/STAT3 signal pathway in Gefitinib-resistant lung cancer cells. Sci Rep. 5:84772015. View Article : Google Scholar : PubMed/NCBI

23 

Bucay N, Bhagirath D, Sekhon K, Yang T, Fukuhara S, Majid S, Shahryari V, Tabatabai Z, Greene KL, Hashimoto Y, et al: A novel microRNA regulator of prostate cancer epithelial-mesen-chymal transition. Cell Death Differ. 24:1263–1274. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Montanari M, Rossetti S, Cavaliere C, D'Aniello C, Malzone MG, Vanacore D, Di Franco R, La Mantia E, Iovane G, Piscitelli R, et al: Epithelial-mesenchymal transition in prostate cancer: An overview. Oncotarget. 8:35376–35389. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Chen CM, Lin CL, Chiou HL, Hsieh SC, Lin CL, Cheng CW, Hung CH, Tsai JP and Hsieh YH: Loss of endothelial cell-specific molecule 1 promotes the tumorigenicity and metastasis of prostate cancer cells through regulation of the TIMP-1/MMP-9 expression. Oncotarget. 8:13886–13897. 2017.PubMed/NCBI

26 

Zhang Q, Liu S, Parajuli KR, Zhang W, Zhang K, Mo Z, Liu J, Chen Z, Yang S, Wang AR, et al: Interleukin-17 promotes prostate cancer via MMP7-induced epithelial-to-mesenchymal transition. Oncogene. 36:687–699. 2017. View Article : Google Scholar :

27 

Andreolas C, Kalogeropoulou M, Voulgari A and Pintzas A: Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells. Int J Cancer. 122:1745–1756. 2008. View Article : Google Scholar

28 

Zhao J, Ou B, Han D, Wang P, Zong Y, Zhu C, Liu D, Zheng M, Sun J, Feng H, et al: Tumor-derived CXCL5 promotes human colorectal cancer metastasis through activation of the ERK/Elk-1/Snail and AKT/GSK3β/β-catenin pathways. Mol Cancer. 16:702017. View Article : Google Scholar

29 

Chang MC, Chen CA, Chen PJ, Chiang YC, Chen YL, Mao TL, Lin HW, Lin Chiang WH and Cheng WF: Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442:293–302. 2012. View Article : Google Scholar

30 

Khanna A, Rane JK, Kivinummi KK, Urbanucci A, Helenius MA, Tolonen TT, Saramäki OR, Latonen L, Manni V, Pimanda JE, et al: CIP2A is a candidate therapeutic target in clinically challenging prostate cancer cell populations. Oncotarget. 6:19661–19670. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Terracciano D, Bruzzese D, Ferro M, Mazzarella C, Di Lorenzo G, Altieri V, Mariano A, Macchia V and Di Carlo A: Preoperative insulin-like growth factor-binding protein-3 (IGFBP-3) blood level predicts gleason sum upgrading. Prostate. 72:100–107. 2012. View Article : Google Scholar

32 

Terracciano D, Mazzarella C, Di Carlo A, Mariano A, Ferro M, Di Lorenzo G, Giordano A, Altieri V, De Placido S and Macchia V: Effects of the ErbB1/ErbB2 kinase inhibitor GW2974 on androgen-independent prostate cancer PC-3 cell line growth and NSE, chromogranin A and osteopontin content. Oncol Rep. 24:213–217. 2010.PubMed/NCBI

33 

Feng T, Cao W, Shen W, Zhang L, Gu X, Guo Y, Tsai HI, Liu X, Li J, Zhang J, et al: Arctigenin inhibits STAT3 and exhibits anticancer potential in human triple-negative breast cancer therapy. Oncotarget. 8:329–344. 2017.

34 

Liu Y, Dong Y, Zhang B and Cheng YX: Small compound 6-O-angeloylplenolin induces caspase-dependent apoptosis in human multiple myeloma cells. Oncol Lett. 6:556–558. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Cao Z, Koochekpour S, Strup SE and Kyprianou N: Reversion of epithelial-mesenchymal transition by a novel agent DZ-50 via IGF binding protein-3 in prostate cancer cells. Oncotarget. 8:78507–78519. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Chen HN, Yuan K, Xie N, Wang K, Huang Z, Chen Y, Dou Q, Wu M, Nice EC, Zhou ZG, et al: PDLIM1 stabilizes the E-cadherin/β-catenin complex to prevent epithelial-mesenchymal transition and metastatic potential of colorectal cancer cells. Cancer Res. 76:1122–1134. 2016. View Article : Google Scholar

37 

Wen-Sheng W: ERK signaling pathway is involved in p15INK4b/p16INK4a expression and HepG2 growth inhibition triggered by TPA and Saikosaponin a. Oncogene. 22:955–963. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Rincón R, Cristóbal I, Zazo S, Arpí O, Menéndez S, Manso R, Lluch A, Eroles P, Rovira A, Albanell J, et al: PP2A inhibition determines poor outcome and doxorubicin resistance in early breast cancer and its activation shows promising therapeutic effects. Oncotarget. 6:4299–4314. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Tsukamoto S, Huang Y, Umeda D, Yamada S, Yamashita S, Kumazoe M, Kim Y, Murata M, Yamada K and Tachibana H: 67-kDa laminin receptor-dependent protein phosphatase 2A (PP2A) activation elicits melanoma-specific antitumor activity overcoming drug resistance. J Biol Chem. 289:32671–32681. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Wang J, Okkeri J, Pavic K, Wang Z, Kauko O, Halonen T, Sarek G, Ojala PM, Rao Z, Xu W, et al: Oncoprotein CIP2A is stabilized via interaction with tumor suppressor PP2A/B56. EMBO Rep. 18:437–450. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu X, Sun Z, Deng J, Liu J, Ma K, Si Y, Zhang T, Feng T, Liu Y, Tan Y, Tan Y, et al: Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer. Int J Oncol 53: 1279-1288, 2018.
APA
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y. ... Tan, Y. (2018). Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer. International Journal of Oncology, 53, 1279-1288. https://doi.org/10.3892/ijo.2018.4464
MLA
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y., Zhang, T., Feng, T., Liu, Y., Tan, Y."Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer". International Journal of Oncology 53.3 (2018): 1279-1288.
Chicago
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y., Zhang, T., Feng, T., Liu, Y., Tan, Y."Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer". International Journal of Oncology 53, no. 3 (2018): 1279-1288. https://doi.org/10.3892/ijo.2018.4464
Copy and paste a formatted citation
x
Spandidos Publications style
Liu X, Sun Z, Deng J, Liu J, Ma K, Si Y, Zhang T, Feng T, Liu Y, Tan Y, Tan Y, et al: Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer. Int J Oncol 53: 1279-1288, 2018.
APA
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y. ... Tan, Y. (2018). Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer. International Journal of Oncology, 53, 1279-1288. https://doi.org/10.3892/ijo.2018.4464
MLA
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y., Zhang, T., Feng, T., Liu, Y., Tan, Y."Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer". International Journal of Oncology 53.3 (2018): 1279-1288.
Chicago
Liu, X., Sun, Z., Deng, J., Liu, J., Ma, K., Si, Y., Zhang, T., Feng, T., Liu, Y., Tan, Y."Polyphyllin I inhibits invasion and epithelial-mesenchymal transition via CIP2A/PP2A/ERK signaling in prostate cancer". International Journal of Oncology 53, no. 3 (2018): 1279-1288. https://doi.org/10.3892/ijo.2018.4464
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team