Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of microtopographic structures of silk fibroin on endothelial cell behavior

  • Authors:
    • Jin-Yun Tan
    • Jian-Chuan Wen
    • Wei-Hao Shi
    • Qing He
    • Lei Zhu
    • Kun Liang
    • Zheng-Zhong Shao
    • Bo Yu
  • View Affiliations / Copyright

    Affiliations: Department of Surgery, Huashan Hospital of Fudan University, Shanghai 200040, P.R. China, Laboratory of Advanced Materials of Fudan University, Shanghai 200438, P.R. China, Department of Surgery, Pudong Hospital of Fudan University, Shanghai 201399, P.R. China
  • Pages: 292-298
    |
    Published online on: October 12, 2012
       https://doi.org/10.3892/mmr.2012.1127
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Stent implantation has become the preferred revascularization treatment for occlusive blood vessel disease; however, there are occasionally complications resulting in re-narrowing of the treated artery. One approach to overcoming this problem is to establish a confluent monolayer of endothelial cells (ECs) on the stent, and a coating would facilitate the attachment of ECs. Silk fibroin was reported to be used as an ideal coating applied to stent for the culture of human ECs. The aim of the present study is to gain more insight into the influence of the internal microtopographical structure of silk fibroin on cell behavior, such as attachment and growth, and to further investigate its molecular mechanism using human umbilical vein ECs (HUVECs). Our results evaluated the effect of different microtopographical structures on cell behavior. In addition, we analyzed the cell cycle and investigated relevant molecules involved. The results indicated that the microtopographic structure of silk fibroin was associated with EC morphology, attachment and proliferation.

Introduction

A new era commenced when metallic stents were firstly introduced into clinical practice for the management of coronary and peripheral artery disease following transluminal angioplasty. This development brought about a significant reduction in restenosis compared to balloon angioplasty (1). Stent implantation has improved outcomes and become the preferred revascularization treatment for occlusive blood vessel disease. However, during surgical intervention, the unavoidable vascular trauma may initiate undesirable responses such as the excessive proliferation of vascular smooth muscle cells (SMCs), extracellular matrix synthesis, thrombosis and a chronic inflammatory reaction, leading to complications resulting in the re-narrowing of the treated artery, known clinically as in-stent restenosis (ISR) (2). ISR is defined as diameter stenosis of ≥50% in the stented area of the vessel mainly due to excessive neointimal proliferation within the stented segment. This reduces the long-term efficacy of metal stent implantation to 20–40%.

ISR represents an abnormal vascular response and repair to injury that results in excessive tissue growth. Angioscopic and pathological evidence suggests that endothelial cell (EC) dysfunction contributes to such development (3). A healthy endothelium sustains an antithrombotic milieu by secretion of various factors that exert antiaggregatory effects on platelets or have anticoagulatory or fibrinolytic properties (4). When in a confluent monolayer, ECs cease replication. Following stent implantation, the attendant endothelial denudation allows thrombus formation in response to exposure of highly thrombogenic substances from ruptured or erosive plaques, and in the meantime, the SMCs proliferate and migrate to the deendothelialized vessel surface, where they continue to proliferate and secrete extracellular matrix proteins, leading to neointimal tissue formation.

A possible future approach to overcome ISR is to promote and accelerate reendothelialization in the injured vessel, which is more natural and consequently safer. Among them, EC-capture stent, a type of stent used to attract ECs, would ultimately promote the elution of biologically active substances through a functioning endothelium monolayer, revealing correlation with a decrease in thrombosis and intimal thickening (5). Endothelium cell seeding techniques could be of high value for the establishment of a confluent monolayer on the stent in vitro. However, in vitro experiments showed that limited ECs were retained after stent expansion at the time of implantation and the subsequent pulsatile flow exposure (6,7).

Prior studies have suggested that coating the stent with a matrix such as fibronectin or collagen would facilitate the attachment of ECs. These studies have also demonstrated that fibronectin-coated stents can be seeded in vitro with vascular ECs (8,9) and that a number of the cells remain adherent to the stent following balloon expansion of the stent (10). However, these matrices are thrombogenic and could increase stent thrombogenicity. In addition, their poor mechanical property and limited ability to sustain stent expansion and deployment are also substantial challenges in clinical application (10,11).

A number of other different compounds have been utilized as scaffold for the growth of ECs in the last decade. Among them, silk fibroin, the material that remains after the removal of sericin from silk, has demonstrated unique mechanical properties as well as excellent biocompatibility, controlled degradability and versatile processability in different material formats, and could be used to coat the stent in an attempt to increase attachment to ECs (12,13). Silk has been used for centuries primarily as suture material. Its fibers are composed of two major types of protein: a) sericin, the antigenic gum-like protein surrounding the fibers; and b) fibroin, the core filaments of silk responsible for silk’s elasticity (14). If sericin is removed, purified silk fibroin exhibits few immunological reactions, retaining the strength and many other desirable features of silk just as mentioned above.

Recent studies have revealed that physical modifications of biomaterials may influence cell reaction (15), and that nanostructured materials have been shown to support endothelial cellular attachment and growth (16). Thus, to validate silk fibroin’s ability for coating the stent, it is our belief that a deeper understanding of cell-material interactions is essential for controlling endothelial cellular function by the physical parameters of the material. In the present study, we focused on employing a micromolding technique to produce silk fibroin with different microstructural features at micron scale, and at the same time, to evaluate the effect of these microtopographical features on cell behavior, such as attachment and growth, using human umbilical vein ECs (HUVECs). Furthermore, we analyzed the cell cycle and investigated relevant molecules involved in the cell growth and adhesive molecules such as integrin α5β1 and α5β3 for the study of the biological performance of cells on different patterned surfaces.

Materials and methods

Fabrication of silk fibroin

Silk fibroins with different microtopographical features were kindly supplied by the Laboratory of Advanced Materials, Fudan University. Polydimethylsiloxane (PDMS) molds were surface modified by carving various combinations of grooves and ridges into the surface using a computer controlled excimer laser beam through a metal photomask. The mask was not in close contact with the surface and the desired pattern was projected via the laser beam onto the area of interest. The silk fibroin solutions prepared earlier were pipetted on top of the pattern present on the PDMS mold. As the silk fibroin solution evaporated and transformed to membrane, the micropatterns of the PDMS mold were transferred to the membrane. In this way, 4 types of silk fibroin were obtained having microtopographical structures at micron scale, as well as one control, having a non-patterned structure.

Cell culture on the silk fibroin surfaces

HUVECs were isolated according to a previously published method (17). Cells were cultured in medium M199 (Sigma, St. Louis, MO, USA) supplemented with 20% fetal bovine serum (Thermo Scientific Hyclone, South Logan, UT, USA). Cells were seeded at a density of 1×104 cells/cm2 in a 6-well plate containing 4 types of silk fibroin with different microtopographic structures and one with a non-patterned structure. The plate was incubated at 37<C in 5% carbon dioxide. Cells were cultured for 3 days and were imaged at ×160 magnification using an IX-71 microscope (Olympus, Tokyo, Japan) equipped with a high resolution digital camera.

Cell proliferation assay

Cell proliferation was evaluated during culture time (24, 48 and 72 h) to detect the effect of microtopographic structures on the proliferation of HUVECs by Sulforhodamine B (SRB). Cells (5×103 cells/well in 100 μl medium) were seeded in 96-well plates containing the 4 types of silk fibroin with different microtopographic structures and one with a non-patterned structure. After each time point, 50 μl of 30% trichloroacetic acid was added for 60 min at 4°C. After washing and drying the plate, 100 μl of 0.4% SRB was added for 30 min. The plates were rinsed with 0.1% acetic acid and air-dried, after which 100 μl of Tris base (10 mmol/l) was added, and the plates were agitated for 5 min. The SRB value was measured at a wavelength of 490 nm by iMark™ Microplate Reader (Bio-Rad, Hercules, CA, USA). The experiment was performed in quintuplicate and repeated three times.

Real-time PCR analysis

HUVECs were seeded in 60 mm plates (1×106/plate) containing the 4 types of silk fibroin with different microtopographic structures and one with a non-pattened structure. After incubation for 72 h, cells were removed from plates with trypsin and then centrifuged. The total cellular RNA was extracted from the cell pellets using TRIzol (Invitrogen, Carlsbad, CA, USA) and then transcribed into cDNA with a RevertAid™ first strand cDNA synthesis kit (Fermentas, Vilnius, Lithuania) using 2 μg total RNA and oligo(dT) primers. The quantitative PCR included 2 μl cDNA and 10 μl SYBR-Green Master mix (Takara, China) with a pair of primers. The reactions were monitored on the ABI PRISM 7500 sequence system (Applied Biosystems, Carlsbad, CA, USA). mRNA levels of VEGF, VCAM-1, Eselectin, α5β3 and E-cadherin were calculated using the equation 2−ΔΔCt and normalized to human GAPDH mRNA levels. The primer sequences for specific mRNA are shown in Table I.

Table I

Primer sequences for specific genes.

Table I

Primer sequences for specific genes.

GenePrimer sequences (5′-3′)
VEGFF: AATCATCACGAAGTGGTGAAG
R: AATCTGCATGGTGATGTTGGA
VCAM-1F: TTAGATAATGGGAATCTACA
R: TCAACATGACTGAGTCTCCAA
EselectinF: TGAGTGTGATGCTGTGACAAA
R: TTCTGAGGCTGGCGGACGG
α5β3F: TTAAGAATGCTTACAATAA
R: AACGACTGCTCCTGGATGCAC
E-cadherinF: TTGCTCACATTTCCCAACTCC
R: TTTCAATAATAAAGACACCAA
GAPDHF: TTCACCACCATGGAGAAGGCTG
R: TTCCACGATACCAAAGTTGTCA

[i] F, forward; R, reverse.

Western blot analysis for adhesive molecules

HUVECs were seeded in 60-mm plates as described above. Following incubation for 72 h, cells were removed from the plates with trypsin and then centrifuged. Cell pellets were resuspended in lysis buffer (1% Triton X100, 50 mM Hepes, pH 7.4, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi and 10% glycerol to which 1 mM PMSF, 1 mM Na3VO4, and 1X protease inhibitor were added before use) to harvest cell lysates. Proteins from total cell lysates were separated using a 10–15% SDS-PAGE gel and then transferred to PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked, washed, and incubated with specific primary antibodies. The primary antibody incubation was followed by incubation with HRP-conjugated secondary antibodies. The bands were detected with an enhanced chemiluminescence assay (PerkinElmer, Waltham, MA, USA). The protein expression level of α5β1 and α5β3 was calculated using Quantity One software (Bio-Rad).

Enzyme-linked immunosorbent assay (ELISA) test

HUVECs were seeded in 60-mm plates as described above. Supernatants were harvested after 72 h and centrifuged at 2,000 × g to measure the concentration of protein factor by an ELISA according to the manufacturer’s instructions for the ELISA kit (R&D Systems, Minneapolis, MN, USA).

Cell cycle analysis

HUVECs were seeded in 60-mm plates as described above. After incubation for 72 h, cells were trypsinized, collected in phosphate-buffered saline (PBS) and fixed on ice followed by 70% cold ethanol. After treatment with 10 μg/ml RNase, cells were stained with 50 μg/ml propidium iodide (Sigma) for 15 min at room temperature to prepare for cell cycle analysis. Stained cells were analyzed by flow cytometry (FACSCalibur; BD Biosciences, Franklin Lakes, NJ, USA). The cell cycle information was analyzed using ModFit 3.0 software.

Statistical analysis

All data were subjected to statistical analysis and were reported as the mean ± standard deviation. ANOVA was used to assess the statistical differences in means among these groups. The criterion for statistical significance was taken as P<0.05 using a two-tailed t-test. The analyses were performed using SPSS 15.0 software.

Results

Fabrication of micropatterned silk fibroin

In this study, micromolding was used to develop microtopographic structures of silk fibroin. Four defined types of silk fibroin demonstrated features of microtopographical structure and another showed a non-patterned structure as a control (Fig. 1).

Figure 1

Four samples of silk fibroin showing different features of microtopographical structure under the microscope. In this study, micromolding was used to develop the microtopographic structures of silk fibroin.

Cell behavior on micropatterned silk fibroin surfaces

Fig. 2 shows micrographs of HUVEC imaged at ×160 magnification on silk fibroin with different microtopographic structures or non-patterned structure after 72 h in culture. Notably, most of the ECs had preferential spreading along the ridges and grooves of the microtopographic structure. The cells clearly show a different adhesion and proliferation behavior depending on the underlying microtopographic structure as described in Table II. Cells in the non-patterned structure group showed a changed morphology, such as fusiform or spherical, compared to the cells of the microtopographic structure groups, which were well attached and stretched, particularly in Structure 1. Meanwhile, the cell debris in the non-patterned structure group was far greater than in the other groups.

Figure 2

Human umbilical vein endothelial cells (HUVECs) imaged at ×160 magnification on silk fibroin with different microtopographic structures or non-patterned structure after 72 h in culture. (A) Non-silk fibroin. (B) Silk fibroin of non-patterned structure. (C) Silk fibroin of Structure 1. (D) Silk fibroin of Structure 2. (E) Silk fibroin of Structure 3. (F) Silk fibroin of Structure 4.

Table II

Micrographs of HUVECs on different types of silk fibroin.

Table II

Micrographs of HUVECs on different types of silk fibroin.

GroupCell debrisMorphology
Non-patterned structureMoreChanged
Structure 1LessVery good
Structure 2LessNot bad
Structure 3LessGood
Structure 4LessGood

[i] HUVECs, human umbilical vein endothelial cells.

Effect of microtopographic structure of silk fibroin on cell growth

Cell proliferation evaluated by SRB suggested that cultured HUVECs on silk fibroin with different microtopographic structures or non-patterned structure proliferated from day 1 to 3 of culture and the cell number in Structure 1 increased the most. Compared to the non-patterned structure group, the optical density (OD) values were statistically significant for the microtopographic structure groups (P<0.01, P<0.05), with the exception of Structure 4 (P>0.05), although for the first 2 days no statistically significant difference was observed, suggesting that HUVECs would proliferate better on silk fibroin with different microtopographic structures (Fig. 3).

Figure 3

Microtopographic structures had a positive effect on the proliferation of human umbilical vein endothelial cells (HUVECs). Cell proliferation on silk fibroin of 4 types of different microtopographic structures (Str-1, 2, 3 and 4 and a non-patterned structure as a control (Ctrl) were evaluated by Sulforhodamine B (SRB) and detected at a fixed wavelength of 490 nm after incubation for 24, 48 and 72 h (**P<0.01, *P<0.05).

Effect of microtopographic structure of silk fibroin on mRNA level and protein expression of growth factor and adhesive molecules

To understand the mechanisms of how most ECs adhere and grow more effectively on silk fibroin with microtopographic structures compared to that of non-patterned structure, we performed molecular studies on the adhesive molecules and growth factor using real-time PCR and western blot analysis. We found that after 72 h, the mRNA level of adherent molecule Eselectin was upregulated in Structure 1, and VCAM-1 was upregulated in Structure 1 and 3; moreover, α5β3, E-cadherin and VEGF were upregulated in all microtopographic structure groups except Structure 4, compared to the non-patterned structure group, particularly in Structure 1 group (P<0.01, P<0.05; Fig. 4). In addition, the protein expression of adhesive molecule α5β1 was upregulated in the microtopographic structure groups except Structure 4, and α5β3 was upregulated in Structure 1 and 2, compared to the non-patterned structure group (P<0.01, P<0.05; Fig. 5).

Figure 4

mRNA level of adherent molecules and growth factor of cells growing on silk fibroin of different microstructures were significantly higher than that of the non-patterned structure. Human umbilical vein endothelial cells (HUVECs) were seeded on 4 types of silk fibroin with different microtopographic structures (Str-1, 2, 3 and 4) and one with a non-pattened structure as a control (Ctrl). After incubation for 72 h, mRNA levels of VEGF, VCAM-1, Eselectin, α5β3 amd E-cadherin were analyzed by real-time PCR (**P<0.01, *P<0.05).

Figure 5

Protein expression of integrin of cells growing on silk fibroin of different microstructures was significantly higher than that of the non-patterned structure. (A) Human umbilical vein endothelial cells (HUVECs) were seeded on 4 types of silk fibroin with different microtopographic structures (Str-1, 2, 3 and 4) and one with a non-pattened structure as a control (Ctrl). After incubation for 72 h, the protein expression levels of α5β1 and α5β3 were analyzed by western blotting (**P<0.01, *P<0.05). (B) The protein expression levels of α5β1 and α5β3 were calculated by Quantity One software.

Effect of microtopographic structure of silk fibroin on secretion of protein factor

The influence of microtopographic structure on protein factor secreted in the HUVEC culture supernatant was further investigated using ELISA. We found that after 72 h in culture, the secretion of growth factor VEGF and adhesive molecules Eselectin and VCAM-1 increased significantly in microtopographic structure groups except Structure 4. Moreover, the secretion of adhesive molecule ICAM-1 increased significantly in Structure 1 and 2 groups (particularly in the former), compared with the non-patterned structure group (P<0.01, P<0.05; Fig. 6).

Figure 6

Protein factor secreted in the medium of cells growing on silk fibroin of different microstructures was significantly higher than that of the non-patterned structure. Human umbilical vein endothelial cells (HUVECs) were seeded on 4 types of silk fibroin with different microtopographic structures (Str-1, 2, 3 and 4) and one with a non-pattened structure as a control (Ctrl). After incubation for 72 h, the secretion of growth factor and molecular factors was analyzed by ELISA; (A) Eselectin, (B) VEGF, (C) ICAM-1 and (D) VCAM-1. **P<0.01, *P<0.05.

Effect of microtopographic structure of silk fibroin on cell cycle

In line with the cell proliferation results, Fig. 7 shows that, with the exception of Structure 4, the frequency of cells at the S or G1 phase was markedly increased or decreased in the microtopographic structure groups compared to the non-patterned structure group (P<0.01, P<0.05; Table III).

Figure 7

Frequency of cells growing on silk fibroin of different microstructures at the S or G1 phase was markedly increased or decreased compared to that of the non-patterned structure. (A) Human umbilical vein endothelial cells (HUVECs) were seeded on 4 types of silk fibroin with different microtopographic structures (Str-1, 2, 3 and 4) and one with a non-pattened structure as a control (Ctrl). After incubation for 72 h, cells were fixed on ice followed by 70% cold ethanol and stained with propidium iodide. Stained cells underwent cell cycle analysis by flow cytometry. (B) The cell cycle information was analyzed using ModFit3.0 software.

Table III

Cell cycle analysis of HUVECs.

Table III

Cell cycle analysis of HUVECs.

GroupG0/G1 (%)S (%)G2/M (%)
Non-patterned structure46.00±4.5811.88±2.3742.12±2.78
Structure 129.33±8.087.00±1.7663.67±6.36
Structure 233.67±8.026.09±2.0760.24±7.08
Structure 332.00±3.6110.68±3.3557.32±5.58
Structure 451.33±3.518.88±0.7339.79±4.25

[i] HUVECs, human umbilical vein endothelial cells.

Discussion

One of the currently discussed concepts to improve the vascularization of metallic stents is the prevascularization by including vascular ECs. A wide variety of coatings have been explored for stents, targeting the objective to promote endothelialization. The success of such biomaterial is dependent on its ability to support the growth and functioning of the cells growing on it. Prior studies (12,13) showed that silk fibroin had unique properties that fulfill many of the requirements for biomaterial scaffolds and could be used as a coating applied to stent for the culture of human ECs. It was demonstrated that the biophysical environment consisting of microstructures could influence the cellular behavior; however, whether the silk fibroin of different microstructures could support the growth of human ECs and exert effects on endothelial phenotypes or functions have never been discussed.

In this study, silk fibroin of microtopographic structure with four different patterns developed by micromolding were synthesized to evaluate the response of vascular ECs to topographic cues. Laser and UV-based patterning are two prevalent alternative methodologies for engineering and micromolding the surface with specific patterns (18), allowing enhanced resolution despite the higher costs. Of these methods, we adopted the former. We used HUVECs in our experiment since this endothelial cell type is of embryonic origin and of the macrovascular type, whereas ECs involved in inflammation, healing and vascularization are primarily of microvascular origin.

In the present study, we provided quantitative data in order to gain more insight into the effect of the microstructure of silk fibroin on cell growth and further investigated the mechanism of it. The response of HUVECs growing on non-patterned and microtopographic structure silk fibroin scaffolds was compared, with emphasis on cell morphology, proliferation, cell cycle, expression of adhesive molecules and secretion of relevant protein factors.

Our results suggested that the morphology of the HUVECs could be influenced by the microstructure of silk fibroin. It has been reported that cells align along microfeatures in a process resulting from the rearrangement of the cellular cytoskeleton (18,19) and that the cells form cytoplasm extensions and cellular associations over different ridges while populating the groove of the pattern. Cells may have different morphologies on sensing the distinct surface topography and in aggregate, a microtopographic structure would be more helpful to the morphology of the cells than a non-patterned structure.

We also found that silk fibroin of microtopographic structure had positive effects on endothelial cell attachment, with respect to the adhesive molecules expressed intracytoplasm and secreted in the medium, suggesting the potential ability of the cells induced by the microtopographic structure to synthesize, adapt and produce adhesive proteins, to ensure effective adhesion on the surface. In light of the fact that the microstructure influenced the morphology of cells, it is obvious that there is an initial correlation between the attachment and the morphology of cells, which is supported by our observation that cells on silk fibroin of non-patterned structure were round in shape and the substrate demonstrated a low ability to stimulate cell adhesion. However, the mechanism of this requires further investigation.

It is reported that changes in cell shape impacted by the microstructure of the biomaterial have been implicated in alterations in the cell cycle which would directly influence the proliferative state of ECs (20). In our studies, HUVECs demonstrated a significant change in proliferation and cell cycle on the silk fibroin of microstructures compared with that of the non-patterned structure, which was consistent with the morphology of the cells.

Of all the microtopographic structures, the behaviors and inherent phenomena of the cells were particularly influenced by Structure 1, containing arrays of large holes within a flat surface. As most of the cells were inclined to spread along the ridges and grooves of the microtopographic structure, we supposed that an architecture like Structure 1, possessing a great number of large holes, may afford more space for cells to adhere and thus obtain the best advantage. However, the mechanism has to be further investigated.

Acknowledgements

This study was supported by the Fundamental Research Projects fund (no. 09JC1403200) sponsored by the Shanghai Science and Technology Committee.

References

1 

Hinohara T: Percutaneous coronary intervention: current perspective. Keio J Med. 50:152–160. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Alfonso F, Pérez-Vizcayno MJ, Cruz A, García J, Jimenez-Quevedo P, Escaned J and Hernandez R: Treatment of patients with in-stent restenosis. EuroIntervention. 5(Suppl D): D70–D78. 2009.PubMed/NCBI

3 

Thansayari P, Kathir K, Celemajer DS and Adams MR: Endothelial dysfunction and restenosis following percutaneous coronary intervention. Int J Cardiol. 119:362–367. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Bonetti PO, Lerman LO and Lerman A: Endothelial dysfunction: a marker of atherosclerotic risk. Arterioscler Thromb Vasc Biol. 23:168–175. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Kipshidze N, Baker J and Nikolaychik N: Fibrin coated stents as an improved vehicle for endothelial cell seeding. Circulation. 90:I-5971994.

6 

Flugelman MY, Virmani R, Leon MB, Bowman RL and Dichek DA: Genetically engineered endothelial cells remain adherent and viable after stent deployment and exposure to flow in vitro. Circ Res. 70:348–354. 1992. View Article : Google Scholar

7 

Scott NA, Candal FJ, Robinson KA and Ades EW: Seeding of intracoronary stents with immortalized human microvascular endothelial cells. Am Heart J. 129:860–866. 1995. View Article : Google Scholar : PubMed/NCBI

8 

Van der Giessen WJ, Serruys PW, Visser WJ, Verdouw PD, van Schalkwijk WP and Jongkind JF: Endothelialization of intravascular stents. J Intervent Cardiol. 1:109–120. 1988.

9 

Dichek DA, Neville RF, Zwiebel JA, Freeman SM, Leon MB and Anderson WF: Seeding of intravascular stents with genetically engineered endothelial cells. Circulation. 80:1347–1353. 1989. View Article : Google Scholar : PubMed/NCBI

10 

Chen MC, Liang HF, Chiu YL, Chang Y, Wei HJ and Sung HW: A novel drug-eluting stent spray-coated with multi-layers of collagen and sirolimus. J Control Release. 108:178–189. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Thierry B, Winnik FM, Merhi Y, Silver J and Tabrizian M: Bioactive coatings of endovascular stents based on polyelectrolyte multilayers. Biomacromolecules. 4:1564–1571. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Zhang X, Baughman CB and Kaplan DL: In vitro evaluation of electrospun silk fibroin scaffolds for vascular cell growth. Biomaterials. 29:2217–2227. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Wang X, Zhang X, Castellot J, Herman I, Iafrati M and Kaplan DL: Controlled release from multilayer silk biomaterial coatings to modulate vascular cell responses. Biomaterials. 29:894–903. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Altman GH, Diaz F, Jakuba C, Calabro T, Horan RL, Chen J, Lu H, Richmond J and Kaplan DL: Silk-based biomaterials. Biomaterials. 24:401–416. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Diener A, Nebe B, Lüthen F, Becker P, Beck U, Neumann HG and Rychly J: Control of focal adhesion dynamics by material surface characteristics. Biomaterials. 26:383–392. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Karuri NW, Porri TJ, Albrecht RM, Murphy CJ and Nealey PF: Nano- and microscale holes modulate cell-substrate adhesion, cytoskeletal organization, and -beta1 integrin localization in SV40 human corneal epithelial cells. IEEE Trans Nanobioscience. 5:273–280. 2006. View Article : Google Scholar

17 

Jaffe EA, Nachman RL, Becker CG and Minick CR: Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest. 52:2745–2756. 1973. View Article : Google Scholar : PubMed/NCBI

18 

Teixeira AI, Nealey PF and Murphy CJ: Responses of human keratocytes to micro- and nano structured substrates. J Biomed Mater Res A. 71:369–376. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Rebollar E, Frischauf I, Olbrich M, Peterbauer T, Hering S, Preiner J, Hinterdorfer P, Romanin C and Heitz J: Proliferation of aligned mammalian cells on laser-nanostructured polystyrene. Biomaterials. 29:1796–1806. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Roca-Cusachs P, Alcaraz J, Sunyer R, Samitier J, Farré R and Navajas D: Micropatterning of single endothelial cell shape reveals a tight coupling between nuclear volume in G1 and proliferation. Biophys J. 94:4984–4995. 2008.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tan J, Wen J, Shi W, He Q, Zhu L, Liang K, Shao Z and Yu B: Effect of microtopographic structures of silk fibroin on endothelial cell behavior. Mol Med Rep 7: 292-298, 2013.
APA
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K. ... Yu, B. (2013). Effect of microtopographic structures of silk fibroin on endothelial cell behavior. Molecular Medicine Reports, 7, 292-298. https://doi.org/10.3892/mmr.2012.1127
MLA
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K., Shao, Z., Yu, B."Effect of microtopographic structures of silk fibroin on endothelial cell behavior". Molecular Medicine Reports 7.1 (2013): 292-298.
Chicago
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K., Shao, Z., Yu, B."Effect of microtopographic structures of silk fibroin on endothelial cell behavior". Molecular Medicine Reports 7, no. 1 (2013): 292-298. https://doi.org/10.3892/mmr.2012.1127
Copy and paste a formatted citation
x
Spandidos Publications style
Tan J, Wen J, Shi W, He Q, Zhu L, Liang K, Shao Z and Yu B: Effect of microtopographic structures of silk fibroin on endothelial cell behavior. Mol Med Rep 7: 292-298, 2013.
APA
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K. ... Yu, B. (2013). Effect of microtopographic structures of silk fibroin on endothelial cell behavior. Molecular Medicine Reports, 7, 292-298. https://doi.org/10.3892/mmr.2012.1127
MLA
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K., Shao, Z., Yu, B."Effect of microtopographic structures of silk fibroin on endothelial cell behavior". Molecular Medicine Reports 7.1 (2013): 292-298.
Chicago
Tan, J., Wen, J., Shi, W., He, Q., Zhu, L., Liang, K., Shao, Z., Yu, B."Effect of microtopographic structures of silk fibroin on endothelial cell behavior". Molecular Medicine Reports 7, no. 1 (2013): 292-298. https://doi.org/10.3892/mmr.2012.1127
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team