Differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes using chondrocyte extract

  • Authors:
    • Xinjie Tang
    • Lingling Sheng
    • Feng Xie
    • Qun Zhang
  • View Affiliations

  • Published online on: July 19, 2012     https://doi.org/10.3892/mmr.2012.996
  • Pages: 745-749
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Reprogramming cells using cell extracts is an effective method for harvesting cells of interest. The aim of this study was to investigate the chondrogenic transdifferentiation potential of swine bone marrow-derived mesenchymal stem cells (BM-MSCs) by culturing with chondrocyte extract, using monolayer and micromass culture. Chondrogenic-specific markers were detected via reverse transcription-polymerase chain reaction (RT-PCR) and immunofluorescence. After 7 days of induction in monolayer culture, BM-MSCs reversibly permeabilized with streptolysin O (SLO), a bacterial exotoxin that is capable of forming large pores in the plasma membrane of mammalian cells, and expressed chondrocyte‑specific genes such as type II collagen (COL II) and aggrecan. A positive protein expression of COL II was also observed. However, BM-MSCs treated without SLO did not express the related genes and proteins. The transition of reprogrammed BM-MSCs was lost 14 days later. By using micromass culture, reprogrammed BM-MSCs were able to maintain the change until the 14th day. In summary, permeabilized BM-MSCs were transiently transdifferentiated into chondrocytes by co-culturing with the chondrocyte extract. Moreover, a high-density culture method was able to increase the time in which the phenotypic change was maintained.

Introduction

Transplantation of autogenous or allogenous chondrocytes has been used to repair defective cartilage. However, the limited sources for a sufficient number of chondrocytes restricts the development and clinical application of chondrocyte-based therapies (1). Therefore, finding an effective method to collect ‘target cells’ is crucial.

Increasing evidence has shown that an extract harvested from one type of differentiated somatic cell is capable of altering another cell phenotype in vitro, a method of reprogramming that has developed in recent years (25). This method was first introduced by Hakelien et al (2). Those authors found that 293T cells permeabilized with streptolysin O (SLO) exposed to a T-cell extract were capable of adopting T cell-specific properties, such as expressing T cell-specific receptors and assembling the interleukin-2 receptor. Supported by a number of studies, use of this method suggests that altering cell fate using cell extract is feasible and effective, and may be applied to multiple cell types.

The most common cells used as ‘donor cells’, which receive another cell extract and differentiate into ‘target cells’, are fibroblasts and adult stem cells, as they can be harvested easily and exhibit marked proliferative capacity. Compared with fibroblasts, adult stem cells have a broad prospect of application as a result of their potential of multi-directional differentiation into cells including adipocytes, osteoblasts and chondrocytes in response to lineage-specific induction factors (6,7). Bone marrow-derived mesenchymal stem cells (BM-MSCs), widely used in regenerative medicine, have also been successfully induced into chondrocytes by the induction of growth factors (8,9), co-culturing with chondrocytes (10,11) or low-intensity ultrasound (12).

The aim of this study was to observe whether chondrocyte extract induced the differentiation of BM-MSCs into chondrocytes in a monolayer culture. Moreover, we investigated whether the maintenance time of phenotypic alteration could be prolonged and whether cells were able to produce cartilage-specific extracellular matrix (ECM) components when cultured at a high density.

Materials and methods

Animals

All animal procedures in this study were approved by Shanghai Jiaotong University Medical Center, Institutional Animal Care and Use Committee. The animals were maintained in a specific pathogen-free environment. The surgical procedures were performed under aseptic conditions.

BM-MSC preparation

Swine bone marrow was obtained from the posterior superior iliac crest of newborn pigs. Briefly, after washing twice in phosphate-buffered saline (PBS; Gibco-BRL, Grand Island, NY, USA) to remove red cell fragments, cells were resuspended in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) with low glucose plus 10% fetal bovine serum (FBS; Gibco) and plated in 100 mm2 culture dishes at a density of 2.0×105 cells/cm2 at 37°C with 5% CO2. Non-adherent cells were removed by medium change after 5 days. The adherent cells were collected when >80% confluence was achieved and then subcultured. BM-MSCs at passage 2 were used for subsequent experiments.

Chondrocyte isolation and culture

The swine articular cartilage was cut into 2×2 mm slices and washed twice with PBS. After being digested with 0.25% trypsin plus 0.02% EDTA at 37°C for 30 min, the cartilage slices were further digested with 0.1% collagenase II in serum-free DMEM at 37°C for 12–16 h. Chondrocytes were then harvested, counted and seeded into culture dishes at a cell density of 2.5×104/cm2 for the culture and subculture in DMEM with high glucose and 10% FBS. Chondrocytes at passage 1 were used in this study.

Chondrocyte extract

After being harvested, chondrocytes at passage 1 were washed in Ca2+- and Mg2+-free Hank’s balanced salt solution (HBSS, Sigma, St. Louis, MO, USA) twice and cell lysis buffer (100 mM HEPES, pH 8.2, 50 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol and protease inhibitors), sedimented at 1,000 rpm, resuspended in 0.8 ml cold cell lysis buffer and incubated for 50 min on ice. Cells were sonicated on ice in 200 μl aliquots using a sonicator fitted with a 3-mm diameter probe until the cells and nuclei were lysed, as judged by microscopy. The lysate was sedimented at 15,000 rpm for 15 min at 4°C to pellet the coarse material. The supernatant was aliquoted, frozen in liquid nitrogen and stored at −80°C. The protein concentration of the extract was determined by the Bradford assay. In this study, the chondrocyte extract contained 10–15 mg/ml protein.

Streptolysin O-mediated permeabilization and cell extract treatment

BM-MSCs were washed in cold PBS and in cold HBSS. Cells were resuspended in SLO solution at a concentration of 100 cells/μl with a SLO concentration of 230 ng/ml. Samples were incubated in an H2O bath for 50 min at 37°C with occasional agitation. Cells were then collected by sedimentation at 1,800 rpm for 5 min at 37°C. A permeabilization efficiency of >60% was obtained, as assessed by monitoring the uptake of propidium iodide (PI).

Following permeabilization, cells were resuspended at 1000 cells/μl in 100 μl cell extract containing an ATP- regenerating system and 1 mmol/l of each NTP. Cells were cultured for 1 h at 37°C with occasional agitation. To reseal the cells, cell suspension with cell extract was diluted with DMEM containing 2 mM CaCl2 and cultured for 2 h at 37°C. The supernatant was discarded, fresh DMEM containing no CaCl2 was added and cells were cultured until use. According to the different treatments, there were 4 groups: SLO treatment(+) cell extract(+) group; SLO treatment(−) cell extract(+) group; SLO treatment(−) cell extract(−) group; and chondrocyte group, which was regarded as a positive control.

Immunofluorescence

Immunofluorescence analysis was performed on the seventh day. The cells were fixed with 4% paraformaldehyde for 15 min. The fixed specimens were washed and incubated with primary anti-collagen type II (COL II) monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in 0.5% bovine serum albumin (BSA) at 4°C overnight and then washed and incubated with secondary antibody for 30 min at 37°C. DAPI was used as a nuclear counterstain. Images were captured on a NIKON microscope using IPP software.

Transcription analysis

Reverse transcription-polymerase chain reaction (RT-PCR) was performed on the seventh day using the primers: COL II: forward (5′-3′): GATGGGCAGAGGTATAATGAT and reverse (5′-3′): CTTTTTCACCTTTGTCACCAC (product size, 322 bp); aggrecan: forward (5′-3′): ATGACTCTGGGATCTATCGCT and reverse (5′-3′): CGTAGGTCTCATTGGTGTCA-3 (product size, 352 bp); GADPH: forward (5′-3′): ACATCAAGGAGAAGCTCTGCTACG and reverse (5′-3′): GAGGGGCGATGATCTTGATCTTCA (product size, 366 bp). The reactions were performed in a T3 thermocycler (Biometra, Goettingen, Germany). The amplified products were separated on 1.5% agarose gels and visualized by ethidium bromide (Sigma-Aldrich).

Chondrogenic differentiation of treated-BM-MSCs in micromass culture

Based on the results obtained above, micromass culture was performed. Briefly, reversibly permeabilized BM-MSCs with added cell extract were collected by resuspension at a density of 2.0×107 cells/ml in the growth medium. The cell suspension was then spotted in 15 μl drops into dishes. The cells were incubated for 2 h at 37°C to allow attachment and then maintained in the complete medium until day 14. The specimens were then embedded in paraffin and cut into 10 μm sections. The sections were stained with hematoxylin and eosin (H&E) and toluidine blue to reveal the histological structure and chondroitin sulfate deposition, which is a substance in cartilage matrix, respectively. The expression of COL II was detected using mouse anti-pig monoclonal antibody (1:100 in 0.5% BSA, Santa Cruz Biotechnology), followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibody (1:500 in PBS, Santa Cruz Biotechnology) and color development with diaminobenzidine tetrahydrochloride (DAB, Santa Cruz Biotechnology).

Results

Reversible permeabilization of BM-MSCs

In this study, BM-MSCs were treated with various concentrations of SLO (230, 300 and 400 ng/ml, respectively) and the proliferative ability of cells was detected. Results showed that an enhanced SLO concentration slightly increased permeabilization, however, a marked decrease was observed in the proliferative ability of cells (data not shown). SLO (230 ng/ml) was used, as a permeabilization efficiency of >55% was obtained and it was proven to be least detrimental (Fig. 1).

Exposure of BM-MSCs to the chondrocyte extract leads to the induction of chondrocyte-specific genes and protein

Chondrocytes were sonicated and observed under a microscope, which revealed that there was no cell and nucleus structure (Fig. 2). Consistent with the uptake of PI, following exposure of BM-MSCs to the chondrocyte extract in an ATP-regeneration 7 days later, cells treated with SLO-expressed chondrocyte-specific genes such as COL II and aggrecan on the seventh day (Fig. 3). The immunofluorescent staining revealed that reprogrammed BM-MSCs were positive for COL II (Fig. 4); whereas, no changes were observed in intact (non-permeabilized) BM-MSCs. However, at 14 days, there was no relevant expression.

Maintenance of the chondrogenic phenotype of reprogrammed BM-MSCs in micromass culture

Previous investigations have demonstrated that a high density culture manner, such as micromass or pellet culture, is essential for the chondrogenic differentiation of BM-MSCs. Using monolayer culture, examinations could not detect relevant chondrocyte-specific expression 14 days after cell treatment. Thus, to maintain the chondrogenic differentiation of reprogrammed BM-MSCs, micromass culture was used in this study. When the induction time was extended to 14 days, the cells in the cell mass formed a lacunae structure with chondrocyte-like cells located inside secreting chondroitin sulfate. The expression of COL II was also observed in the cell mass (Fig. 5).

Discussion

Cell extract-based systems for reprogramming cell fate have been developed with the aim of eliciting somatic cell transdifferentiation or dedifferentiation. Previous studies have demonstrated that cell extracts harvested from embryonic stem cells (ESCs) (13) or somatic cells (3) are capable of inducing nuclear de-/transdifferentiation of ‘donor cells’. The current study provided permeabilized BM-MSCs with the chondrocyte extract and observed changes in the gene and protein expression following cell culture. A high-density culture method was also found to prolong the maintenance time of the phenotype change of reprogrammed cells.

The main component of the cell extract was thought to be protein, as heat-treated (95°C, 5 min) extracts were not able to induce any changes (3,5). In this study, the cell extract was obtained using cell lysis and ultrasonic homogenization. By this method, the protein molecular weight varies within a wide range. To enable the cell extract to enter ‘donor cells’ effectively, BM-MSCs were treated with SLO as described previously (2,3). Following the binding of SLO to membranes, toxin monomers diffuse laterally in the bilayer and oligomerize to form homotypic aggregates that represent large transmembrane pores whose diameters may reach 35 nm, allowing molecules <100 kDa to enter the cell cytosol (1416). In the presence of Ca2+, the permeabilized cells were resealed for subsequent culture. This finding was consistent with other authors who reported that resealing was temperature-independent and even occurred eat 4°C (14).

Findings of previous studies have shown that a rapid gene change may be induced over a 1–8 h culture (17) and that these genes would consistently persist up to days 7–10 (3,18). In our study, no gene alteration was evident on day 3. However, 7 days later, a clear expression of COL II and aggrecan, the two main chondrogenic gene markers, was demonstrated by RT-PCR analysis in the group of permeabilized BM-MSCs in the presence of the cell extract. Consistent with gene change, COL II protein expression was also positive in this group. These results suggested that exposure to the chondrocyte extract initiated a series of changes driving BM-MSCs cultured in a monolayer towards chondrocyte-like cells 7 days after treatment. No changes were observed in intact (non-permeabilized) BM-MSCs incubated in chondrocyte extract. These results are consistent with those of Taranger et al (19) and Bru et al (17), but not with those by Hansis et al (20). However, no changes were detected on day 14. In addition to this finding, the percentage of permeabilized cells in this study was over 55% and was discrepant with COL II-positive cells. There are various reasons for this finding: i) A low concentration of cell extract leads to incomplete transdifferentiation; ii) preferential growth of BM-MSCs inhibits the proliferation of successfully reprogrammed BM-MSCs; iii) the culturing method makes the chondrogenic microenvironment deficient and iv) the changes were transient and could not be detected at the 14th day.

Considering the fact that chondroadherin interaction with cells may be crucial for maintaining the adult chondrocyte phenotype and cartilage homeostasis, cell-cell contact may be responsible for the reprogramming (21). Fourteen days after micromass culture, the cells presented a crumb structure. H&E staining showed cells in the crumb presenting lacunae structure with chondroitin sulfate and were COL II-positive. This suggests that cytokines secreted by BM-MSC-converted chondrocytes are likely to constantly induce BM-MSCs towards chondrocytes.

The main regulatory component involved in the cell extract was believed to initiate a transcriptional program specific for the alteration (3). Hakelien et al (2) observed the import of transcription factors into 293T nuclei in their study. At the same time, demethylation of the target cell-specific gene promoter and histone acetylation were also observed (3,5,13,17).

Cell reprogramming is of interest for the development of novel cellular therapeutics and is potentially useful for producing isogenic replacement cells for the treatment of a wide variety of diseases. The incomplete transcriptional and epigenetic reprogramming may not lead the cells harvested in this manner to be totally the same as the ‘target’ cells, but own some of the desired functions of the ‘target’ cells. To a certain degree, it is sufficient for cell programming to exhibit the necessary therapeutic properties without complete alteration of genes, protein and functions. For example, rat fibroblasts reversibly permeabilized with SLO and exposed to extract of an insulin-producing β cell line were capable of secreting insulin on day 5 (3). For diabetes care, it is sufficient to harvest cells able to secrete insulin.

Since only this alteration is detectable, it indicates a limitation of our study. Thus, the relevant mechanism involved in this process and the methods of increasing efficiency and the maintenance time of reprogramming should be investigated.

In conclusion, this study has shown that reversibly permeabilized BM-MSCs were differentiated into chondrocytes when they were co-cultured with the chondrocyte extract. SLO plays a key role, but not dependently, in the reprogramming process and it sets the stage for the further action of more essential components in the cell extract. Nevertheless, culturing cells with a high-density protocol is likely to prolong the phenotypic changes of differentiated cells. The method used in this study provides tissue engineering with a novel way of obtaining seeding cells.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (Nos. 30900308 and 81071580).

References

1 

Wong CC, Chiu LH, Lai WF, et al: Phenotypic re-expression of near quiescent chondrocytes: The effects of type II collagen and growth factors. J Biomater Appl. 25:75–95. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Hakelien AM, Landsverk HB, Robl JM, Skalhegg BS and Collas P: Reprogramming fibroblasts to express T-cell functions using cell extracts. Nat Biotechnol. 20:460–466. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Hakelien AM, Gaustad KG and Collas P: Transient alteration of cell fate using a nuclear and cytoplasmic extract of an insulinoma cell line. Biochem Biophys Res Commun. 316:834–841. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Gaustad KG, Boquest AC, Anderson BE, Gerdes AM and Collas P: Differentiation of human adipose tissue stem cells using extracts of rat cardiomyocytes. Biochem Biophys Res Commun. 314:420–427. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Miyamoto K, Furusawa T, Ohnuki M, et al: Reprogramming events of mammalian somatic cells induced by Xenopus laevis egg extracts. Mol Reprod Dev. 74:1268–1277. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Wu Y, Chen L, Scott PG and Tredget EE: Mesenchymal stem cells enhance wound healing through differentiation and angiogenesis. Stem Cells. 25:2648–2659. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Li H, Zan T, Li Y, et al: Transplantation of adipose-derived stem cells promotes formation of prefabricated flap in a rat model. Tohoku J Exp Med. 222:131–140. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Pittenger MF, Mackay AM, Beck SC, et al: Multilineage potential of adult human mesenchymal stem cells. Science. 284:143–147. 1999. View Article : Google Scholar : PubMed/NCBI

9 

Indrawattana N, Chen G, Tadokoro M, et al: Growth factor combination for chondrogenic induction from human mesenchymal stem cell. Biochem Biophys Res Commun. 320:914–919. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Thompson AD, Betz MW, Yoon DM and Fisher JP: Osteogenic differentiation of bone marrow stromal cells induced by coculture with chondrocytes encapsulated in three-dimensional matrices. Tissue Eng Part A. 15:1181–1190. 2009. View Article : Google Scholar

11 

Liu X, Sun H, Yan D, et al: In vivo ectopic chondrogenesis of BMSCs directed by mature chondrocytes. Biomaterials. 31:9406–9414. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Lee HJ, Choi BH, Min BH, Son YS and Park SR: Low-intensity ultrasound stimulation enhances chondrogenic differentiation in alginate culture of mesenchymal stem cells. Artif Organs. 30:707–715. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Rajasingh J, Lambers E, Hamada H, et al: Cell-free embryonic stem cell extract-mediated derivation of multipotent stem cells from NIH3T3 fibroblasts for functional and anatomical ischemic tissue repair. Circ Res. 102:e107–e117. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Walev I, Bhakdi SC, Hofmann F, et al: Delivery of proteins into living cells by reversible membrane permeabilization with streptolysin-O. Proc Natl Acad Sci USA. 98:3185–3190. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Palmer M, Vulicevic I, Saweljew P, Valeva A, Kehoe M and Bhakdi S: Streptolysin O: a proposed model of allosteric interaction between a pore-forming protein and its target lipid bilayer. Biochemistry. 37:2378–2383. 1998. View Article : Google Scholar : PubMed/NCBI

16 

Palmer M, Harris R, Freytag C, Kehoe M, Tranum-Jensen J and Bhakdi S: Assembly mechanism of the oligomeric streptolysin O pore: the early membrane lesion is lined by a free edge of the lipid membrane and is extended gradually during oligomerization. EMBO J. 17:1598–1605. 1998. View Article : Google Scholar

17 

Bru T, Clarke C, McGrew MJ, Sang HM, Wilmut I and Blow JJ: Rapid induction of pluripotency genes after exposure of human somatic cells to mouse ES cell extracts. Exp Cell Res. 314:2634–2642. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Miyamoto K, Tsukiyama T, Yang Y, et al: Cell-free extracts from mammalian oocytes partially induce nuclear reprogramming in somatic cells. Biol Reprod. 80:935–943. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Taranger CK, Noer A, Sorensen AL, Hakelien AM, Boquest AC and Collas P: Induction of dedifferentiation, genomewide transcriptional programming, and epigenetic reprogramming by extracts of carcinoma and embryonic stem cells. Mol Biol Cell. 16:5719–5735. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Hansis C, Barreto G, Maltry N and Niehrs C: Nuclear reprogramming of human somatic cells by Xenopus egg extract requires BRG1. Curr Biol. 14:1475–1480. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Yin S, Cen L, Wang C, et al: Chondrogenic transdifferentiation of human dermal fibroblasts stimulated with cartilage-derived morphogenetic protein 1. Tissue Eng Part A. 16:1633–1643. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October 2012
Volume 6 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Tang X, Sheng L, Xie F and Zhang Q: Differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes using chondrocyte extract. Mol Med Rep 6: 745-749, 2012
APA
Tang, X., Sheng, L., Xie, F., & Zhang, Q. (2012). Differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes using chondrocyte extract. Molecular Medicine Reports, 6, 745-749. https://doi.org/10.3892/mmr.2012.996
MLA
Tang, X., Sheng, L., Xie, F., Zhang, Q."Differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes using chondrocyte extract". Molecular Medicine Reports 6.4 (2012): 745-749.
Chicago
Tang, X., Sheng, L., Xie, F., Zhang, Q."Differentiation of bone marrow-derived mesenchymal stem cells into chondrocytes using chondrocyte extract". Molecular Medicine Reports 6, no. 4 (2012): 745-749. https://doi.org/10.3892/mmr.2012.996