Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro

  • Authors:
    • Bohan Yu
    • Zuolin Wang
  • View Affiliations / Copyright

    Affiliations: Center of Implant Dentistry, Hospital of Stomatology, Tongji University, Shanghai 200092, P.R. China
    Copyright: © Yu et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 235-242
    |
    Published online on: October 24, 2013
       https://doi.org/10.3892/mmr.2013.1756
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Identifying a reliable and effective cytokine or growth factor group has been the focus of stem cell osteogenic induction studies. Concentrated growth factors (CGFs) as the novel generation of platelet concentrate products, appear to exhibit a superior clinical and biotechnological application potential, however, there are few studies that have demonstrated this effect. This study investigated the proliferation and differentiation of periodontal ligament stem cells (PDLSCs) co‑cultured with CGFs. The rate of proliferation was analyzed by cell counting and an MTT assay. Mineralization nodule counts, alkaline phosphatase activity detection, qPCR, western blot analysis and immunohistochemistry were used to analyze mineralization effects. The results showed that CGF significantly promoted the proliferation of PDLSCs, and exhibited a dose‑dependent effect on the activation and differentiation of the stem cells. The application of CGF on PDLSC proliferation and osteoinduction may offer numerous clinical and biotechnological application strategies.

Introduction

The increased lifespan of human beings has led to the development of novel therapeutic strategies aiming to preserve aged tissue, which range from the replacement of lost or injured tissues to regeneration of the damage tissue (1). Regenerating alveolar bone as an alternative therapy for periodontal regeneration has been increasingly used in dentistry. A deficient alveolar ridge not only fails to provide sufficient support and retention for teeth or dentures, but also hinders dental implant placement (2). The finding of stem cells was a medical breakthrough and led to the novel field of medicine entitled regenerative medicine (3). Postnatal stem cells have been isolated from various tissues, including dental tissue (4). Seo et al suggested that the human periodontal ligament (PDL) contains a population of postnatal multipotent stem cells (5). Stem cells require specific microenvironments for survival (6), thus, in theory periodontal ligament stem cells (PDLSCs) are the most direct and reliable source for periodontal tissue regeneration. Although PDLSCs are easy to separate and purify, the number of cells required for bone regeneration is unachievable in a short period of time. After several passages, it is difficult to induce the differentiation of cells that are prone to aging and changes in phenotype (7,8). Thus, an effective way to rapidly amplify PDLSCs is a current focus of numerous studies.

Growth factors stimulate the differentiation of mesenchymal cells into osteoblasts and accelerate the osteogenesis of these cells. The growth factors that are known to be associated with bone formation are bone morphogenetic protein (BMP), transforming growth factor (TGF), platelet-derived growth factor (PDGF), insulin-like growth factor (IGF), and epidermal growth factor (EGF) (9–11). When these growth factors are used alone, there are often certain shortcomings. For example, when using BMP-2 alone, it has a short half-life and is susceptible to proteolytic degradation. When the concentration is too high, it may lead to tissue edema, an increased inflammatory response, and prevention of novel bone formation (12–14). In addition, the human body is a complex biological environment; thus, stem cell osteogenic differentiation is not regulated by one growth factor alone. Therefore, it is essential to identify an autologous source and effective cytokine or growth factor group in stem cell osteogenic induction studies. Platelet-rich plasma (PRP) (15), a platelet concentrate product, contains numerous growth factors. Previously, it was demonstrated that the PRP may induce proliferation, but inhibits the differentiation of PSLSCs (16). The application of PRP has also been controversial as the addition of dissimilar thrombin and anticoagulant during preparation may pose risks of immune rejection and transmission of infectious diseases. The platelet-rich fibrin (PRF), the second generation of platelet concentrate products (17), exhibits the same properties as PRP with the advantages of an osteogenic ability, a simple preparation process, and lack of added biological agents, as it is produced from autologus blood. Concentrated growth factors (CGF) were developed by Sacco in 2006. It is produced by a centrifuge device (Medifuge Silfradent srl, Italy), similar to the production of PRF (18). The different centrifugation speed permits the isolation of fibrin matrix that is markedly larger, denser and richer in growth factors as compared to PRF. In theory, CGFs appear to exhibit superior clinical and biotechnological application potential (19); however, there are few studies supporting this.

The aim of this study was to analyze the in vitro biological effects of CGFs on the proliferation and differentiation of canine PDLSCs, and to investigate whether this effect occurs in a dose-dependent manner.

Materials and methods

Isolation of beagle PDLSCs and preliminary identification

One healthy beagle dog (18 months old, 14.5 kg, male) was supplied by the Laboratory Center of the Second Military Medical University of the Chinese PLA (No. SCXK-Shanghai 2012–0003). The entire experimental procedure was in accordance with the Regulations of the Administration of Affairs Concerning Experimental Animals formulated by the Ministry of Science and Technology of China. Beagle PDLSCs were isolated and cultured as described previously (4,20,21). Briefly, periodontal ligament tissues were scraped from the intermediate 1/3 of the root. Collagenase type I (3 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) and dispase II (4 mg/ml; Roche, Basel, Switzerland) were added at a 1:1 mixture and digested for 1 h at 37ºC. The mixture was passed through a 70 μm cell sieve (BD Biosciences Franklin Lakes, NJ, USA), using α-minimal essential medium (MEM) containing 15% fetal bovine serum (FBS) to adjust the cell density to 1×104/ml. The cells were then incubated in a 5% CO2 atmosphere at 37ºC. Following expansion, the STRO-1+ cells (Biolegend, San Diego, CA, USA) were separated by flow cytometry. The cells were then inoculated on α-MEM growth medium (Gibco-BRL, Carlsbad, CA, USA) containing 20% FBS (Gibco), 2 mM L-glutamine, 100 μM L-ascorbate-2-phosphate, 1 mM sodium pyruvate, 50 U/ml penicillin and 50 μg/ml streptomycin (21). The logarithmic growth phase cells underwent osteogenic, chondrogenic and adipogenic multi-induction experiments, and the induced cells were stained on day 21 with Alizarin Red S (Sigma-Aldrich), Alcian blue (Sigma-Aldrich) and Oil Red O (Sigma-Aldrich) accordingly.

CGF preparation

It was essential to use cultured PDLSCs and CGFs from the same donor. Under sterilized conditions, venous blood was drawn from the beagle forearm, divided into sterile Vacuette tubes (1 and 3 ml samples in each tube, respectively) without anticoagulants and immediately placed in a centrifuge for centrifugation. The built-in program was: 30″ acceleration, 2′ 408 × g, 4′ 323 × g, 4′ 408 × g, 3′ 3,000 rpm, and 36″ deceleration and stop. The fresh whole blood was divided into three layers (Fig. 1A). The intermediate filament protein gel layer was collected and pressed onto membranous film (MF200, Wisdom, Beijing, China; Fig. 1B).

Figure 1

CGFs were prepared with (A) 1 and 3 ml fresh whole blood and CGFs were pressed into (B) membranous film. (C) Primary PDLCs were obtained from beagle periodontal ligament; and (D) STRO-1+ PDLSCs were isolated by a flow cytometry. (E) The separation rate by flow cytometry was 1.7%. PDLSCs were divided into osteogenic, chondrogenic and adipogenic induction groups and stained by (F) Alizarin Red S, (G) Alcian blue and (H) Oil Red O. The result showed a positive reaction. CGFs, concentrated growth factors; PDLCs, periodontal ligament stem cells.

Experimental groups

There were 6 groups used in the present study, the standard group (0 CGF), standard group + 1 CGFs (prepared with 1 ml fresh whole blood), standard group + 3 CGFs (prepared with 3 ml whole blood), osteogensis induced fluid (0 CGFs), osteogensis induced fluid + 1 CGF and osteogensis induced fluid + 3 CGFs. CGFs were added on the first day and experimental check points were at days 3 (D3), 7, 14 and 21 following inoculation.

The standard culture medium was composed of α-MEM growth medium as described previously. The osteogenic medium (21) was composed of α-MEM supplemented with 10% FBS, 2 mM L-glutamine, 100 μM L-ascorbate-2-phosphate, 10−7 M dexamethasone, 1.8 mM inorganic phosphate (KH2PO4), 50 U/ml penicillin and 50 μg/ml streptomycin.

Cell growth and proliferation analysis

PDLSC proliferation increased following CGF treatment and was analyzed by cell counting and an MTT assay. The absorbance value of each well was measured at 490 nm by the microtiter analyzer (Multiskan FC; Thermo, Vantaa Finland). According to the measured OD values, with time as the x-axis and absorbance value as the y-axis, the cell growth curve was plotted.

Osteoinduction assessment

The mineralized nodules were counted by Alizarin Red S (Sigma-Aldrich, St. Louis, MO, USA) staining and mineralized nodule formation was observed under the microscope (BX43; Olympus, Tokyo, Japan).

Alkaline phosphatase (ALP) activity detection was conducted using a commercialized reagent cartridge (?, USA) at each experimental check point and was analyzed in the microtiter analyzer at OD 405 nm. The ALP activity was expressed as nU/cell and mU/plate.

qPCR was conducted using TRIzol reagent to extract RNA, and using a reverse transcription kit (Takara, Tokyo, Japan) to synthesize cDNA. Primers are listed in Table I. A two-step amplification response procedure was selected with specifications of 95ºC for 120 sec, 95ºC for 15 sec and 61ºC for 40 sec for 40 cycles.

Table I

List of primers.

Table I

List of primers.

GeneSequences (5′-3′)
BSPF: CGATTTCCAGTTCAGAGCAGTAGT
R: CAGCGTCGGATTCATCTTCAT
CollagenI F: TGGGGCAAGACAGTGATCG
R: GGAGGGAGTTTACAGGAAGCAG
OCNF: GCTGTGGCCGCACTCTGC
R: AGAGTGGGGCTGGCCGCTC
GAPDHF: AAGGTCGGAGTCAACGGATTT
R: GGTTCACGCCCATCACAAA

[i] BSP, bone sialoprotein 2; OCN, osteocalcin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

For the western blot analysis, RIPA lysis buffer was added, homogenated and centrifuged and the protein supernatant was collected for sodium dodecyl sulphate-polyacrylamide gel electrophoresis. The proteins were transferred to nitrocellulose membranes, sealed and incubated with primary [BSP (Abcam, Cambridge, MA, USA), Col-I (Abcam) and OCN (Abcam)] and secondary antibodies (ZSGB-Bio, Beijing, China). The membranes were washed and immunoblot chemiluminescence detection reagents (enhanced chemiluminescence, ECL), were used for exposure. Glyceraldehyde 3-phosphate dehydrogenase protein served as a system internal reference and stripe gray values were measured. The results were compared based on the differences in the expression of purpose/internal reference ratio.

For immunohistochemical detection, cell climbing film was produced, sealed and incubated with primary and secondary antibodies. DAB, chromogenic and hematoxylin staining was conducted, and the samples were sealed and observed under the microscope.

Statistical analysis

Cell count, ALP activity, mineralized nodule numbers and the positive expression rate of immunohistochemical staining were presented as the mean ± SE and compared with the control group.

For the MTT assay, the survival capacity of the control group was set as 100%. The experimental groups were calculated as percentages of the control group. P<0.05 was considered to indicate a statistically significant difference.

Relative quantification of qPCR results were obtained using the comparative Ct method. According to the equation Fold = 2−ΔΔCt, the differences in the relative expression of the target gene of the experimental and control groups were calculated.

Western blot analysis results of three experiments were compared with the protein expression differences by scanning the striped gray value.

Results

Cell culture, activity and proliferation

Flow cytometry was used to screen PDLSCs (Fig. 1D) from PDLCs (Fig. 1C); the separation rate was 1.7% (Fig. 1E). To assess the differentiation capacity of PDLSCs, the separated PDLSCs were divided into osteogenic, chondrogenic and adipogenic induction groups. The cells were then stained by Alizarin Red S (Fig. 1F), Alcian blue (Fig. 1G) and Oil Red O (Fig. 1H). The results showed a positive reaction which indicated that the PDLSCs exhibited stem cell-specific differentiation ability.

Fig. 2A shows the proliferation effects of CGFs on PDLSCs. CGFs were identified to increase PDLSC proliferation in a time- and dose-dependent manner (P<0.05), and a significant increase appeared at 14 day. From the MTT assay, in standard culture conditions, the stimulation of proliferation ranged from 178 to 189% with 1 CGF and from 198 to 330% with 3 CGF (Fig. 2B). The stimulation level was stable with 1 CGF, but the cell activity peaked on day 7 with 3 CGF. The cultures with 3 CGF were more strongly stimulated compared with those with 1 CGF (P<0.05) at least up to 14 days. In the osteogenic medium, the stimulation of proliferation ranged between 178 and 196% with 1 CGF and between 201 and 292% with 3 CGF (Fig. 2B). The stimulation level was stable with 1 and 3 CGF. In addition, it was observed that the cultures with 3 CGF were more strongly stimulated than those with 1 CGF (P<0.05) throughout the experimental period.

Figure 2

(A) Proliferation assessment of beagle PDLSCs in six different experimental conditions and at four experimental times. (B) MTT assay results of the test groups are expressed as mean percentages of the control. (C) Alkaline phosphatase activity quantification (nU/cell), and (D) the numeration of critical sized mineralization nodules in beagle PDLSCs cultures in six different experimental conditions. Relative expression of BSP, collagen I and OCN with osteogenesis-induced fluid based on (E) qPCR, (F and H) western blot analysis and (G) immunohistochemistry. Results are expressed as the mean ± SD. PDLSCs, periodontal ligament stem cells; BSP, bone sialoprotein 2; OCN, osteocalcin.

Osteoinduction

ALP activity detection and mineralized nodule counts were performed to determine the effect of CGFs on the induction of osteogenic differentiation of PDLSCs cells. ALP activity was detected on days 3, 7, 14 and 21, and mineralized nodule counts were conducted on days 14 and 21. In the presence of 1 or 3 CGFs, the ALP activities (Fig. 2C) and the number of mineralized nodules (Fig. 2D) were significantly higher (P<0.05) than the values of the respective control groups, and stimulation of differentiation was significantly higher (P<0.05) with 3 CGF than with 1 CGF, regardless of the culture conditions.

The experiments performed showed that the CGFs exhibits a significant positive effect on PDLSC cell morphology due to osteogenic induction and differentiation. To the best of our knowledge, no previous study has investigated this event at the molecular level. In the present study, qPCR analysis was used to detect the expression of bone sialoprotein 2 (BSP), collagen I and osteocalcin (OCN) of different groups at each experimental check point during osteogenic induction. In Fig. 2E, the mRNA expression level of BSP showed an increasing trend along with the increasing quantity of CGF added (P<0.05). In addition, as the culture time increased, BSP mRNA expression was increased, however, it showed no significant increase for the first 7 days (P>0.05) and then significantly increased on day 14 (P<0.05). OCN and collagen I mRNA expression also showed the same increasing trend following CGF addition.

Furthermore, western blot analysis was used to analyze cell growth on the protein level. As shown in Fig. 2F, CGFs were observed to upregulate BSP protein expression in PDLSCs during the culture period (P<0.05). The quantitative measurement is shown in Fig. 2G. BSP protein expression in cells cultured in osteogenic medium was significantly increased with 3 CGF (P<0.05) on day 7 and 21 compared with 1 CGF. Collagen I protein expression levels also increased in a time- and dose-dependent manner, and peaked on day 14 (P<0.05). The OCN protein expression levels increased with time and peaked at day 21 (P<0.05).

Furthermore, immunohistochemical analysis of the flag factor BSP, collagen I and OCN protein expression was also performed during the osteogenic induction process at different experimental check points in all the experimental groups. As shown in Figs. 3–5, BSP, collagen I and OCN-positive expression, respectively, occurred at day 7 when co-cultured with CGF; however, the control group showed a positive expression at day 14. The results indicated that BSP, collagen I and OCN-positive expression increased (Fig. 2H) in a time- and dose-dependent manner (P<0.05).

Figure 3

Relative expression of bone sialoprotein 2 BSP with osteogenesis-induced fluid observed by immunohistochemical analysis. DAB, chromogenic and hematoxylin staining was conducted. Bar, 100 μm. CGFs, concentrated growth factors.

Figure 5

Relative expression of osteocalcin with osteogenesis-induced fluid observed by immunohistochemical analysis. DAB, chromogenic and hematoxylin staining was conducted. Bar, 100 μm. CGFs, concentrated growth factors.

Discussion

Adult stem cells are specific to adult tissues and organs. Under normal circumstances, the majority of the cells are in a resting state; however, damage to body tissues stimulates differentiation of the stem cells in the tissue. The stem cells differentiate into the damaged tissue cells and are involved in tissue repair and reconstruction. Therefore, in theory PDLSCs are the most direct and reliable seed cells for periodontal tissue regeneration. There is no ideal method for the isolation of adult stem cells. Generally, stem cells are separated and identified based on their colony-forming ability and specific biological and physical characteristics. As no specific markers have been identified for PDLSCs, they are predominanly identified by STRO-1, CD146 and other mesenchymal stem cell marker proteins and are isolated by the immunomagnetic bead separation method or flow cytometry. These methods are the same for bone marrow stem cells and dental pulp stem cells, which have similar organizational structure and embryonic origin to PDLSCs (21). As an increasing number of PDLSC studies have been conducted, STRO-1, CD146 and other mesenchymal stem cell surface markers and certain perivascular cell surface markers, such as CD105, CD106 and CD166, have been widely recognized. The STRO-1 antibody immunomagnetic or the flow cytometry separation methods are commonly known to be the most effective separation methods for PDLSCs (4,20–23). In the present study, STRO-1+ cells were separated by flow cytometry and preliminary identification indicated that these cells possess high self-renewal capacity and multi-lineage differentiation potential.

Similar to PRF, the CGFs were only centrifuged once to avoid the loss of fibrinogen. The CGFs formed free modification gelatinous fiber blocks, which were convenient for operation and application. In the present study, CGFs were able to significantly stimulate PDLSC proliferation in a dose-dependent manner in vitro, in standard or differentiation medium. The mechanism responsible for the cell proliferation by CGFs may be explained as follows: CGFs are rich in a variety of growth factors, such as TGF-β, PDGF-AB, VEGF and IGF-I (24). These growth factors while functioning on their own (25–29), are also synergistic and create close contact tissue repair regulatory systems (24,30,31). Unlike PRP, CGFs do not dissolve rapidly following application, instead, the strong fibrin gel in the matrix addition is slowly remodeled in a similar manner to a natural blood clot. Thus, CGFs prolonged the duration of growth factor action, which is conducive for the growth factor synergy (32–34), and enhances cell proliferation and osteogenic differentiation. Previous studies have demonstrated that the PRP may induce proliferation, but inhibits differentiation (16), and certain studies have indicated that high concentrations of PRP may also exhibit an inhibitory effect on the cultured cells (35). In the present study, this was not observed. To avoid any bias related to immune incompatibility, in the present study, CGF was obtained from the same donor as for the PDLSCs. CGFs exhibited no cytotoxic effect on the PDLSCs at the two doses tested similar to PRF (36). CGF also significantly promoted the proliferation of PDLSCs, and exhibited a dose-dependent effect on the activation and differentiation of the stem cells.

With the aid of the osteogenic inductive medium, PDLSCs develop osteogenically. The cells undergo multiple independent stages of differentiation in order to evolve into osteoblasts. The process includes: The conversion phrase, the proliferation phase, cell aggregation secretory phase and extracellular matrix calcification period (37). Throughout the differentiation process, the alkaline phosphatase activity, matrix mineralization, osteocalcin and collagen I are all specific markers for stem cell osteogenic differentiation. Osteoblasts synthesize different products in different stages. Collagen I is produced in the cell proliferation phase, cell aggregation secretory phase synthesizes alkaline phosphatase, and osteocalcin is produced in the extracellular matrix calcification phase (38). Thus, in the present study, the indicators that determine osteoblast differentiation of PDLSCs were mineralized nodule formation, alkaline phosphatase activity, type I collagen synthesis and specific protein expression, such as BSP and OCN. In the present study, ALP activity and mineralized nodule count were elevated by CGF in a time- and dose-dependent manner. qPCR, western blot analysis and immunohistochemical results were used to determine that CGF mediated the osteogenic differentiation of PDLSCs and the results show that CGF accelerates osteogenesis during the differentiation process. Similar the results have been demonstrated previously (39); thus, CGF may contribute to the differentiation of PDLSCs.

In conclusion, CGF significantly promotes the proliferation of PDLSCs and has a dose-dependent effect. In standard culture medium, CGF induces PDLSC osteogenic differentiation. In conditioned medium, CGFs significantly accelerate the osteogenesis transformation process of PDLSCs. CGF mediated culture medium either directly induces transformation or accelerates transformation in a dose-dependent manner. Future studies are required to identify the optimal induction dose of CGF, to determine the mechanism underlying the dose-dependent trend and to reproduce the results in in vivo studies. The present study has therefore provided an experimental basis for further PDLSCs clinical applications and studies.

Acknowledgements

This study was supported by a research grant (no. 09411955100) from Tongji University to Professor Zuolin Wang, the 2010 Shanghai Committee of Science and Technology of China (grant no. 10XD1404500) and National Natural Science Foundation of China (grant no. 81271110).

References

1 

Hench LL: Biomaterials: a forecast for the future. Biomaterials. 19:1419–1423. 1998. View Article : Google Scholar : PubMed/NCBI

2 

Davo R, Malevez C and Rojas J: Immediate function in the atrophic maxilla using zygoma implants: a preliminary study. J Prosthet Dent. 97(Suppl 6): S44–S51. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Petrovic V and Stefanovic V: Dental tissue - new source for stem cells. Scientific World Journal. 9:1167–1177. 2009.PubMed/NCBI

4 

Gronthos S, Brahim J, Li W, et al: Stem cell properties of human dental pulp stem cells. J Dent Res. 81:531–535. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Seo BM, Miura M, Gronthos S, et al: Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet. 364:149–155. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Radtke S and Horn PA: Cells, niche, fate: meeting report on the 6th International Meeting of the Stem Cell Network North Rhine Westphalia. Cell Reprogram. 13:381–384. 2011.PubMed/NCBI

7 

Forte A, Galderisi U, Cipollaro M and Cascino A: Mesenchymal stem cells: a good candidate for restenosis therapy? Curr Vasc Pharmacol. 7:381–393. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Deryugina EI and Müller-Sieburg CE: Stromal cells in long-term cultures: keys to the elucidation of hematopoietic development? Crit Rev Immunol. 13:115–150. 1993.PubMed/NCBI

9 

Fini M, Giavaresi G, Torricelli P, et al: Osteoporosis and biomaterial osteointegration. Biomed Pharmacother. 58:487–493. 2004. View Article : Google Scholar

10 

Davies JE: Mechanisms of endosseous integration. Int J Prosthodont. 11:391–401. 1998.PubMed/NCBI

11 

Meyer U, Joos U, Mythili J, et al: Ultrastructural characterization of the implant/bone interface of immediately loaded dental implants. Biomaterials. 25:1959–1967. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Shields LB, Raque GH, Glassman SD, et al: Adverse effects associated with high-dose recombinant human bone morphogenetic protein-2 use in anterior cervical spine fusion. Spine (Phila Pa 1976). 31:542–547. 2006. View Article : Google Scholar

13 

Alanay A, Chen C, Lee S, et al: The adjunctive effect of a binding peptide on bone morphogenetic protein enhanced bone healing in a rodent model of spinal fusion. Spine (Phila Pa 1976). 33:1709–1713. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Glassman SD, Carreon LY, Campbell MJ, et al: The perioperative cost of Infuse bone graft in posterolateral lumbar spine fusion. Spine J. 8:443–448. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Assoian RK, Grotendorst GR, Miller DM and Sporn MB: Cellular transformation by coordinated action of three peptide growth factors from human platelets. Nature. 309:804–806. 1984. View Article : Google Scholar : PubMed/NCBI

16 

Vogel JP, Szalay K, Geiger F, Kramer M, Richter W and Kasten P: Platelet-rich plasma improves expansion of human mesenchymal stem cells and retains differentiation capacity and in vivo bone formation in calcium phosphate ceramics. Platelets. 17:462–469. 2006. View Article : Google Scholar

17 

Choukroun J, Adda F, Schoeffler C and Vervelle A: Une opportunité en paro-implantologie: le PRF. Implantodontie. 42:55–62. 2001.

18 

Corigliano M, Sacco L and Baldoni E: CGF- una proposta terapeutica per la medicina rigenerativa. Odontoiatria - no 1 anno XXIX - Maggio. 1:69–81. 2010.

19 

Sohn DS, Heo JU, Kwak DH, et al: Bone regeneration in the maxillary sinus using an autologous fibrin-rich block with concentrated growth factors alone. Implant Dent. 20:389–395. 2011.PubMed/NCBI

20 

He H, Yu J, Cao J, et al: Biocompatibility and osteogenic capacity of periodontal ligament stem cells on nHAC/PLA and HA/TCP scaffolds. J Biomater Sci Polym Ed. Jun 16–2010.(Epub ahead of print).

21 

Mrozik K, Gronthos S, Shi S and Bartold PM: A method to isolate, purify, and characterize human periodontal ligament stem cells. Methods Mol Biol. 666:269–284. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Coura GS, Garcez RC, de Aguiar CB, Alvarez-Silva M, Magini RS and Trentin AG: Human periodontal ligament: a niche of neural crest stem cells. J Periodontal Res. 43:531–536. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Lee UL, Jeon SH, Park JY and Choung PH: Effect of platelet-rich plasma on dental stem cells derived from human impacted third molars. Regen Med. 6:67–79. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Rodella LF, Favero G, Boninsegna R, et al: Growth factors, CD34 positive cells, and fibrin network analysis in concentrated growth factors fraction. Microsc Res Tech. 74:772–777. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Zhao L, Jiang S and Hantash BM: Transforming growth factor beta1 induces osteogenic differentiation of murine bone marrow stromal cells. Tissue Eng Part A. 16:725–733. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Zeiter S, Lezuo P and Ito K: Effect of TGF beta1, BMP-2 and hydraulic pressure on chondrogenic differentiation of bovine bone marrow mesenchymal stromal cells. Biorheology. 46:45–55. 2009.PubMed/NCBI

27 

Wirz S, Dietrich M, Flanagan TC, et al: Influence of platelet-derived growth factor-AB on tissue development in autologous platelet-rich plasma gels. Tissue Eng Part A. 17:1891–1899. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Nakano N, Nakai Y, Seo TB, et al: Characterization of conditioned medium of cultured bone marrow stromal cells. Neurosci Lett. 483:57–61. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Fang Y, Wang LP, Du FL, Liu WJ and Ren GL: Effects of insulin-like growth factor I on alveolar bone remodeling in diabetic rats. J Periodontal Res. 48:144–150. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Sunitha Raja V and Munirathnam Naidu E: Platelet-rich fibrin: evolution of a second-generation platelet concentrate. Indian J Dent Res. 19:42–46. 2008.PubMed/NCBI

31 

Dohan DM, Choukroun J, Diss A, et al: Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-related biologic features. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 101:e45–e50. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Kang YH, Jeon SH, Park JY, et al: Platelet-rich fibrin is a Bioscaffold and reservoir of growth factors for tissue regeneration. Tissue Eng Part A. 17:349–359. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Dohan Ehrenfest DM, de Peppo GM, Doglioli P and Sammartino G: Slow release of growth factors and thrombospondin-1 in Choukroun’s platelet-rich fibrin (PRF): a gold standard to achieve for all surgical platelet concentrates technologies. Growth Factors. 27:63–69. 2009.PubMed/NCBI

34 

Dohan Ehrenfest DM, Rasmusson L and Albrektsson T: Classification of platelet concentrates: from pure platelet-rich plasma (P-PRP) to leucocyte- and platelet-rich fibrin (L-PRF). Trends Biotechnol. 27:158–167. 2009.PubMed/NCBI

35 

Graziani F, Ivanovski S, Cei S, Ducci F, Tonetti M and Gabriele M: The in vitro effect of different PRP concentrations on osteoblasts and fibroblasts. Clin Oral Implants Res. 17:212–219. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Dohan Ehrenfest DM, Doglioli P, de Peppo GM, Del Corso M and Charrier JB: Choukroun’s platelet-rich fibrin (PRF) stimulates in vitro proliferation and differentiation of human oral bone mesenchymal stem cell in a dose-dependent way. Arch Oral Biol. 55:185–194. 2010.

37 

Yoshikawa T, Nakajima H, Takakura Y and Nonomura A: Osteogenesis with cryopreserved marrow mesenchymal cells. Tissue Eng. 11:152–160. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Liu G, Shu C, Cui L, Liu W and Cao Y: Tissue-engineered bone formation with cryopreserved human bone marrow mesenchymal stem cells. Cryobiology. 56:209–215. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Huang FM, Yang SF, Zhao JH and Chang YC: Platelet-rich fibrin increases proliferation and differentiation of human dental pulp cells. J Endod. 36:1628–1632. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu B and Wang Z: Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro. Mol Med Rep 9: 235-242, 2014.
APA
Yu, B., & Wang, Z. (2014). Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro. Molecular Medicine Reports, 9, 235-242. https://doi.org/10.3892/mmr.2013.1756
MLA
Yu, B., Wang, Z."Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro". Molecular Medicine Reports 9.1 (2014): 235-242.
Chicago
Yu, B., Wang, Z."Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro". Molecular Medicine Reports 9, no. 1 (2014): 235-242. https://doi.org/10.3892/mmr.2013.1756
Copy and paste a formatted citation
x
Spandidos Publications style
Yu B and Wang Z: Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro. Mol Med Rep 9: 235-242, 2014.
APA
Yu, B., & Wang, Z. (2014). Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro. Molecular Medicine Reports, 9, 235-242. https://doi.org/10.3892/mmr.2013.1756
MLA
Yu, B., Wang, Z."Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro". Molecular Medicine Reports 9.1 (2014): 235-242.
Chicago
Yu, B., Wang, Z."Effect of concentrated growth factors on beagle periodontal ligament stem cells in vitro". Molecular Medicine Reports 9, no. 1 (2014): 235-242. https://doi.org/10.3892/mmr.2013.1756
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team