Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease

  • Authors:
    • Jie Mi
    • Dong Chen
    • Mei Wu
    • Weilin Wang
    • Hong Gao
  • View Affiliations / Copyright

    Affiliations: Laboratory of Congenital Malformation, Ministry of Public Health, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China
  • Pages: 1839-1843
    |
    Published online on: March 6, 2014
       https://doi.org/10.3892/mmr.2014.2022
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hirschsprung's disease (HSCR) is a polygenic disease, of which the cause remains to be elucidated. It has been suggested that SRY‑related HMG‑box 9 (SOX9) is fundamental for the correct development of oligodendrocytes and astrocytes; however, not the development of neurons. There are currently no reports regarding SOX9 expression in patients with HSCR; therefore, the present study aimed to investigate the expression of microRNA‑124 (miR‑124) and its target gene, SOX9, in HSCR. Quantitative polymerase chain reaction (qPCR), western blot analysis and immunohistochemistry were used to detect the mRNA and protein expression of miR‑124 and SOX9 in patients with HSCR. miR‑124 expression was observed to be markedly higher in stenotic colon segment tissues compared with normal colon segment tissues in patients with HSCR. Furthermore, mRNA and protein analyses revealed that SOX9 expression was also higher in the stenotic colon segment tissues compared with the normal colon segment tissues. In conclusion, these data suggest that miR‑124 and its target gene, SOX9, are overexpressed in the stenotic colon segment of patients with HSCR, and may have a significant role in the development of HSCR.

Introduction

Hirschsprung’s disease (HSCR) is characterized by aganglionosis; a loss of enteric ganglia in the distal section of the gut (1,2). HSCR represents the predominant genetic cause of functional intestinal obstruction with an average incidence of 20/100,000 live births worldwide. There is a considerable ethnic disparity in the incidence of the disease, with an incidence of 28/100,000 live births in individuals of Asian descent (3). Aganglionosis is a disorder of the enteric nervous system (ENS) in which ganglion cells fail to innervate the lower gastrointestinal tract during embryonic development (4).

As a neurocristopathy, HSCR is a complex disease influenced by multiple genetic and environmental factors. Mutations in genes with significant roles in the formation of the ENS have been identified in patients with HSCR, including rearranged during transfection (RET) (5–7), endothelin receptor type B (EDNRB) (8–10), endothelin-3 (EDN3) (11,12), glial cell line-derived neurotrophic factor (GDNF) (13–15) and SRY-related HMG-box (SOX) 10 (16,17). SOX10 is a major gene associated with HSCR. In the human colon, SOX10 expression is restricted to the ENS, and is present in neuronal and glial cells. The expression of SOX10 was observed to be consistently lower in the aganglionic segments of the colon than in the hypoganglionic and normal segments (18).

SOX9 is a member of the SOXE group of genes along with SOX8 and SOX10, and is markedly expressed, initially in neural stem cells and later in glial cells, in the developing central nervous system (CNS). It has been identified that SOX9 is crucial for the correct development of oligodendrocytes and astrocytes, but not neurons (19). Moreover, it has been shown that SOX9 is present in a small population of subventricular zone (SVZ) cells in the postnatal and adult mouse brain (20). However, there are no reports regarding SOX9 expression in patients with HSCR.

MicroRNAs (miRNAs) are a class of short, noncoding RNA genes that have been reported to demonstrate essential roles in cell growth and apoptosis, hematopoietic lineage differentiation and tumorigenesis (21,22). The miR-124 family of miRNAs are a key focus of research into miRNA function in humans and animals. It has been reported that miR-124 is a significant regulator of the temporal progression of adult neurogenesis in the mouse SVZ, and that SOX9 is a target of miR-124 at the transition from transit-amplifying cell to neuroblast stage in the adult mouse brain (23,24).

The present study aimed to investigate the association between the SOX9 gene and HSCR, by exploring the SOX9 and miR-124 expression patterns in patients with HSCR. To the best of our knowledge, the present study is the first investigate SOX9 and miR-124 detection in patients with HSCR, and may provide a novel understanding of HSCR for genetic counseling.

Materials and methods

Patients

This study was approved by the Ethics Committee of China Medical University (Shenyang, China; 2012PS17K) and all subjects involved in the study provided written informed consent. Stenotic and normal colon segment tissues were obtained from 50 patients diagnosed with HSCR at the Department of Pediatric Surgery, Shengjing Hospital of China Medical University. Patient age ranged from 6 months to 6 years, with a mean age of 2.5 years. HSCR was diagnosed in patients using barium enema, acetylcholinesterase histochemical examination of the rectal mucosa and anorectal manometry and was further confirmed by the pathological results. At the time of surgery, none of these cases had received preoperative treatment, or had either a history of HSCR-associated or active enterocolitis. All tissue samples were subdivided for fixation using 4% paraformaldehyde solution, and for histological sectioning and storage at −80°C for molecular analysis.

Antibodies

Polyclonal rabbit anti-SOX9 antibodies were purchased from Beijing Biosynthesis Biotechnology Co., Ltd. (no. bs-4177R; Beijing, China).

RNA extraction, reverse transcription and quantitative polymerase chain reaction (qPCR)

A total of ~100 mg stenotic and normal intestine tissue from patients with HSCR were used for total RNA extraction using TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), in accordance with the manufacturer’s instructions. The harvested RNA was diluted to a concentration of 1 μg/μl, aliquoted and stored at −80°C. For cDNA synthesis, two reagent kits were used: One Step PrimeScript® miRNA cDNA Synthesis Kit and PrimeScript® RT reagent Kit (TaKaRa Biotechnology Co., Dalian, China). qPCR was performed in triplicate for each specimen using SYBR® Green PCR Master Mix (TaKaRa Biotechnology Co.) in a LightCycler® (Roche Molecular Biochemicals, Co., Mannheim, Germany). RNA and miRNA expression levels were normalized to GAPDH mRNA and U6 miRNA expression levels, respectively. The primers (TaKaRa Biotechnology Co.) used in qPCR are listed in Table I. Following amplification, melting curve analysis was performed, using temperatures ranging from 60 to 90°C, increasing by 0.2°C every 10 sec. The threshold cycle (CT) value, the point at which a significant increase in PCR product is detected, was also recorded. ΔCT was calculated as follows: ΔCT=CT of gene of interest minus CT of GAPDH and U6. For these genes, one cycle change in CT corresponded to a 2.1±0.2 standard error of the mean change in RNA dilution. To estimate the magnitude of the difference in expression for the other individual RNAs, the ΔΔCT (ΔΔCT=ΔCT for samples with HSCR-ΔCT for control samples) was transformed to ‘fold change’ =2−ΔΔct.

Table I

Primer sequences for qPCR.

Table I

Primer sequences for qPCR.

TargetSequence (5′-3′) (°C)Annealing temperature
SOX9F: GCAGCGAAATCAACGAG
R: CAAAGTCCAAACAGGCAGA
51
GAPDHF: AGAGCTACGAGCTGCCTGAC
R: AGC ACTGTGTTGGCGTACAGA
55
miR-124F: CTCTCTCTCCGTGTTCACAG
R: GCTGTC AACGATACGCTACGTAACG
53
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
60

[i] qPCR, quantitative polymerase chain reaction; SOX9, SRY-related HMG-box 9; miR-124, microRNA-124.

Western blot analysis

Each specimen (~100 mg) of stenotic and normal intestine tissue from patients with HSCR was homogenized using surgical blades and sonicated in protein lysis buffer. Protein concentrations were then measured using the Bradford assay and specimens were adjusted to equal protein concentrations, aliquoted and stored at −80°C. Equal quantities of total proteins were separated by SDS-PAGE prior to being electro-transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). Membranes were then incubated with an anti-SOX9 polyclonal primary antibody (Beijing Biosynthesis Biotechnology Co. Ltd.) at a dilution of 1:50, overnight at 4°C. Membranes were then washed, prior to incubation with a horseradish peroxidase-linked secondary antibody (Beijing Biosynthesis Biotechnology Co. Ltd) at a dilution of 1:2,000 for 1 h at room temperature. Blots were developed using an enhanced chemiluminescence kit and dectection was performed using a Syngene G:Box (SYOR4/1246; GE Healthcare, Pittsburgh, PA, USA).

Hematoxylin and eosin (H&E) staining and immunohistochemical staining

Immunohistochemical staining was performed as described previously (25). The stenotic and normal colon segments from patients with HSCR were immediately washed in cold phosphate-buffered saline (PBS; pH 7.4), prior to undergoing fixation in 4% buffered paraformaldehyde at 4°C for 24 h. Subsequently, the samples were dehydrated, embedded in paraffin and sectioned sagittally at a thickness of 4 μm. Slides were then incubated in boiling 0.01 mol/l citrate buffer (pH 6.0) for 10 min, cooled to room temperature and incubated with 3% H2O2 for 15 min, prior to being incubated with 10% normal goat serum (Biosynthesis Biotechnology Co., Ltd.) for 30 min. Sections were then incubated with primary anti-SOX9 antibody, at a dilution of 1:200, at 4°C for 14–16 h. Following primary antibody incubation, slides were washed in PBS, incubated with anti-rabbit immunoglobulin G-peroxidase antibody for 20 min at room temperature and then stained with 3′3-diaminobenzidine tetrahydrochloride (DAB). Dark brown granules in the cytoplasm and cytomembrane were considered positive results. Negative controls were generated by incubating slides with equivalent concentrations of nonimmune rabbit antiserum. Using integrated optical density (IOD) measurements (26), images were captured on color-positive films under identical illumination settings for each sample. The optical density (OD) of the cells was measured in the control tissues in the same fields, using a NIS-Elements Basic Research analysis system version 2.30 (Nikon Co., Kawasaki, Japan). The immunohistochemical-stained slides were independently reviewed by two researchers.

Statistical analysis

Statistical analyses were conducted using SPSS statistical software 16.0 (SPSS Inc., Chicago, IL, USA). T tests were used to determine the statistical significance of the differences in levels of miR-124 and SOX9 expression in stenotic colon segments compared with normal colon segments. All results are presented as the mean ± standard deviation. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

qPCR analysis

The concentration and purity of extracted total RNA of matched samples from 50 patients with HSCR was determined as the A260/280 ratio using a NanoVue™ spectrophotometer (GE Healthcare Bio-Sciences AB, Freiburg, Germany). The levels of SOX9 expression were normalized to the mRNA levels of GAPDH from the same specimen, and the levels of miR-124 expression were normalized to the levels of U6 miRNA expression. Melting curves for SOX9 and miR-124 were observed to differ between samples; therefore, for each sample, the replicates should share the same melting curve protocol for SOX9 and miR-124 amplification in the human transcriptome. It was observed that in patients with HSCR, the levels of SOX9 mRNA and miR-124 were 4.1 and 5.9 fold higher in the stenotic colon segment tissue than in the normal colon segment tissue, respectively (P<0.0047; P<0.0007) (data not shown).

Protein expression levels

The protein expression of SOX9 was evaluated in the same 50 patients with HSCR using western blot analysis with specific antibodies. Consistent with the qPCR data, a significant increase in SOX9 was detected in the stenotic colon segment tissue compared with the matched normal colon segment tissue (Figs. 1 and 2). Densitometry analysis indicated that this difference was statistically significant (P<0.05).

Figure 1

SOX9 expression in patients with HSCR. Protein extracts from normal and stenotic colon segment tissues from patients with HSCR were probed using western blot analysis with anti-SOX9 antibodies. HSCR, Hirschsprung’s disease; SOX9, SRY-related HMG-box 9.

Figure 2

SOX9 protein expression relative to β-actin expression (y-axis) in normal and stenotic colon segments from patients with HSCR (x-axis). SOX9, SRY-related HMG-box 9; HSCR, Hirschsprung’s disease.

Immunohistochemistry

The expression profile of SOX9 was further confirmed using immunohistochemistry. The stenotic colon segments were defined by the loss of the focal colon ganglion cells using H&E staining (Fig. 3). Immunohistochemical staining of SOX9 revealed an increase in SOX9 expression in the stenotic colon segment tissue, as represented by the brown yellow staining (Fig. 4A and C). By contrast, SOX9 expression was observed to be lower in the normal colon segment tissue, where staining was light yellow or colorless (Fig. 4B and D).

Figure 3

Photomicrographs of hematoxylin and eosin-stained stenotic and normal intestine tissue from patients with Hirschsprung’s disease. (A) Stenotic colon segment tissue, showing aganglionosis (magnification, ×400). (B) Normal colon segment tissue, showing the presence of ganglion cells (magnification, ×400).

Figure 4

Distribution and expression of S0X9 using immunohistochemistry in patients with Hirschsprung’s disease. (A and C) S0X9 staining in the mucous and muscular layers of stenotic colon segment tissues (magnifications, ×200 and ×400, respectively). (B and D) S0X9 staining in the mucous and muscular layers of normal colon segment tissues (magnifications, ×200 and ×400, respectively). SOX9, SRY-related HMG-box 9.

Discussion

HSCR is the most common congenital gut motility disorder and is caused by the absence of ganglion cells in the bowel wall. It is well established that the onset of HSCR involves a series of complex processes, including the distortion of ganglion cell development at different stages (3,26). Although progress has been made with regard to identifying some of the genetic factors associated with HSCR, numerous factors are yet to be elucidated. miRNA research is providing a novel understanding of the molecular mechanisms underlying normal and abnormal biological processes.

miRNAs are non-coding RNAs, ~20–24 nucleotides in length, which are found in the majority of eukaryotic cells (27). Due to the complexity of HSCR, progress in understanding the disease is limited. miRNAs were originally identified as moderate biological modifiers of gene expression and protein translation; however, they have recently been identified as powerful regulators of diverse cellular processes, with significant roles in disease and tissue remodeling. Therefore, it has been suggested that miRNAs may represent target molecules for disease treatment (28). However, identifying the target genes regulated by miRNAs remains a challenge. It has been suggested that miRNAs and their target genes have a one-to-numerous and numerous-to-one interrelation in the function of miRNA regulation (26).

miR-124 is preferentially expressed in neurons and has been implicated in the positive modulation of the transitory progression of adult SVZ neurogenesis, through the repression of SOX9 (23). This suggests that miR-124 may be critical for the homeostasis of differentiation and proliferation in adult neural progenitor cells (23,29). However, the miRNAs and specific target genes that are involved in the development of the ENS are yet to be identified. To the best of our knowledge, the present study was the first to detect miR-124 and SOX9 expression in patients with HSCR.

In the present study, the stenotic and normal colon segment tissues of 50 patients with HSCR were analyzed. The expression of SOX9 and miR-124 in stenotic and normal colon segments was detected using qPCR. The expression of SOX9 and miR-124 was observed to be significantly higher in stenotic colon segments than in normal colon segments (P<0.05). Furthermore, the results of the western blot analysis and immunohistochemical staining also revealed a significant increase in SOX9 expression in the stenotic colon segments compared with the normal colon segments.

miRNAs have recently attracted much attention as a novel research tool. It was observed in the present study that the miRNA that targets SOX9, miR-124, was upregulated in stenotic colon segments compared with the normal colon segments. Therefore, this study concludes that an association may exist between the expression of SOX9 and miR-124 in patients with HSCR. miR-124 may be capable of promoting the development of HSCR by targeting SOX9; however, the mechanism by which this occurs is yet to be elucidated.

In conclusion, the present study reveals that the expression of SOX9 is abnormal in patients with HSCR, and that miR-124 may be a risk factor for these patients. Furthermore, it has been demonstrated that SOX9 may represent a potential target for gene therapy and may be a promising candidate biomarker for HSCR. Further investigations are required to assess the potential of SOX9 for the treatment and diagnosis of HSCR and to identify other miRNAs that may be involved in HSCR.

Acknowledgments

The present study was supported by a grant from the National Natural Science Foundation of China (no. 30772277).

References

1 

Amiel J and Lyonnet S: Hirschsprung disease, associated syndromes, and genetics: a review. J Med Genet. 38:729–739. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Whitehouse FR and Kernohan JW: Myenteric plexus in congenital megacolon; study of 11 cases. Arch Intern Med (Chic). 82:75–111. 1948. View Article : Google Scholar : PubMed/NCBI

3 

Haricharan RN and Georgeson KE: Hirschsprung disease. Semin Pediatr Surg. 17:266–275. 2008. View Article : Google Scholar

4 

Tam PK and Garcia-Barceló M: Genetic basis of Hirschsprung’s disease. Pediatr Surg Int. 25:543–558. 2009.

5 

Angrist M, Kauffman E, Slaugenhaupt SA, et al: A gene for Hirschsprung disease (megacolon) in the pericentromeric region of human chromosome 10. Nat Genet. 4:351–356. 1993. View Article : Google Scholar : PubMed/NCBI

6 

Luo Y, Ceccherini I, Pasini B, et al: Close linkage with the RET protooncogene and boundaries of deletion mutations in autosomal dominant Hirschsprung disease. Hum Mol Genet. 2:1803–1808. 1993. View Article : Google Scholar : PubMed/NCBI

7 

Lyonnet S, Bolino A, Pelet A, et al: A gene for Hirschsprung disease maps to the proximal long arm of chromosome 10. Nat Genet. 4:346–350. 1993. View Article : Google Scholar : PubMed/NCBI

8 

Amiel J, Attié T, Jan D, et al: Heterozygous endothelin receptor B (EDNRB) mutations in isolated Hirschsprung disease. Hum Mol Genet. 5:355–357. 1996. View Article : Google Scholar : PubMed/NCBI

9 

Attié T, Till M, Pelet A, Amiel J, Edery P, Boutrand L, Munnich A and Lyonnet S: Mutation of the endothelin-receptor B gene in Waardenburg-Hirschsprung disease. Hum Mol Genet. 4:2407–2409. 1995.PubMed/NCBI

10 

Kusafuka T, Wang Y and Puri P: Novel mutations of the endothelin-B receptor gene in isolated patients with Hirschsprung’s disease. Hum Mol Genet. 5:347–349. 1996.

11 

Edery P, Attié T, Amiel J, Pelet A, Eng C, Hofstra RM, Martelli H, Bidaud C, Munnich A and Lyonnet S: Mutation of the endothelin-3 gene in the Waardenburg-Hirschsprung disease (Shah-Waardenburg syndrome). Nat Genet. 12:442–444. 1996. View Article : Google Scholar : PubMed/NCBI

12 

Hofstra RM, Osinga J, Tan-Sindhunata G, et al: A homozygous mutation in the endothelin-3 gene associated with a combined Waardenburg type 2 and Hirschsprung phenotype (Shah-Waardenburg syndrome). Nat Genet. 12:445–447. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Angrist M, Bolk S, Halushka M, Lapchak PA and Chakravarti A: Germline mutations in glial cell line-derived neurotrophic factor (GDNF) and RET in a Hirschsprung disease patient. Nat Genet. 14:341–344. 1996. View Article : Google Scholar : PubMed/NCBI

14 

Ivanchuk SM, Myers SM, Eng C and Mulligan LM: De novo mutation of GDNF, ligand for the RET/GDNFR-alpha receptor complex, in Hirschsprung disease. Hum Mol Genet. 5:2023–2026. 1996. View Article : Google Scholar : PubMed/NCBI

15 

Salomon R, Attié T, Pelet A, et al: Germline mutations of the RET ligand GDNF are not sufficient to cause Hirschsprung disease. Nat Genet. 14:345–347. 1996. View Article : Google Scholar : PubMed/NCBI

16 

Pingault V, Bondurand N, Kuhlbrodt K, et al: SOX10 mutations in patients with Waardenburg-Hirschsprung disease. Nat Genet. 18:171–173. 1998. View Article : Google Scholar : PubMed/NCBI

17 

Southard-Smith EM, Angrist M, Ellison JS, Agarwala R, Baxevanis AD, Chakravarti A and Pavan WJ: The Sox10(Dom) mouse: modeling the genetic variation of Waardenburg-Shah (WS4) syndrome. Genome Res. 9:215–225. 1999.PubMed/NCBI

18 

Sham MH, Lui VC, Fu M, Chen B and Tam PK: SOX10 is abnormally expressed in aganglionic bowel of Hirschsprung’s disease infants. Gut. 49:220–226. 2001.PubMed/NCBI

19 

Stolt CC, Lommes P, Sock E, Chaboissier MC, Schedl A and Wegner M: The Sox9 transcription factor determines glial fate choice in the developing spinal cord. Genes Dev. 17:1677–1689. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Kordes U, Cheng YC and Scotting PJ: Sox group E gene expression distinguishes different types and maturational stages of glial cells in developing chick and mouse. Brain Res Dev Brain Res. 157:209–213. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Kloosterman WP and Plasterk RH: The diverse functions of microRNAs in animal development and disease. Dev Cell. 11:441–450. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Cheng LC, Pastrana E, Tavazoie M and Doetsch F: miR-124 regulates adult neurogenesis in the subventricular zone stem cell niche. Nat Neurosci. 12:399–408. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Grandjean V, Gounon P, Wagner N, Martin L, Wagner KD, Bernex F, Cuzin F and Rassoulzadegan M: The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development. 136:3647–3655. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Simic P and Vukicevic S: Bone morphogenetic proteins in development and homeostasis of kidney. Cytokine Growth Factor Rev. 6:299–308. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Martucciello G: Hirschsprung’s disease, one of the most difficult diagnoses in pediatric surgery: a review of the problems from clinical practice to the bench. Eur J Pediatr Surg. 18:140–149. 2008.

27 

Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

28 

van Rooij E: The art of microRNA research. Circ Res. 108:219–234. 2011.

29 

Papagiannakopoulos T and Kosik KS: MicroRNA-124: micromanager of neurogenesis. Cell Stem Cell. 4:375–376. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mi J, Chen D, Wu M, Wang W and Gao H: Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease. Mol Med Rep 9: 1839-1843, 2014.
APA
Mi, J., Chen, D., Wu, M., Wang, W., & Gao, H. (2014). Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease. Molecular Medicine Reports, 9, 1839-1843. https://doi.org/10.3892/mmr.2014.2022
MLA
Mi, J., Chen, D., Wu, M., Wang, W., Gao, H."Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease". Molecular Medicine Reports 9.5 (2014): 1839-1843.
Chicago
Mi, J., Chen, D., Wu, M., Wang, W., Gao, H."Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease". Molecular Medicine Reports 9, no. 5 (2014): 1839-1843. https://doi.org/10.3892/mmr.2014.2022
Copy and paste a formatted citation
x
Spandidos Publications style
Mi J, Chen D, Wu M, Wang W and Gao H: Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease. Mol Med Rep 9: 1839-1843, 2014.
APA
Mi, J., Chen, D., Wu, M., Wang, W., & Gao, H. (2014). Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease. Molecular Medicine Reports, 9, 1839-1843. https://doi.org/10.3892/mmr.2014.2022
MLA
Mi, J., Chen, D., Wu, M., Wang, W., Gao, H."Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease". Molecular Medicine Reports 9.5 (2014): 1839-1843.
Chicago
Mi, J., Chen, D., Wu, M., Wang, W., Gao, H."Study of the effect of miR‑124 and the SOX9 target gene in Hirschsprung's disease". Molecular Medicine Reports 9, no. 5 (2014): 1839-1843. https://doi.org/10.3892/mmr.2014.2022
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team