SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction

  • Authors:
    • Tim Boehringer
    • Peter Bugert
    • Martin Borggrefe
    • Elif Elmas
  • View Affiliations

  • Published online on: July 21, 2014     https://doi.org/10.3892/mmr.2014.2401
  • Pages: 2039-2044
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Mutations in the SCN5A gene encoding the Nav1.5 channel α-subunit are known to be risk factors of arrhythmia, including Brugada Syndrome and Long QT syndrome subtype 3. The present study focused on the role of SCN5A variants in the development of ventricular fibrillation (VF) during acute myocardial infarction (AMI). Since VF during AMI is the major cause of sudden death in the Western world, SCN5A mutations represent genetic risk factors for sudden death. By exon re-sequencing, the entire coding region and flanking intron regions were sequenced in 46 AMI/VF+ patients. In total, nine single nucleotide variants were identified of which four represented common single nucleotide polymorphisms (SNPs; 87G>A, 1673A>G, IVS16‑6C>T and 5457T>A). Only five rare variants were identified, each in only one patient. Only two of the rare variants represented missense mutations (3578G>A and 4786T>A). The common SNPs and the missense mutations were also genotyped using polymerase chain reaction methods in 79 AMI/VF‑ patients and 480 healthy controls. The SNPs did not demonstrate significant differences in allele and genotype frequencies between the study groups. The 3578G>A mutation was identified in one out of the 480 controls, whereas the 4786T>A mutation was not present in AMI/VF- patients and controls. In conclusion, the majority of AMI/VF+ patients demonstrated a wild type sequence or common SNPs in SCN5A. Only two out of 46 (4.3%) AMI/VF+ patients revealed mutations that may be involved in Nav1.5 dysfunction and VF. However, this requires further functional validation.

Introduction

In the Western world ventricular fibrillation (VF) during acute myocardial infarction (AMI) is the major cause of sudden cardiac death (SCD) (1). VF occurs in 10% of cases within the first hours following the symptoms of an AMI (2,3). In addition to established risk factors for VF, a significant genetic component may be detected using extensive observational population studies (47). In primary electrical heart diseases, including Long QT syndrome (LQTS), Short QT syndrome and Brugada syndrome, genes encoding ion channels are mutated.

The SCN5A gene encodes the major cardiac voltage-gated sodium channel α-subunit Nav1.5 and is located on chromosome 3p21–24 (8). Exons 2–28 contain the protein-coding sequence and several splice variants have been described (9). The major role of the sodium channel is the rapid depolarization at the beginning of an action potential and the transmission of electrical impulses in the heart myocardia (8,10). Mutations in SCN5A may affect different mechanisms, including channel activation, inactivation and reactivation or may lead to complete loss of function (11). Mutations were identified in different types of arrhythmias (1215), i.e. in 10–20% of patients with Brugada syndrome and in 6% of patients with Long QT syndrome subtype 3 (LQTS3). Common polymorphisms in SCN5A modulate the biophysical defects of SCN5A mutations (1619) or may be associated with an increased risk of SCD (20). The potential association of SCN5A variants with VF during AMI remains unclear. Among a small cohort of 19 patients suffering from VF during AMI, only one demonstrated a missense mutation in SCN5A (21). In our previous study on 240 AMI patients, including 73 patients with primary VF an association of the SCN5A-H558R polymorphism with the risk of VF or AMI was not identified (22).

The present study aimed to investigate the role of SCN5A mutations and polymorphisms in the development of VF during AMI. Screening for DNA sequence variation in the coding region of SCN5A was performed by exon re-sequencing in patients suffering from VF during AMI (AMI/VF+). For common single nucleotide polymorphisms (SNPs) and rare mutations identified in the AMI/VF+ patients polymerase chain reaction with sequence-specific primers (PCR-SSP) was developed. In order to estimate the role of these gene variants as risk factors for VF or AMI, the present study additionally genotyped AMI/VF patients and healthy controls.

Materials and methods

Patients and controls

Patients were recruited from the First Department of Medicine (Cardiology), University Medical Centre (Mannheim, Germany). The controls were recruited at the Institute of Transfusion Medicine and Immunology, German Red Cross Blood Service (Mannheim, Germany). In total 49 Patients who suffered from VF during AMI (AMI/VF+) and 74 AMI patients without VF (AMI/VF) were included. Additionally, a control group of 480 healthy blood donors was analyzed. The baseline characteristics of the study individuals are summarized in Table I. All patients and controls provided written consent to use biological material for molecular genetic research purposes. The study was approved by the ethics committee of the Medical Faculty Mannheim, Heidelberg University (Mannheim, Germany). DNA was extracted from EDTA blood samples of all study individuals using commercial kits (QIAamp® DNA Blood Mini kit; Qiagen, Hilden, Germany).

Table I

Baseline characteristics of patients and controls.

Table I

Baseline characteristics of patients and controls.

CharacteristicAMI/VF+ patients (n=49)AMI/VF patients (n=74)Controls (n=480)Significance (P-value)a
No. of males (%)44 (91.8)53 (71.6)288 (60.0)0.045a
<0.001b
Age (mean ± SD)60.7±10.061.0±12.057.3±6.70.903a
0.001b
CAD, n (%)
 1-vessel disease28 (57.1)27 (36.5)-0.028a
 2-vessel disease18 (36.7)22 (29.7)-0.438a
 3-vessel disease3 (6.1)25 (33.8)-<0.001a
No. of patients with hypertension (%)27 (55.1)40 (54.1)-0.909a
No. of patients with hyperlipoproteinemia (%)26 (53.1)47 (63.5)-0.266a
No. of smokers (%)26 (53.1)38 (51.4)-0.853a
No. of patients with diabetes mellitus (%)11 (22.4)17 (23.0)-0.946a
No. of patients with a family history of myocardial infarction (%)12 (24.5)17 (23.0)-0.830a

a AMI/VF+ vs. AMI/VF;

b AMI vs. controls.

{ label (or @symbol) needed for fn[@id='tfn3-mmr-10-04-2039'] } AMI, acute myocardial infarction; VF, ventricular fibrillation; CAD, coronary artery disease; SD, standard deviation.

Mutation screening and genotyping

SCN5A exons 2–28 were amplified from genomic DNA using flanking intron primers (Table II). Sequencing was performed on the two strands with the use of the amplification primers.

Table II

Primers for amplification and re-sequencing of SCN5A exons 2–28.

Table II

Primers for amplification and re-sequencing of SCN5A exons 2–28.

TargetBinding regionDirectionSequence (5′-3′)Final MgCl2 conc. (mM)Size (bp)
Exon 2 (part I)Intron 1Sense ctgtccctgggcatagaatc3.5188
Exon 2Antisense ttctctgccatgcgcttctc
Exon 2 (part II)Exon 2Sense cagcttccgcaggttcacac2.0288
Intron 2Antisense ggagttgcacagaagggtag
Exon 3Intron 2Sense tctacacaagggcctaatgctac2.0274
Intron 3Antisense agggaatcagcgctactctc
Exon 4Intron 3Sense cccatgctgctcagctttcc2.0152
Intron 4Antisense gtggagaagaggccctgaag
Exon 5Intron 4Sense acgtaaggaacctggagaacc3.5306
Intron 5Antisense agggaggaagccagaaagag
Exon 6Intron 5Sense caggcggtggttctgctttg2.0424
Intron 6Antisense aaggcccaggcatatccctc
Exon 7Intron 6Sense cgtgcttgttcttgccttcc3.5299
Intron 7Antisense gctggtctcacaaagtcttc
Exon 8Intron 7Sense cctggatgcaaggcggaaac2.0274
Intron 8Antisense gaagggtcctggcaggtaag
Exon 9Intron 8Sense tggcactaggtttgtgaagc2.0325
Intron 9Antisense ctgagcccacacttgctgtc
Exon 10Intron 9Sense cctggcacaactagactagg3.5332
Intron 10Antisense agtcaggtgagggcttagag
Exon 11Intron 10Sense ggctgcacaaagtctcaatg2.0348
Intron 11Antisense aaacaggaagcgcagagatg
Exon 12Intron 11Sense ccctctcctcatgcccttag2.0425
Intron 12Antisense tgctgtggtgcctgcatctc
Exon 13Intron 12Sense cccaggctgacgcaaatctc2.0242
Intron 13Antisense tgggtcaggctgggataaag
Exon 14Intron 13Sense gtcatctcccagagcaagtc2.0379
Intron 14Antisense caggatgcccatttgagagc
Exon 15Intron 14Sense ggccagggagtctttccatc2.0283
Intron 15Antisense ttgggttgtgccgagccttc
Exon 16Intron 15Sense ccagagcccttcacaaggtc2.0442
Intron 16Antisense gctgggtagatgagtggatg
Exon 18Intron 17Sense gcatgggcagggtctgaaac3.5284
Intron 18Antisense gctggcttcagggacaaagg
Exon 21Intron 20Sense ggcttcatgtccaccttgtc2.0256
Intron 21Antisense cggcaatgggtttctccttc
Exon 22Intron 21Sense cccatttctactttgcctccc3.5172
Intron 22Antisense tgggaaggcagccacctc
Exon 23Intron 22Sense aaagggcatgtgctctgg2.0378
Intron 23Antisense ccattgggaggaaggaagtc
Exon 24Intron 23Sense gaagctcaagcgaggtacag2.0229
Intron 24Antisense acgagatcttgcccttgtgg
Exon 26Intron 25Sense ggttggtgccttctctttgc3.5244
Intron 26Antisense ctcaggctgggctgaaagac
Exon 27Intron 26Sense gggatgagaggcagcaacag2.0373
Intron 27Antisense gtccagctgacttgtatacc
Exon 28 (Part I)Intron 27Sense gacagaggtgccaccagtag3.5450
Exon 28Antisense cccgagagccattgctgttg
Exon 28 (Part II)Exon 28Sense acccatccaagatctcctac3.5494
Exon 28Antisense tggtggtgatgggctcgtag

For the single nucleotide variations (mutations and SNPs) identified by mutation screening PCR-SSP methods were established according to standard protocols (23) and the primers are provided in Table III. In addition, PCR-SSP methods were developed for SCN5A variants 1062T>C, 354G>C, 287C>T and 1199G>C, which were associated with arrhythmia in previous studies (21,24). All patients and controls were genotyped for the SCN5A variants using PCR-SSP.

Table III

Primers for PCR-SSP typing of SCN5A variants.

Table III

Primers for PCR-SSP typing of SCN5A variants.

SCN5A variationGene regionDirectionSpecificitySequence (5′-3′)Size (bp)
−1062T>CPromoterSense1062T ccccataggtcctgggcat127
Sense1062C ccccataggtcctgggcac127
Antisense cagagcctggagtcacatac
−354G>CPromoterSense−354G ccgcggacagacagacatag138
Sense−354C gtatactctggcgggtgctgg138
Antisense gtatactctggcgggtgctgc
287C>TIntron 1Sense287C gtccctgcgtgctcctcc145
Sense287T gtccctgcgtgctcctct145
AntisenseGeneric ggcgcacggtgtttagagac
87G>AExon 2Sense87G catcgagaagcgcatggcg168
Sense87A catcgagaagcgcatggca168
AntisenseGeneric ggctctccgatgagctcttg
1199G>C (G400A)Exon 10SenseGeneric cctggcacaactagactagg
Antisense1199G gttcaccaggtagaaggacc166
Antisense1199C gttcaccaggtagaaggacg166
1673A>G (H558R)Exon 12Sense1673A ggagagcgagagccacca139
Sense1673G ggagagcgagagccaccg139
AntisenseGeneric ttgcagtccacagtgctgttc
IVS16C>TIntron 16SenseIVS16-6C gtgagcctgacccattatctc
SenseIVS16-6T gtgagcctgacccattatct299
AntisenseGeneric tggtggtgatgggctcgtag299
3578G>A (R1193Q)Exon 20Sense3578G agggaaggtctggtggcg304
Sense3578A agggaaggtctggtggca304
AntisenseGeneric tcctgctctggcctccatac
4786T>A (F1596I)Exon 27Sense4786T caacagctggaatatcttcgact148
Sense4786A caacagctggaatatcttcgaca148
AntisenseGeneric gaagctagggttgtacatgg
5457T>AExon 28Sense5457T tcctgtctgactttgccgat180
Sense5457A tcctgtctgactttgccgac180
AntisenseGeneric tcttcagggcgtccatctcc

[i] PCR-SSP, polymerase chain reaction with sequence-specific primers.

Statistical analysis

Fisher exact and χ2 tests were performed to investigate differences between the study cohorts in the baseline characteristics as well as allele and genotype frequencies of the SCN5A polymorphisms. SPSS statistical software version 12.0 (SPSS, Inc., Chicago, IL, USA) was used for the statistical analysis.

Results and Discussion

Screening for SCN5A sequence variations in the entire coding region and flanking intron regions was achieved by exon re-sequencing in 46 AMI/VF+ patients. In total, nine single nucleotide variations were identified and were all listed in the Single Nucleotide Polymorphism Database and LQTS gene Leiden Open Variation Database (25) (Table IV). Four variants (87G>A, 1673A>G, IVS16-6C>T and 5457T>A) represented common SNPs of which only 1673A>G (His558Arg) was a missense variant. However, all SNPs have previously been described as normal variants without an association with arrhythmia (2631).

Table IV

Single nucleotide variants identified in the SCN5A gene of AMI/VF+ patients.

Table IV

Single nucleotide variants identified in the SCN5A gene of AMI/VF+ patients.

Gene regionOccurenceaNucleotide changeAmino acid changedbSNPb
Exon 2Common87G>ANoners6599230
Exon 6bRare630G>ANoners193922727
Exon 12Common1673A>GHis558Argrs1805124
Intron 16CommonIVS16-6C>TUnknownrs41260344
Exon 17Rare3183G>ANoners7430407
Exon 20Rare3578G>AArg1193Glurs41261344
Exon 26Rare4509C>TNoners45548237
Exon 27Rare4786T>APhe1596Ilers199473278
Exon 28Common5457T>ANoners1805126

a Each rare variant was found in only one of the 46 analyzed AMI/VF+ patients.

{ label (or @symbol) needed for fn[@id='tfn6-mmr-10-04-2039'] } AMI, acute myocardial infarction; VF, ventricular fibrillation; single nucleotide polymorphism database (dbSNP);

b dbSNP reference number.

The 630G>A variant is rare and was found in exon 6b of one AMI/VF+ patient. The amino acids encoded by exon 6b are present in the major ‘adult’ SCN5A isoform, whereas exon 6a is alternatively spliced in the ‘neonatal’ isoform (9). However, the nucleotide change 630G>A does not alter the encoded amino acid and no effect on protein function was assumed. The variants 3183G>A and 4509C>T also represent rare and silent variants, each found in only one AMI/VF+ patient. The rare and silent variants were not further investigated in the present study.

In one AMI/VF+ patient (79 year old, male) the missense mutation 3578G>A (R1193Q) was identified. The mutation was described as a normal variant with a frequency of 0.3% in Caucasians (32). However, the mutation conducts a longer QT-time and an association with LQTS has been discussed (33,34). Associations have also been described with Brugada syndrome, progressive cardiac conduction defect (PCCD) and sudden infant death syndrome (30,34,35). Recently, the R1193Q variant was described in a young Korean patient (3 year old, male) with LQTS (36).

The missense mutation 4786T>A (F1596I) in exon 27 was found in one AMI/VF+ patient (54 year old, male). In a previous study the mutation was found in two out of 2,500 LQTS patients; however, not in the 1,300 individuals of the control group (37). An association with primary atrial fibrillation has been discussed; however, no evidence for an effect of the mutation on the channel function has been described (38).

In order to evaluate allele and genotype frequencies, the common SNPs (87G>A, 1673A>G, IVS16-6C>T and 5457T>A) were genotyped by PCR-SSP in all patients (49 AMI/VF+ and 74 AMI/VF) and controls (480 healthy blood donors). The differences in allele and genotype frequencies between the study groups were not identified to be statistically significant (Table V). The rare missense mutations (3578G>A and 4786T>A) were screened by PCR-SSP in AMI/VF patients and controls. None of the AMI/VF 74 patients were positive for the two mutations, whereas, one of the 480 controls was positive for the 3578G>A mutation. All study individuals were also screened for the SCN5A variants (1062T>C, 354G>C, 287C>T and 1199G>C) that were associated with arrhythmia in previous studies (21,24). However, none of the patients or controls were positive for these variants.

Table V

Genotype frequency of SCN5A variants.

Table V

Genotype frequency of SCN5A variants.

VariantGenotypeaAMI/VF+ n (%)AMI/VF n (%)Controls n (%)Significance (P-value)
−1062T>CTT49 (100)74 (100)480 (100)-
−354G>CGG49 (100)74 (100)480 (100)-
287C>TCC49 (100)74 (100)480 (100)-
87G>AGG31 (68.9)50 (69.4)294 (63.0)0.188b
GA12 (26.7)22 (30.6)158 (33.8)0.568c
AA2 (4.4)0 (0)15 (3.2)0.378d
1199G>CGG49 (100)74 (100)480 (100)-
1673A>GAA34 (69.4)46 (62.2)283 (59.3)0.712b
AG14 (28.6)26 (35.1)168 (35.2)0.345c
GG1 (2.0)2 (2.7)26 (5.5)0.277d
IVS16-6C>TCC45 (93.9)-444 (92.7)-
CT3 (6.1)-34 (7.1)0.919c
TT0 (0)-1 (0.2)-
3578G>AGG48 (98.0)74 (100)479 (99.8)-
GA1 (2.0)0 (0)1 (0.2)0.046c
AA0 (0)0 (0)0 (0)-
4786T>ATT48 (98.0)74 (100)480 (100)-
TA1 (2.0)0 (0)0 (0)-
AA0 (0)0 (0)0 (0)-
5457T>ATT20 (42.6)30 (44.8)208 (44.3)0.669b
TA20 (42.6)32 (47.8)209 (44.6)0.801c
AA7 (14.8)5 (7.4)52 (11.1)0.973d

a Genotypes: homozygous major allele, heterozygous, homozygous minor allele;

b P1: AMI/VF+ vs. AMI/VF;

c P2: AMI/VF+ vs. controls;

d P3: AMI vs. controls.

{ label (or @symbol) needed for fn[@id='tfn12-mmr-10-04-2039'] } AMI, acute myocardial infarction; VF, ventricular fibrillation.

In conclusion, mutations in the SCN5A gene are relatively uncommon in AMI/VF+ patients. In the present study only two out of 49 AMI/VF+ patients (4.1%) demonstrated SCN5A variants that may be the cause of VF.

Acknowledgements

This study was supported by the DZHK (German Centre for Cardiovascular Research) and by the BMBF (German Ministry of Education and Research).

References

1 

Zipes DP and Wellens HJ: Sudden cardiac death. Circulation. 98:2334–2351. 1998. View Article : Google Scholar

2 

Spooner PM, Albert C, Benjamin EJ, et al: Sudden cardiac death, genes, and arrhythmogenesis: consideration of new population and mechanistic approaches from a National Heart, Lung, and Blood Institute workshop, Part II. Circulation. 103:2447–2452. 2001. View Article : Google Scholar

3 

Zipes DP, Camm AJ, Borggrefe M, et al: European Heart Rhythm Association; Heart Rhythm Society; American College of Cardiology; American Heart Association Task Force; European Society of Cardiology Committee for Practice Guidelines: ACC/AHA/ESC 2006 guidelines for management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: a report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Develop Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death). J Am Coll Cardiol. 48:e247–e346. 2006.

4 

Friedlander Y, Siscovick DS, Weinmann S, et al: Family history as a risk factor for primary cardiac arrest. Circulation. 97:155–160. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Jouven X, Desnos M, Guerot C and Ducimetière P: Predicting sudden death in the population: the Paris Prospective Study I. Circulation. 99:1978–1983. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Kaikkonen KS, Kortelainen ML, Linna E and Huikuri HV: Family history and the risk of sudden cardiac death as a manifestation of an acute coronary event. Circulation. 114:1462–1467. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Novotny T, Kadlecova J, Raudenska M, et al: Mutation analysis ion channel genes ventricular fibrillation survivors with coronary artery disease. Pacing Clin Electrophysiol. 34:742–749. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Rook MB, Evers MM, Vos MA and Bierhuizen MF: Biology of cardiac sodium channel Nav1.5 expression. Cardiovasc Res. 93:12–23. 2012. View Article : Google Scholar

9 

Schroeter A, Walzik S, Blechschmidt S, Haufe V, Benndorf K and Zimmer T: Structure and function of splice variants of the cardiac voltage-gated sodium channel Na(v)1.5. J Mol Cell Cardiol. 49:16–24. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Tfelt-Hansen J, Winkel BG, Grunnet M and Jespersen T: Inherited cardiac diseases caused by mutations in the Nav1.5 sodium channel. J Cardiovasc Electrophysiol. 21:107–115. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Kapplinger JD, Tester DJ, Alders M, et al: An international compendium of mutations in the SCN5A-encoded cardiac sodium channel in patients referred for Brugada syndrome genetic testing. Heart Rhythm. 7:33–46. 2010. View Article : Google Scholar

12 

Remme CA, Wilde AA and Bezzina CR: Cardiac sodium channel overlap syndromes: different faces of SCN5A mutations. Trends Cardiovasc Med. 18:78–87. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Ruan Y, Liu N and Priori SG: Sodium channel mutations and arrhythmias. Nat Rev Cardiol. 6:337–348. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Wang DW, Desai RR, Crotti L, et al: Cardiac sodium channel dysfunction in sudden infant death syndrome. Circulation. 115:368–376. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Watanabe H, Nogami A, Ohkubo K, et al: Electrocardiographic characteristics and SCN5A mutations in idiopathic ventricular fibrillation associated with early repolarization. Circ Arrhythm Electrophysiol. 4:874–881. 2011. View Article : Google Scholar

16 

Park JK, Martin LJ, Zhang X, Jegga AG and Benson DW: Genetic variants in SCN5A promoter are associated with arrhythmia phenotype severity in patients with heterozygous loss-of-function mutation. Heart Rhythm. 9:1090–1096. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Marangoni S, Di Resta C, Rocchetti M, et al: A Brugada syndrome mutation (p. S216L) and its modulation by pH558R polymorphism: standard and dynamic characterization. Cardiovasc Res. 91:606–616. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Cheng J, Tester DJ, Tan BH, et al: The common African American polymorphism SCN5A-S1103Y interacts with mutation SCN5A-R680H to increase late Na current. Physiol Genomics. 43:461–466. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Shinlapawittayatorn K, Du XX, Liu H, Ficker E, Kaufman ES and Deschênes I: A common SCN5A polymorphism modulates the biophysical defects of SCN5A mutations. Heart Rhythm. 8:455–462. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Lahtinen AM, Noseworthy PA, Havulinna AS, et al: Common genetic variants associated with sudden cardiac death: the FinSCDgen study. PLoS One. 7:e416752012. View Article : Google Scholar : PubMed/NCBI

21 

Hu D, Viskin S, Oliva A, et al: Novel mutation in the SCN5A gene associated with arrhythmic storm development during acute myocardial infarction. Heart Rhythm. 4:1072–1080. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Elmas E, Bugert P, Popp T, Lang S, Weiss C, Behnes M, Borggrefe M and Kälsch T: The P-selectin gene polymorphism Val168Met: a novel risk marker for the occurrence of primary ventricular fibrillation during acute myocardial infarction. J Cardiovasc Electrophysiol. 21:1260–1265. 2010. View Article : Google Scholar

23 

Bugert P, Lese A, Meckies J, Zieger W, Eichler H and Klüter H: Optimized sensitivity of allele-specific PCR for prenatal typing of human platelet alloantigen single nucleotide polymorphisms. Biotechniques. 35:170–174. 2003.

24 

Bezzina CR, Shimizu W, Yang P, et al: Common sodium channel promoter haplotype in asian subjects underlies variability in cardiac conduction. Circulation. 113:338–344. 2006. View Article : Google Scholar

25 

Zhang T, Moss A, Cong P, et al: LQTS gene LOVD database. Hum Mutat. 31:E1801–E1810. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Ackerman MJ, Siu BL, Sturner WQ, Tester DJ, Valdivia CR, Makielski JC and Towbin JA: Postmortem molecular analysis of SCN5A defects in sudden infant death syndrome. JAMA. 286:2264–2269. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Takahata T, Yasui-Furukori N, Sasaki S, Igarashi T, Okumura K, Munakata A and Tateishi T: Nucleotide changes in the translated region of SCN5A from Japanese patients with Brugada syndrome and control subjects. Life Sci. 72:2391–2399. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Gouas L, Nicaud V, Berthet M, Forhan A, Tiret L, Balkau B and Guicheney P: Association of KCNQ1, KCNE1, KCNH2 and SCN5A polymorphisms with QTc interval length in a healthy population. Eur J Hum Genet. 13:1213–1222. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Lai LP, Su YN, Hsieh FJ, et al: Denaturing high-performance liquid chromatography screening of the long QT syndrome-related cardiac sodium and potassium channel genes and identification of novel mutations and single nucleotide polymorphisms. J Hum Genet. 50:490–496. 2005. View Article : Google Scholar

30 

Arnestad M, Crotti L, Rognum TO, et al: Prevalence of long-QT syndrome gene variants in sudden infant death syndrome. Circulation. 115:361–367. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Zhang Y, Chang B, Hu S, et al: Single nucleotide polymorphisms and haplotype of four genes encoding cardiac ion channels in Chinese and their association with arrhythmia. Ann Noninvasive Electrocardiol. 13:180–190. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Ackerman MJ, Splawski I, Makielski JC, et al: Spectrum and prevalence of cardiac sodium channel variants among black, white, Asian, and Hispanic individuals: implications for arrhythmogenic susceptibility and Brugada/long QT syndrome genetic testing. Heart Rhythm. 1:600–607. 2004. View Article : Google Scholar

33 

Wang Q, Chen S, Chen Q, et al: The common SCN5A mutation R1193Q causes LQTS-type electrophysiological alterations of the cardiac sodium channel. J Med Genet. 41:e662004. View Article : Google Scholar : PubMed/NCBI

34 

Sun A, Xu L, Wang S, et al: SCN5A R1193Q polymorphism associated with progressive cardiac conduction defects and long QT syndrome in a Chinese family. J Med Genet. 45:127–128. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Huang H, Zhao J, Barrane FZ, Champagne J and Chahine M: Nav1.5/R1193Q polymorphism is associated with both long QT and Brugada syndromes. Can J Cardiol. 22:309–313. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Kwon HW, Lee SY, Kwon BS, et al: Long QT syndrome and dilated cardiomyopathy with SCN5A p. R1193Q polymorphism: cardioverter-defibrillator implantation at 27 months. Pacing Clin Electrophysiol. 35:e243–e246. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Kapplinger JD, Tester DJ, Salisbury BA, et al: Spectrum and prevalence of mutations from the first 2,500 consecutive unrelated patients referred for the FAMILION long QT syndrome genetic test. Heart Rhythm. 6:1297–1303. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Olesen MS, Yuan L, Liang B, et al: High prevalence of long QT syndrome-associated SCN5A variants in patients with early-onset lone atrial fibrillation. Circ Cardiovasc Genet. 5:450–459. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October 2014
Volume 10 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Boehringer T, Bugert P, Borggrefe M and Elmas E: SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction. Mol Med Rep 10: 2039-2044, 2014
APA
Boehringer, T., Bugert, P., Borggrefe, M., & Elmas, E. (2014). SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction. Molecular Medicine Reports, 10, 2039-2044. https://doi.org/10.3892/mmr.2014.2401
MLA
Boehringer, T., Bugert, P., Borggrefe, M., Elmas, E."SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction". Molecular Medicine Reports 10.4 (2014): 2039-2044.
Chicago
Boehringer, T., Bugert, P., Borggrefe, M., Elmas, E."SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction". Molecular Medicine Reports 10, no. 4 (2014): 2039-2044. https://doi.org/10.3892/mmr.2014.2401