International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Malignant glioma is the most common brain tumor, with a high ability of invasion, metastasis and recurrence and poor prognosis (1). Current treatment options, including surgery, chemotherapy and radiotherapy, have undesirable outcomes, and therefore, novel therapeutic strategies are required (2).
Gene therapy has been shown to be an alternative, efficient therapeutic strategy for glioma treatment. Tumor suppressor genes, such as p53, and small hairpin (sh)RNA for oncogenes, can be delivered into glioma cells (3,4).
The WNT/β-catenin pathway has been well documented to be essential for the proliferation, survival, metastasis and neoangiogenesis of glioma cells (5). The WNT gene family consists of 19 members, which are soluble ligands for the cellular transmembranal receptors Frizzled and low density lipoprotein receptor-related protein (6). For glioma, WNT5a and WNT7b (particularly WNT5a) are overexpressed and secreted into the extracellular space in an autocrine or paracrine manner (6). Subsequently, WNT proteins activate downstream signaling through β-catenin-dependent and -independent mechanisms. The activation of the WNT/β-catenin pathway ultimately regulates cell proliferation, motility and tumorigenicity of glioma cells (7). Decreased expression of WNT inhibitors is a predominant mechanism causing ectopic activation of WNT signaling in glioma. Epigenetic silencing of WNT pathway inhibitor genes by supermethylation of their promoters accounts for the enhanced activation of WNT signaling in certain cases of glioma (8). A study using β-catenin small interfering (si)RNA demonstrated that targeting the WNT pathway reduces glioma growth (9). Suppression of the WNT pathway therefore appears to be an effective anti-glioma strategy.
The TIKI gene family of proteases have been previously identified as a new class of WNT inhibitors, which utilize a distinct mechanism to negatively regulate the activation of WNT signaling (10). The human transcript has two TIKI orthologs, TIKI-1 and TIKI-2. TIKIs have three separate functional domains: i) Signal peptide sequence; ii) TIKI domain; and iii) transmembrane domain. The TIKI domain is highly conserved between different organisms and exerts the predominant protease activity for WNTs. This can result in the removal of several N-terminal amino acids from the mature WNT proteins, or its immature form in the endoplasmic reticulum (ER), thereby inducing oligomerization of WNT proteins and minimizing their activity. siRNA-mediated TIKI2 downregulation potentiates the WNT-3a-induced WNT pathway in mammalian cells. Overexpression of TIKI proteins has been shown to be able to suppress the WNT/β-catenin pathway (10). This indicated that adenoviral vector-based TIKI expression may be an effective method to treat glioma. However, to date, the association of TIKIs with glioma and the effect of TIKI gene therapy for glioma have remained to be investigated.
In the present study, miRNA response elements (MREs) of tumor suppressor miR-124, which have previously caused reduced expression levels in a number of glioma cells (11), were constructed in an adenoviral vector with glioma specificity. Subsequently, this vector was used to express TIKI2 to suppress the aberrant WNT activation in glioma cells, aiming to impair the proliferation, invasion and tumorigenesis of glioma cells both in vitro and in vivo.
Human glioma, U-87 MG, U-251 MG, U-373 MG and M059J, neuronal, HCN-2, fibroblast, MRC-5 and BJ, and endothelial, HUV-EC-C, cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Human L-02 normal liver cells were obtained from the Shanghai Cell Collection (Shanghai, China). Cells were cultured using recommended media supplemented with 10% of fetal bovine serum (FBS; Invitrogen Life Technologies, Carlsbad, CA, USA), 4 mm glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin in a 5% CO2 and humidified atmosphere at 37°C. Media included the following: ATCC-formulated Eagle’s Minimum Essential Medium for U-87 MG, U-251 MG, U-373 MG, MRC-5 and BJ; Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 medium (1:1) for M059J; DMEM for HCN-2; ATCC-formulated of F-12K Medium for HUV-EC-C; and RPMI-1640 for L-02 (All media were purchased from Invitrogen Life Technologies)
For primary astrocyte culture, cell samples were obtained from aborted fetuses with informed consent from the pregnant females, according to the previously published procedures approved by the Ethical Review Board of Xinxiang Center Hospital (Xinxiang, China). Briefly, brain tissue from the anterior fontanelle was dissected into pieces with the removal of meninges, followed by trypsin digestion. The digested cells were filtered using a steel net and cultured in DMEM supplemented with 15% FBS. Glial fibrillary acidic protein (GFAP) expression was confirmed by immunofluorescent staining.
Fresh cancerous and noncancerous brain tissues (n=9) were obtained with written informed consent from all patients according to protocols approved by Ethical Review Board in Xinxiang Center Hospital (Xinxiang, China), in order to analyze miR-124 expression. All patients underwent surgical resection of primary glioma at Xinxiang Center Hospital (Xinxiang, China).
Total RNA was extracted from glioma and noncancerous brain tissue as well as from the indicated cell lines using TRIzol™ solution (Sigma-Aldrich, St Louis, MO, USA). The reverse transcription reaction was performed using the TaqMan® MicroRNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions. qPCR was performed using TaqMan® 2× Universal PCR Master Mix (Applied Biosystems) on a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) supplied with LightCycler Data Analysis software, version 3.5 (Roche Diagnostics, Basel, Switzerland).
To determine the abundance of TIKI2 mRNA in adenovirus (Ad)-infected cells, a multiplicity of infection (MOI) of 10 of the indicated adenoviruses were added to the cell cultures. Following 48 h, cells were harvested for RNA extraction, followed by reverse transcription into cDNAs using Rever Tra Ace qPCR RT Kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. The 7.5-μl reactions were incubated for 30 min at 16°C, 30 min at 42°C, 5 min at 85°C and then held at 4°C. qPCR was performed using TaqMan® 2× Universal PCR Master Mix (Applied Biosystems) using a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories) supplied with analytical software. The following primers were used: TIKI2, forward 5′-GACCTGCGTGCTGATC-3′ and reverse 5′-TAAAAGAAGATGACAG-3′; Axin2, forward 5′-CCGGTGGACCAAGTCCTTAC-3′ and reverse 5′-TCCATTGCAGGCAAACCAGA-3′; Lgr5, forward 5′-TGAACACCTGCTTGATGGCT-3′ and reverse 5′-TGCTGCGATGACCCCAATTA-3′. The housekeeping gene was GAPDH, forward 5′-TCAGTGGTGGACCTG ACCTG-3′; reverse 5′-TGCTGTAGCCAAATT CGTTG-3′.
The sense and antisense sequences containing four copies of the miR-124 MREs were synthesized, annealed and inserted into the XhoI and NotI sites of psiCheck2 vectors (Promega Corp., Madison, WI, USA) immediately following the Renilla luciferase gene, in order to construct an MRE-regulated luciferase reporter, namely psiCheck2-124. The inserted MRE sequence for the miRNAs used in the present study was as follows: 5′-TCGAGGATATCACAAACACCGTGCCTTAAACA AACA CCGTGCCTTAAACAAACACCGTGCCTTAAACAAACA CCGTGCCTTAAACAAACACCGATATCGC-3′; 5′-GGCC GCGATATCGGTGTTTGTTTAAGGCACGGTGTTTGT TTAAGGCACGGTGTTTGTTTAAGGCACGGTGTTTGT TTAAGGCACGGTGTTTGTGATATCC-3′. Italicization indicates endonuclease site.
Following 48 h of transfection of U-87 MG, U-251 MG, astrocyte, MRC-5 and L-02 cells, the cells were harvested and treated with lysis buffer. Firefly and Renilla luciferase activities were determined with using the Dual-Luciferase reporter system (Promega Corp.) following the manufacturers instructions.
Adenovirus Ad-enhanced green fluorescent protein (EGFP) was kindly provided by Dr. Zhao (General Hospital of Chengdu Military Area Command of Chinese PLA, Chengdu, China). Ad-TIKI2 was constructed using the procedures described below. The sequence of the human TIKI2 gene used in this study was available from GenBank (accession no., JQ653416). The cDNA templates were obtained from HeLa cells. A set of primers was used for PCR-based TIKI2 gene amplification: Forward 5′-GCCGTCGACACCATGCACGCCGCCCTG-3′ and reverse 5′-GCCGATATCTCAGGAGGGCCCAA-3′. The PCR product was digested with SalI and EcoRV restriction endonucleases and then inserted into the pShuttle-cytomegalovirus (CMV) vector at the same site, to become pShuttle-CMV-TIKI2. For the construction of the pShuttle-CMV-TIKI2-124, the DNA fragment containing four copies of the miR-124 MREs was released by digestion with EcoRV from the psiCheck2-124 vector, followed by insertion into the same site of the pShuttle-CMV-TIKI2 to generate the pShuttle-CMV-TIKI2-124 construct.
The pShuttle-CMV-TIKI2 and pShuttle-CMV-TIKI2-124 constructs were co-transfected using pAdEasy into human HEK-293 embryonic kidney cells with Lipofectamine 2000 transfection reagent (Invitrogen Life Technologies). Following three rounds of plaque purification and PCR-based identification, the adenoviruses (Ad-TIKI2 and Ad-TIKI2-124) were harvested and purified by CsCl gradient centrifugation. The titers of the adenoviruses were determined using the TCID50 method (12) in HEK-293 cells and shown as plaque-forming units per milliliter (pfu/ml).
To determine the expression levels of phosphorylated and total β-catenin in adenovirus-infected cells, 10 MOIs of the indicated adenoviruses were added to the cell cultures. After 48 h, the proteins were harvested using an M-PER® Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Waltham, MA, USA), separated by polyacrylamide gel electrophoresis and transferred onto 0.45 μm nitrocellulose membranes. The membranes were then blocked with 5% fat-free dry milk for 2 h. The membrane was incubated with monoclonal rabbit IgG against p-β-catenin (1:1,000), β-catenin (1:1,000) and GAPDH (1:2,000) primary antibodies (Cell Signaling Technology, Inc., Danvers, MA, USA) for 2 h, and then incubated overnight with the corresponding secondary antibody (polyclonal goat IgG against rabbit IgG, 1:10,000; ZSGB-BIO, Beijing, China). The membranes were visualized using SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific) and the ChemiDoc XRS+ chemiluminescence imaging system (Bio-Rad Laboratories).
The activation of endogenous WNT signaling was further examined by a TCF reporter dual luciferase assay. Glioma cells were seeded in 24-well tissue culture plates and transfected with the TCF reporter vector (TOPflash) (Millipore, Billercia, MA, USA) and control Renilla luciferase reporter vector (pRL-TK) (40:1) (Promega Corportation), using Lipofectamine 2000 (Invitrogen Life Technologies). Overnight, cells were infected with the indicated adenoviruses of 10 MOI. Forty-eight hours following adenovirus administration, the cells were collected and resuspended in lysis buffer (Promega Corp.) and the levels of luciferase activity were monitored for the adenovirus and Renilla expression levels using the Dual-Luciferase Reporter Assay kit and a luminometer (Promega Corp.) according to the manufacturer’s instructions. All experiments were performed in triplicate.
Adenoviral vectors of indicated MOIs were added to the cell cultures. Following transduction for the indicated times, 50 ml MTT (1 mg/ml) was added. The MTT reagent was removed after 4 h and 150 ml dimethyl sulfoxide was added. The spectrophotometric absorbance was measured on a model 550 microplate reader (Bio-Rad Laboratories) at 570 nm, with a reference wavelength of 655 nm. Cell viability was calculated according to the following formula: Cell viability = absorbance value of infected cells/absorbance value of uninfected control cells.
The cells were transduced with Ad-TIKI2, Ad-TIKI2-124 or Ad-EGFP of 10 MOI for 48 h. The cells were then harvested and fixed in 70% ethanol and stained with propidium iodide (PI; 200 mg/ml) for cytometrical analysis using an Aria II sorter (BD Biosciences, San Diego, CA, USA). For each group, 10,000 cells were counted to determine the percentages of the sub-G0/G1 population.
To determine the contact-independent colony formation efficiency, cells were seeded into low-attachment 96-well plates (Corning Life Sciences, Cambridge, MA, USA) at a density of 10 cells per well. The cells were infected with 10 MOI of Ad-EGFP, Ad-TIKI2 or Ad-TIKI2-124 and maintained in stem cell medium. Equal volumes of fresh media were replaced to replenish the growth factors and nutrients every three days. Methyl cellulose (1%) (Sigma-Aldrich) was added to prevent cell aggregation. In this way, an individual sphere derived from a single cell was produced. Cells were incubated for 14 days and then the number of wells which contained spheres with a diameter >75 μm were counted. The experiments were performed in triplicate.
The effect of Ad-TIKI2 and Ad-TIKI2-124 on the invasion of glioma cells was evaluated using the Transwell® assay in a 24-well plate (Corning Life Sciences). The Transwell membrane with 8.0 μm pores was coated with or without Matrigel® (1 μg/μl; BD Biosciences). Cells were infected with 10 MOI of adenoviruses and resuspended in DMEM/F12 basic medium. The cells were then seeded in the upper chambers (5×104 cells each). The nutritional attractant in the lower chambers was DMEM/F12 medium containing 10% FBS. Subsequently, the cells were allowed to migrate for 24 h. The migrant cells on the membranes of the lower chambers were stained with crystal violet and then the cells in ≥10 randomly selected microscopic fields at 100× magnification were counted and expressed as the invasive cells per microscopic field. All the experiments were performed in triplicate.
The procedures for animal experiments were approved by the Committee for the Use and Care on Animals in the Xinxiang Center Hospital (Xinxiang, China).
A U-87 MG tumor xenograft model was established by injecting 2×106 cells into the right flanks of five-week-old male BALB/c nude mice (obtained from the Shanghai Laboratory Animal Center, Shanghai, China) The mice were kept at an 18–22°C aired condition with 50–60% humidity. As soon as tumors grew to 6–8 mm in diameter, 24 mice were randomly and equally divided into four groups (n=6). The mice were intratumorally injected with 100 μl phosphate-buffered saline (PBS), with or without 2×108 pfu of Ad-EGFP, Ad-TIKI2 and Ad-TIKI2-124, respectively. The injections were repeated every other day for five times, with a total dosage of 1×109 pfu of adenoviruses.
The tumor diameter was measured by periodic measurements using calipers and the volume was calculated using the following formula: Tumor volume (mm3) = maximal length (mm) × [perpendicular width (mm)]2/2. The tumor weights were measured when the mice were sacrificed. Immunohistological staining was used to determine the localization of β-catenin in the sections of established glioma.
Each experiment was performed at least three times. All values are expressed as the mean ± standard deviation, and compared with the unpaired two-tailed t-test. P<0.05 was considered to indicate a statistically significant difference.
The first aim of the present study was to construct a glioma-specific expression vector for exogenous genes, including TIKI2. miR-124 has been shown to be underexpressed in glioma cells as compared with noncancerous brain tissue; therefore, the MREs of miR-124 were used to restrict exogenous gene expression within glioma cells for subsequent experiments. The levels of miR-124 were confirmed to be downregulated in glioma cell lines (Fig. 1A) and primary glioma from patients (Fig. 1B) by qPCR assays. Subsequently, a luciferase reporter assay was used to verify the effectiveness of the miR-124 MREs in the regulation of inserted genes (Fig. 1C). The data indicated that the MREs-regulated psiCheck2 vector expressed luciferase in a glioma-selective fashion (Fig. 1D).
An adenoviral vector expressing TIKI2 was constructed, which harbored four copies of MREs of miR-124 following the coding region of TIKI2 (Ad-TIKI2-124) (Fig. 2A). The Ad-TIKI2-124, and Ad-TIKI2 and Ad-EGFP control vectors were transduced into U-87 MG and U-251 MG cells. qPCR assays confirmed that TIKI2 was highly expressed in the tested glioma cells infected with both Ad-TIKI2-124 and Ad-TIKI2 (Fig. 2B). Immunoblot analysis of β-catenin expression revealed that the phosphorylation of β-catenin was enhanced in Ad-TIKI2-124- and Ad-TIKI2-infected glioma cells, with a reduced stabilization of β-catenin (Fig. 2C). TOPFlash reporter experiments indicated that the transcriptional activity of transcription factor/lymphoid enhancer-binding factor (TCF/LEF), the major downstream effector in the WNT/β-catenin pathway, was potently inhibited in the glioma cells infected with the two distinct TIKI2-expressing adenoviruses (Fig. 2D). The mRNA abundance of the WNT signaling target genes was markedly decreased in U-87 MG and U-251 MG cells upon infection with Ad-TIKI2-124 and Ad-TIKI2 (Fig. 2E).
The effects of the TIKI2-expressing adenoviral vector on the biological traits of glioma cells was analyzed. MTT assays indicated that Ad-TIKI2-124 and Ad-TIKI2 was able to decelerate the proliferation of glioma cells (Fig. 3A). The determination of the sub-G0/G1 subpopulation revealed that TIKI2 expression lead to an increase in the percentage of apoptotic U-87 MG and U-251 MG cells (Fig. 3B). Furthermore, soft agar assays showed that Ad-TIKI2-124 and Ad-TIKI2 infection of glioma cells greatly compromised the colony formation ability, evidenced by a markedly lower number of colonies detected in the group transduced with the two vectors as compared with the group infected with Ad-EGFP (Fig. 3C). Finally, the motility and invasion capacity of glioma cells were found to be highly impaired when TIKI2 expression mediated by the infected adenoviruses occurred (Fig. 3D and E).
The antitumor activity of TIKI2 was further studied in a mouse model. U-87 MG cells were subcutaneously injected into the flanks of mice. When the tumor grew to 8–10 mm, Ad-TIKI2, Ad-TIKI2-124, Ad-EGFP and PBS were intratumorally administrated. The diameter of these tumors was periodically measured using a caliper and their sizes were calculated (Fig. 4A). The weights of U-87 MG cells are presented in Fig. 4B. Immunohistological staining revealed that extranuclear translocation of β-catenin frequently occurred in the tumors treated with Ad-TIKI2 and Ad-TIKI2-124, while β-catenin accumulated in the nuclei of Ad-EGFP and PBS-injected tumors (Fig. 4C).
The effect of TIKI2 expression was a major concern in the present study. It was therefore investigated whether TIKI2 is able to affect the activation of WNT signaling in normal cells and induce cytotoxicity. qPCR assays revealed that TIKI2 expression was suppressed in normal cells infected with Ad-TIKI2-124, which may be due to the existence of miR-124 in these cell lines (Fig. 5A). Immunoblot assays indicated that β-catenin was stabilized in astrocyte and L-02 cells infected with Ad-TIKI2-124 (Fig. 5B), suggesting that WNT signaling was not affected by the treatment of Ad-TIKI2-124. In addition, the percentage of sub-G0/G1 cells was not altered in Ad-TIKI2-124-transduced normal cells, as compared with Ad-EGFP-infected cells (Fig. 5C). Finally, MTT assays revealed that there was no significant cytotoxicity to normal cells when Ad-TIKI2-124 was added to the cultures (Fig. 5D).
There has been extensive research into glioma gene therapy for many years. A recent phase III clinical trial revealed that adenovirus-mediated herpes simplex virus thymidine kinase (HSV-tk) expression significantly prolonged the survival of glioma patients (13). This encouraging result is expected to attract increasing attention from additional researchers.
The suppressor selected for glioma gene therapy is critical to ensure effective treatment. To date, numerous genes have been trialled for glioma therapy (14). In addition to HSV-tk, key genes in the glioma-specific molecular pathways have additionally been studied for gene therapy. Adenovirus-mediated delivery of calreticulin and melanoma-associated antigen 3 has been shown to inhibit invasion and angiogenesis of U-87 MG glioblastoma cells through suppression of the metastasis-associated pathway (15). TNF-related apoptosis-inducing ligand and arresten expression mediated by adenoviral vectors have also been demonstrated to potently suppress glioma cell growth by targeting its survival pathway (16). Adenovirus-mediated delivery of basic fibroblast growth factor small interfering RNA was found to suppress the activation of signal transducer and activator of transcription 3 signaling, and thus, induce the apoptosis in U-251 MG glioma cells (17).
Aberrant WNT/β-catenin signaling has been shown to have a central function in the development of glioblastoma (5). Proliferation, apoptosis and invasion have been identified to be affected by the activation of WNT/β-catenin signaling. Various miRNAs and small molecular compounds have been shown to exert anti-glioma activity by suppressing the activation of the WNT pathway (5), suggesting that targeting this pathway may be an effective strategy for glioma gene therapy. The current strategy used to suppress the activation of WNT signaling is by transfection of glioma cells with β-catenin siRNA (9); however, the therapeutic effect is limited by the low efficiency of transfection.
In the present study, a distinct method to suppress the activation of the WNT pathway was employed. TIKI2, a protease specific for WNT protein inactivation, was inserted into adenoviral vectors for intracellular expression in glioma cells. Subsequent experiments revealed that TIKI2 potently inhibited WNT/β-catenin signaling in glioma cell lines.
To improve the biosafety of TIKI2 expression-based gene therapy, MREs of miR-124 were utilized to confer its expression with high selectivity for glioma cells. Previous studies have demonstrated that the application miRNA MREs is able to regulate exogenous gene expression in a glioma-specific fashion (18–21). To further improve the selectivity of gene expression mediated by adenoviral vectors, additional miRNA MREs may be selected for glioma therapy. miR-122, a liver-enriched miRNA, can be used to further reduce the cytotoxicity induced by TIKI2 expression in hepatic cells (21).
In addition to the TIKI gene family, other WNT inhibitors could also be used for glioma gene therapy. Dickkopf WNT signaling pathway inhibitor 1 (DKK1) has been shown to suppress the proliferation of glioma cells, secreted from mesenchymal stem cells of the umbilical cord (22), and a therapeutic effect of DKK1 expression has additionally been verified in gastric cancers (23). Therefore, DKK1 may also be selected as an exogenous gene for MRE-regulated adenoviral vector overexpression in future studies.
Finally, the fiber region of adenoviral vectors can be reconstructed to enhance infectiveness for glioma cells. Currently, a 5/35 chimeric adenovirus that harbors a fused fiber protein from the two different serotypes has been tested for glioma gene therapy (24), and this recombinant adenovirus has been used in gene therapy treatment of a wide range of cancers (23,12). In future experiments, the 5/35 adenoviral vector may be used to express TIKI2 in order to potently suppress WNT signaling.
In conclusion, a TIKI2 expressing adenovirus regulated by MREs of miR-124 was investigated for its use in glioma therapy. Experimental data confirmed that this strategy is highly effective for glioma treatment and may be promising for clinical application.
|
Reardon DA, Galanis E, DeGroot JF, et al: Clinical trial end points for high-grade glioma: the evolving landscape. Neuro Oncol. 13:353–361. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Recławowicz D, Stempniewicz M, Biernat W and Słoniewski P: Modern approach to WHO grade II glioma classification and treatment – review of the literature. Neurol Neurochir Pol. 42:536–545. 2008.PubMed/NCBI | |
|
Mitlianga PG, Sioka C, Vartholomatos G, et al: p53 enhances the Delta-24 conditionally replicative adenovirus anti-glioma effect. Oncol Rep. 15:149–153. 2006.PubMed/NCBI | |
|
Wang X, Han L, Zhang A, et al: Adenovirus-mediated shRNAs for co-repression of miR-221 and miR-222 expression and function in glioblastoma cells. Oncol Rep. 25:97–105. 2011.PubMed/NCBI | |
|
Zhang K, Zhang J, Han L, Pu P and Kang C: Wnt/beta-catenin signaling in glioma. J Neuroimmune Pharmacol. 7:740–749. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Clevers H and Nusse R: Wnt/β-catenin signaling and disease. Cell. 149:1192–1205. 2012. | |
|
Kamino M, Kishida M, Kibe T, et al: Wnt-5a signaling is correlated with infiltrative activity in human glioma by inducing cellular migration and MMP-2. Cancer Sci. 102:540–548. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Gotze S, Wolter M, Reifenberger G, Muller O and Sievers S: Frequent promoter hypermethylation of Wnt pathway inhibitor genes in malignant astrocytic gliomas. Int J Cancer. 126:2584–2593. 2010.PubMed/NCBI | |
|
Pu P, Zhang Z, Kang C, et al: Downregulation of Wnt2 and beta-catenin by siRNA suppresses malignant glioma cell growth. Cancer Gene Ther. 16:351–361. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang X, Abreu JG, Yokota C, et al: Tiki1 is required for head formation via Wnt cleavage-oxidation and inactivation. Cell. 149:1565–1577. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Xia H, Cheung WK, Ng SS, et al: Loss of brain-enriched miR-124 microRNA enhances stem-like traits and invasiveness of glioma cells. J Biol Chem. 287:9962–9971. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
He X, Liu J, Yang C, et al: 5/35 fiber-modified conditionally replicative adenovirus armed with p53 shows increased tumor-suppressing capacity to breast cancer cells. Hum Gene Ther. 22:283–292. 2011. View Article : Google Scholar | |
|
Westphal M, Ylä-Herttuala S, Martin J, et al: Adenovirus-mediated gene therapy with sitimagene ceradenovec followed by intravenous ganciclovir for patients with operable high-grade glioma (ASPECT): a randomised, open-label, phase 3 trial. Lancet Oncol. 14:823–833. 2013. View Article : Google Scholar | |
|
Tobias A, Ahmed A, Moon KS and Lesniak MS: The art of gene therapy for glioma: a review of the challenging road to the bedside. J Neurol Neurosurg Psychiatry. 84:213–222. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Liu XL, Zhao D, Sun DP, et al: Adenovirus-mediated delivery of CALR and MAGE-A3 inhibits invasion and angiogenesis of glioblastoma cell line U87. J Exp Clin Cancer Res. 31:82012. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Mao Q, Wang D, Zhang W and Xia H: A fiber chimeric CRAd vector Ad5/11-D24 double-armed with TRAIL and arresten for enhanced glioblastoma therapy. Hum Gene Ther. 23:589–596. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Liu J, Xu X, Feng X, Zhang B and Wang J: Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251. J Exp Clin Cancer Res. 30:802011. View Article : Google Scholar : PubMed/NCBI | |
|
Bo Y, Guo G and Yao W: MiRNA-mediated tumor specific delivery of TRAIL reduced glioma growth. J Neurooncol. 112:27–37. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao Y, Li Y, Wang L, et al: microRNA response elements-regulated TRAIL expression shows specific survival-suppressing activity on bladder cancer. J Exp Clin Cancer Res. 32:102013. View Article : Google Scholar | |
|
Liu J, Ma L, Li C, et al: Tumor-targeting TRAIL expression mediated by miRNA response elements suppressed growth of uveal melanoma cells. Mol Oncol. 2013.PubMed/NCBI | |
|
Ma L, Liu J, Shen J, et al: Expression of miR-122 mediated by adenoviral vector induces apoptosis and cell cycle arrest of cancer cells. Cancer Biol Ther. 9:554–561. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ma S, Liang S, Jiao H, et al: Human umbilical cord mesenchymal stem cells inhibit C6 glioma growth via secretion of dickkopf-1 (DKK1). Mol Cell Biochem. 2013.PubMed/NCBI | |
|
Wang B, Liu J, Ma LN, et al: Chimeric 5/35 adenovirus-mediated Dickkopf-1 overexpression suppressed tumorigenicity of CD44+ gastric cancer cells via attenuating Wnt signaling. J Gastroenterol. 48:798–808. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hoffmann D, Meyer B and Wildner O: Improved glioblastoma treatment with Ad5/35 fiber chimeric conditionally replicating adenoviruses. J Gene Med. 9:764–778. 2007. View Article : Google Scholar |