Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2014 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array

  • Authors:
    • Yijian Zhu
    • Mingfu Ma
    • Ling Wan
    • Danyan Zhang
    • Letian Zhao
    • Li Wei
    • Lianbing Li
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Birth Defects and Reproductive Health of The National Health and Family Planning Commission (Chongqing Population and Family Planning Science and Technology Research Institute), Chongqing 400020, P.R. China
  • Pages: 2949-2954
    |
    Published online on: October 14, 2014
       https://doi.org/10.3892/mmr.2014.2634
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to investigate the association between two single nucleotide polymorphisms (SNPs) and infertility in Chinese males using multi-analyte suspension array (MASA). A total of 196 male patients with azoospermia or severe oligospermia (sperm density <5x106/ml, non‑obstructed) who had a normal karyotype and no azoospermia factor microdeletions were recruited, along with 40 healthy, fertile males as controls. Two SNPs of the deleted in azoospermia-like (DAZL) gene, SNP260 and SNP386, were genotyped by allele‑specific primer extension (ASPE) combined with MASA technology. The SNP260A>G and SNP386A>G mutations were found in the males with infertility. The SNP260, but not the SNP386, mutation was detectable in the control group. The mutation rates in the controls and patients were 2.5 and 3.06% for SNP260, and 0 and 2.04% for SNP386, respectively. A χ2 analysis did not identify any significant differences in the frequency of either mutation between the fertile and infertile males. In conclusion, the combination of ASPE and MASA methods for SNP genotyping was high‑throughput, accurate and cost‑efficient. The method was applied to detect SNP polymorphisms in the DAZL gene; and neither the A260G nor the A386G polymorphism of DAZL appeared to be involved in male infertility in the Chinese population.

Introduction

Male infertility is considered to be associated with azoospermia factor (AZF), one of several genes located in the Yq11 chromosomal region. The most common mutations identified in AZF are microdeletions in AZFc (60%) (1,2). The members of the deleted in azoospermia (DAZ) gene family are the primary regulators of proliferation in early germ cells and are important candidate genes for male infertility in the AZFc region (3). There are three genes in the DAZ gene family: DAZ, DAZL and BOULE. The DAZ-like (DAZL) gene is located in the 3p24 chromosomal region and is an autosomal homolog of DAZ; 83% of the cDNA coding regions in DAZ and DAZL are similar (4–6).

A previous study suggested that DAZL is important in the sperm production process (7). However, there are conflicting studies regarding whether DAZL mutations impact male infertility. Following completion of the human genome project, single nucleotide polymorphisms (SNPs) have been intensively investigated. As genetic markers, SNPs have been associated with pharmacogenomics and disease susceptibility. Two studies (8,9) have described A>G transitions at the SNP260 and SNP386 nucleotide positions of DAZL, and SNP386 was found to be associated with susceptibility to spermatogenic failure in the Taiwanese population. However, studies in other countries, including Italy, India and Japan, have indicated that there is not an association between the two SNPs and spermatogenic impairment (10–13). Thus, the role of the SNP260A>G and SNP386A>G transitions in male infertility is controversial (12–16). To the best of our knowledge, there have been no studies regarding DAZL SNPs in the Chinese population. Therefore, in the present study, the distribution of the DAZL A260G and A386G SNPs in Chinese males was investigated.

The methods for SNP genotyping are advancing. The available technology includes: Restriction fragment length polymorphism (RFLP), Taqman, high performance liquid chromatography and single-strand conformation polymorphism analysis (17). The most common methods used currently in China to detect SNPs are RFLP and DNA sequencing; however, these techniques are limited in their applications due to the high costs in time and resources.

In the present study, a high-throughput, low-cost and low-consumption method that combined allele-specific primer extension (ASPE) and multi-analyte suspension array (MASA) technology was applied (18) to characterize the DAZL SNP260 and SNP386 mutations in a Chinese population sample.

Materials and methods

Ethics statement

This study was approved by: The Ethics Committee of Chongqing Institute of Science and Technology for Population and Family Planning, the Research Ethics Committees of the Key Laboratory of Birth Defects and Reproductive Health, and the Ethics Committee of the Human Sperm Bank of Chongqing (Chongqing, China). All ethics approvals were provided in compliance with the Declaration of Helsinki (World Medical Association, 2000). All participants included in this study provided informed consent.

Patients and sample collection

A total of 196 males with azoospermia (non-obstructed) or severe oligospermia (sperm density <5×106/ml), but with a normal karyotype and no AZF microdeletions, were recruited from the Affiliate Hospital of Sichuan Genitalia Hygiene Research Center (Chengdu, China). Forty samples from fertile controls comprised of healthy volunteers were collected from the Human Sperm Bank of Chongqing. Whole blood (5 ml) was obtained from all patients and control subjects. Peripheral blood lymphocytes were isolated from the whole blood and stored at −20°C until required for analysis.

Coupling of oligonucleotides to microspheres

The sequences of cZipcodes for SNP260 and SNP386 (Table I) were selected online through Luminex Corporation (Austin, TX, USA). The 5′ ends of all cZipcodes were C-12-linked and amino-modified. To couple the cZipcodes to carboxylate beads, 2.5 million carboxylate beads, suspended in 25μl 0.1 mol/l 2-(N-morpholino)ethanesulfonic acid (pH 4.5), were mixed with 0.5 nmol amino-modified cZipcodes. Subsequently, 1.25 μl 10 mg/ml fresh 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride was added to the microsphere/oligo mixture and incubated in the dark for 30 min at room temperature, and this step was repeated twice. The microsphere/oligo mixture was mixed occasionally during incubation to ensure that the microspheres remained in suspension. The bead mixture was washed with 0.5 ml 0.02% Tween-20 and 0.5 ml 0.1% SDS. The beads were finally resuspended in 50 μl Tris-EDTA (pH 8.0) at 4°C in the dark.

Table I

Sequences of Capture probes, ZipCodes and cZipCodes (5′>3′).

Table I

Sequences of Capture probes, ZipCodes and cZipCodes (5′>3′).

SNPCapture probeZipCodecZipCode
SNP260A CTGGCCTCTCTGGAGATGGT CTACAAACAAACAAACATTATCAA TTGATAATGTTTGTTTGTTTGTAG
SNP260G CTGGCCTCTCTGGAGATGGC CTTTAATCCTTTATCACTTTATCA TGATAAAGTGATAAAGGATTAAAGG
SNP386A GCAAAGAAGCTTCTAATCTCTCAGT TCAACAATCTTTTACAATCAAATC ATTTGATTGTAAAAGATTGTTGA
SNP386G GCAAAGAAGCTTCTAATCTCTCAGC TCAATCATTACACTTTTCAACAAT ATTGTTGAAAAGTGTAATGATTGA

[i] SNP, single nucleotide polymorphism.

DNA isolation and polymerase chain reaction (PCR)

Genomic DNA was extracted from peripheral blood lymphocytes using a DNA isolation kit (Youjing Corp., Seoul, Korea). PCR was performed in a total volume of 25 μl containing 150 ng genomic DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 μM dNTPs, 5 pmol of each primer (Table II) and 1.5 U DNA polymerase. The PCR cycling conditions were as follows: 94°C for 10 min, followed by 35 cycles of 94°C for 30 sec, 62°C for 30 sec and 72°C for 5 min.

Table II

Primer sequences (5′>3) and the sizes of the PCR amplification products.

Table II

Primer sequences (5′>3) and the sizes of the PCR amplification products.

PCR productPrimer sequenceProduct length (bp)
SNP260A Forward CCTGAGCCTGAACTAACTTAGAATG225
SNP260A Reverse AATATAGCCTTGGCTGGTTGC
SNP386 Forward GGGAGAAATTGTCACATCATCG198
SNP386 Reverse AAAATTACTCACCCTTTGGACAC

[i] PCR, polymerase chain reaction; SNP, single nucleotide polymorphism; bp, base pairs.

ASPE

To remove unincorporated dNTPs and primers from the PCR reaction, 2 U Shrimp alkaline phosphatase and 1 U Exonuclease I were added to 10 μl of the pooled PCR products. The mixture was incubated at 37°C for 15 min, and then the enzymes were inactivated by heating at 95°C for 20 min.

The ASPE reaction comprised 10 μl enzyme-treated PCR products, 40 mM Tris-HCl (pH 8.4), 100 mM KCl, 25 mM MgCl2, 0.5 pmol of each SNP oligonucleotide, 100 μM of each dNTP (including biotin-labeled dCTP) and 3 U Tsp DNA polymerase in a total volume of 20 μl. The PCR cycling conditions were as follows: 96°C for 2 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 1 min and 72°C for 2 min.

Hybridization of ASPE products to the microspheres

A total of 3,000 probe-coupled microspheres of each type were added to the ASPE products and 1X tetramethylammonium chloride was used to obtain a final volume of 50 μl. The mixture was heated at 90°C for 10 min and then hybridized at 53°C for 5, 10, 15, 30 and 45 min to optimize the hybridization time. The hybrid products were labeled with 200 ng fresh streptavidin-R-phycoerythrin at 55°C for 5 min. The fluorescent signal was measured using the Luminex 100 system (Luminex Corporation).

RFLP and DNA sequencing for verification of the accuracy of the ASPE

All samples identified as SNP mutants using ASPE were sequenced using the alternate methods. Samples randomly selected from the non-mutated infertile males and control patients were also used. The RFLP reaction consisted of 17.3 μl purified PCR products, 0.2 μl bovine serum albumin, 2 μl 10X PCR buffer, and 0.5 μl restriction endonuclease DdeI for SNP260 or AluI for SNP386. The total reaction volume was 20 μl. Following incubation at 37°C for 4 h, the enzyme products were analyzed using polyacrylamide gel electrophoresis. PCR products were first cloned (TOPO TA cloning kit; Invitrogen Life Technologies, Carlsbad, CA, USA) according to the instructions of the manufacturer, followed by DNA sequencing. The identification of the obtained sequence was verified by using alignment search tool (BLAST) analysis (www.ncbi.nlm.nih.gov).

Statistical analysis

Statistical analysis was performed using SPSS software, version 13.0 (SPSS, Inc., Chicago, IL, USA). The χ2 test was used to evaluate the genotype distribution and allele frequencies of the polymorphisms. P<0.05 was considered to indicate a statistically significant difference.

Results

Assay optimization

To assess the association between DAZL mutations and male infertility, the present study aimed to develop a bead-based platform for SNP genotyping of DAZL. A schematic of the ASPE technology applied is shown in Fig. 1. For the SNP genotyping, two capture probes were designed for each SNP site. One primer was complementary to the wild-type sequence and the other was complementary to the mutation. A thermostable polymerase was used to extend the capture probe by incorporation of dNTPs, and one of which was biotin-labeled (Fig. 1). Extension only occurred if the 3′ nucleotide of the probes had annealed to the template DNA. A DNA sequence, termed Zipcode, was added at the 5′-end portion of the capture probe. The Zipcode hybridized to its complementary sequence, termed cZipcode, which was coupled to a specific fluorescent microsphere (Fig. 1). The sequences of the Zipcode and cZipcode pairs for each SNP are shown in Table I. With the extension of the capture probe, the template DNA was labeled with biotin. Following hybridization and dye incorporation, the signals were captured and analyzed by Luminex 100.

Figure 1

Schematic diagram of the ASPE reaction. In the assay combining ASPE and multi-analyte suspension array, the genomic DNA was amplified by PCR using primers specific for the A>G transitions at SNP260 or SNP386. The PCR incorporated a Zipcode tag specific to each allele. The Zipcode tag interacted with cZipcoded microspheres to detect the frequency of each allele. ASPE, allele-specific primer extension; PCR, polymerase chain reaction; SNP, single nucleotide polymorphism; SAP, shrimp alkaline phosphatase; Exonuclease I, ExoI; bio-dCTP, biotin-dCTP.

To optimize the hybridization time, samples of the mixture were incubated for 5, 10, 15, 30 and 45 min. Allowing samples to hybridize for 30 min achieved the best specificity and highest fluorescence intensity (Fig. 2). For the multiplex bead array screening, a cut-off value was established based on a fluorescence intensity of 100. Results with fluorescence intensity <100 were classified as negative. Results classified as positive were at least 10-fold greater than the negative reading. The results presented had to meet the aforementioned requirements to be considered valid.

Figure 2

Effect of hybridization time on fluorescence intensity. Zipcode-tagged polymerase chain reaction SNP260 and SNP386 products were incubated with cZipcode-labeled microspheres for 10–40 mins as indicated. The fluorescent signal was then read on a Luminex 100. The 30 min time point gave the most intense specific fluorescent signal. SNP, single nucleotide polymorphism.

SNP260 assayed by ASPE, RFLP and DNA sequencing

In the 196 infertility patients and 40 controls, the heterozygote mutation was not identified using MASA. Only one (2.50%) of the 40 controls and six (3.06%) of the 196 patients were observed to have a homozygous mutation (Table III). The results of the wild-type and homozygous mutations detected by MASA are shown in Fig. 3A. The results obtained using ASPE were consistent with the results obtained using RFLP (Fig. 3B) and DNA sequencing (Fig. 3C–F).

Figure 3

Results of the multi-analyte suspension array, restriction fragment length polymorphism and DNA sequencing. (A) The fluorescence intensity of the blank, wild-type and homozygous mutations of SNP260 and SNP386. (B) Electrophoretic analysis of the PCR products of deleted in azoospermia-like digested by DdeI or AluI; lanes 1 and 6, marker; lane 2, SNP260 PCR products (225 bp); lanes 3 and 4, SNP260 PCR products with wild-type digested by DdeI (217, 3 and 5 bp; the latter two were run off the gel); lane 5, SNP260 PCR products with homozygous mutation digested by DdeI (155, 62, 5 and 3 bp; the latter three were run off the gel); lane 7, SNP386 PCR products (198 bp); lane 8, SNP386 PCR products with wild-type digested by Alu I (118 and 80 bp); lane 9, SNP386 PCR products with homozygote mutation digested by AluI (105, 80 and 13 bp, the last was run off the gel). (C) Representative DNA sequence analysis of SNP260 showing the wild-type sequence. (D) Representative SNP260 DNA sequence analysis showing the homozygous mutation. (E) Representative DNA sequence analysis of SNP386 showing the wild-type sequence. (F) Representative SNP386 DNA sequence analysis showing the homozygous mutation. PCR, polymerase chain reaction.

Table III

Relative prevalence of mutations in DAZL SNP260 and SNP386 in infertile males and controls.

Table III

Relative prevalence of mutations in DAZL SNP260 and SNP386 in infertile males and controls.

Mutation Rate, n (%)

Mutation siteInfertility (n=196)Control (n=40)χ2P-value
SNP260A>G1 (2.50)0 (0.00)0.18>0.05
SNP386A>G6 (3.06)4 (2.04)0.05>0.05

[i] DAZL, deleted in azoospermia-like; SNP, single nucleotide polymorphism.

SNP386 assayed by ASPE, RFLP and DNA sequencing

In the enrolled patients, no heterozygote mutations in SNP386 were detected (Table III). Four (2.04%) of the 196 infertility patients were identified to have the homozygous SNP386 mutation (Table III). All the controls were wild-type homozygous (Table III). However, χ2 analysis did not indicate a statistically significant difference between the groups. The results of the wild-type and homozygous mutations detected by MASA are shown in Fig. 3A. The ASPE results were again consistent with those of the RFLP (Fig. 3B) and DNA sequencing (Fig. 3C–F).

Association between the DAZL mutation and infertility in males

The mutation rates of SNP260 and SNP386 in the controls and patients were low: 0.00 and 2.50% for SNP260 and 2.04 and 3.06% for SNP386, respectively. The frequencies of the SNP mutations in the control and infertile males were similar (P>0.05). This was inconsistent with results reported in a study of controls and infertile male patients from Taiwan (0.86 and 7.39%, respectively, for SNP386) (8,9).

Discussion

DAZL, DAZ and BOULE are the three members of the DAZ gene family which encode RNA-binding proteins associated with impaired spermatogenesis. The DAZ gene family contributes to spermatogenesis in a number of different species. Houston et al (19) found that DAZL knockout reduced the number of testicular stem cells in mice and caused spermatogonia to halt in meiosis. They also demonstrated that mice lacking BOULE exhibited impaired spermatogenesis, but the symptoms were corrected by reimplantation of the Xenopus xDAZL gene. Slee et al (20) have also reported that the human DAZL gene partially restored function in mice lacking DAZL. Lin et al (21) have shown that males with Sertoli-cell-only syndrome exhibited low levels of expression of DAZL. All these studies demonstrate that the DAZL gene is important during spermatogenesis.

Spermatogenesis is a complex process regulated by several genes located on autosomal and sex chromosomes (22). Approximately 10% of infertile males have complete or partial deletions of the DAZ gene cluster (23,24). The hypothesis that DAZL is involved in spermatogenesis is supported by studies demonstrating its testis-specific expression and its high homology to DAZ (25,26). Studies have indicated that DAZL may be involved in germ cell development. For example, in Caenorhabditis elegans, inactivation of DAZL was associated with meiotic arrest in oogenesis (27). In mice, knockout of the DAZL homolog led to the loss of germ cells in males and females (28). Additionally, in humans, low mRNA transcript levels of the DAZL gene were identified in infertile males with testicular failure (29).

However, there have been few studies that establish the association between the human DAZL gene mutation and male infertility. Two studies (8,9) have identified two SNP mutations in DAZL in the Taiwanese population: SNP260A>G in exon 2 and SNP386A>G in exon 3. SNP386A>G was identified in 7.39% of infertile males compared with 0.86% of fertile males. By contrast, studies in India, Japan and Italy observed that SNP386A>G was not associated with male infertility (10–13). Notably, Bartoloni et al (10) found the SNP386 mutation in <1/316 males with azoospermia and severe oligospermia. It is possible that the mutation may only be associated with infertility in males of Asian descent. However, the present study, conducted using Chinese male participants, also revealed no association between male infertility and the SNP386 mutation. This suggests the SNP386 mutation may be associated with infertility in only the Taiwanese population. Alternatively, the mutation site may be located in non-specific sites of the gene for the RNA-binding protein, and would therefore not likely be important in the sperm production process. To further understand the association between SNP386 and male infertility, additional studies at the protein level are required.

To date, there are four methods compatible with MASA that can be used to genotype SNPs: (i) Single base chain extension (SBCE), (ii) ASPE, (iii) oligonucleotide ligation assay and (iv) direct DNA hybridization (DH) (30). Lee et al (31) compared the accuracy, efficiency and costs of these methods, and showed that SBCE and ASPE are the most accurate. However, SBCE is also the most expensive while DH is the cheapest.

There are numerous advantages of incorporating ASPE and MASA technology to perform targeted high-throughput genetic characterization. ASPE lends itself to this application as it is: Highly specific, cost-efficient, versatile and not labor-intensive. Using ASPE and MASA, the fluorescent signal from the positive results is always ~10-fold higher than that from the negative results. The high signal-to-noise ratio makes it easy to interpret the results analyzed using a Luminex 100. Furthermore, the experiments can be conducted in <8 h. The combined technique is also easily scaled and sample throughput may be increased using 96-well plates instead of single tubes (18). It is also possible that by taking advantage of the full bead array, up to 50 SNP sites could be analyzed in a single tube simultaneously. This would minimize consumption of Tsp DNA polymerase and dNTPs, particularly biotin-labeled dCTP. In the full multiplex assay, the more SNP sites genotyped, the less each reaction costs. In traditional MASA formats, the microspheres are directly coupled to specific probes. Thus, each set of beads is only able to genotype one site. However, in assays combining ASPE and MASA, the microspheres are coupled to a non-specific cZipcode. The cZipcode-coupled microspheres can be used to detect almost any SNP linked to a Zipcode tag and specific capture probes.

In the present study, a potential platform was established for SNP research. The results suggested that SNP260 and SNP386 are not linked to azoospermia and severe oligospermia in Chinese males. However, studies are required to understand the important role of DAZL in spermatogenesis.

The most common methods to detect SNPs currently used in China are based on RFLP or DNA sequencing. However, the current methods are expensive and labor-intensive. In the present study, 196 male patients with azoospermia or severe oligospermia (sperm density <5×106/ml, non-obstructed) that had a normal karyotype and no AZF microdeletions were recruited, along with 40 healthy, fertile controls. SNP260 and SNP386 of DAZL were genotyped using ASPE combined with MASA technology. The combined method for SNP genotyping was high-throughput, accurate and cost-efficient. The technique was successfully applied to detect polymorphisms in the DAZL gene. However, no significant differences were identified between the frequencies of the mutations in SNP260 or SNP386 in the infertile and fertile males (P>0.05). The A260G and A386G polymorphisms of DAZL appeared to not affect male fertility in the Chinese population.

Acknowledgements

The authors thank Chongqing Key Laboratory of Birth Defects and Reproductive Health for funding this study (grant no. 1110). The authors thank Professor XP Ding, Miss. Zhang Min and Miss. Wang Huan for their help with the study.

Abbreviations:

MASA

multi-analyte suspension array

SNP

single nucleotide polymorphism

ASPE

allele-specific primer extension

DAZL

deleted in azoospermia-like

References

1 

Simoni M, Tüttelmann F, Gromoll J and Nieschlag E: Clinical consequences of microdeletions of the Y chromosome: the extended Münster experience. Reprod Biomed Online. 16:289–303. 2008.PubMed/NCBI

2 

Ferlin A, Arredi B, Speltra E, Cazzadore C, Selice R, Garolla A, Lenzi A and Foresta C: Molecular and clinical characterization of Y chromosome microdeletions in infertile men: a 10-year experience in Italy. J Clin Endocrinol Metab. 92:762–770. 2007.PubMed/NCBI

3 

Giachini C, Nuti F, Marinari E, Forti G and Krausz C: Partial AZFc deletions in infertile men with cryptorchidism. Hum Reprod. 22:2398–2403. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Shan Z, Hirschmann P, Seebacher T, Edelmann A, Jauch A, Morell J, et al: A SPGY copy homologous to the mouse gene Dazla and the Drosophila gene boule is autosomal and expressed only in the human male gonad. Hum Mol Genet. 5:2005–2011. 1996. View Article : Google Scholar : PubMed/NCBI

5 

Seboun E, Barbaux S, Bourgeron T, Nishi S, Agulnik A, Egashira M, et al: Gene sequence, localization and evolutionary conservation of DAZLA, a candidate male sterility gene. Genomics. 41:227–235. 1997. View Article : Google Scholar : PubMed/NCBI

6 

Saxena R, Brown LG, Hawkins T, Alagappan RK, Skaletsky H, Reeve MP, et al: The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nat Genet. 14:292–299. 1996. View Article : Google Scholar

7 

Yen PH: Putative biological functions of the DAZ family. Int J Androl. 27:125–129. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Teng YN, Lin YM, Lin YH, et al: Association of a single-nucleotide polymorphism of the deleted-in-azoospermia-like gene with susceptibility to spermatogenic failure. J Clin Endocrinol Metab. 87:5258–5264. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Teng YN, Chang YP, Tseng JT, et al: A single-nucleotide polymorphism of the DAZL gene promoter confers susceptibility to spermatogenic failure in the Taiwanese Han. Hum Reprod. 27:2857–2865. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Bartoloni L, Cazzadore C, Ferlin A, Garolla A and Foresta C: Lack of the T54A polymorphism of the DAZL gene in infertile Italian patients. Mol Hum Reprod. 10:613–615. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Poongothai J, Gopenath TS and Manonayaki S: A386G transition in DAZL gene is not associated with spermatogenic failure in Tamil Nadu, South India. Indian J Hum Genet. 14:16–19. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Becherini L, Guarducci E, Degl’Innocenti S, Rotondi M, Forti G and Krausz C: DAZL polymorphisms and susceptibility to spermatogenic failure: an example of remarkable ethnic differences. Int J Androl. 27:375–381. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Yang XJ, Shinka T, Nozawa S, et al: Survey of the two polymorphisms in DAZL, an autosomal candidate for the azoospermic factor, in Japanese infertile men and implications for male infertility. Mol Hum Reprod. 11:513–515. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Kumar K, Venkatesh S, Sharma PR, Tiwari PK and Dada R: DAZL 260A > G and MTHFR 677C > T variants in sperm DNA of infertile Indian men. Indian J Biochem Biophys. 48:422–426. 2011.

15 

Teng YN, Lin YM, Sun HF, Hsu PY, Chung CL and Kuo PL: Association of DAZL haplotypes with spermatogenic failure in infertile men. Fertil Steril. 86:129–135. 2006. View Article : Google Scholar

16 

Tschanter P, Kostova E, Luetjens CM, Cooper TG, Nieschlag E and Gromoll J: No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility in a Caucasian population. Hum Reprod. 19:2771–2776. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Wang WP, Ni KY and Zhou GH: Approaches for SNP genotyping. Yi Chuan. 28:117–126. 2006.(In Chinese).

18 

Ye F, Li MS, Taylor JD, et al: Fluorescent microsphere-based readout technology for multiplexed human single nucleotide polymorphism analysis and bacterial identification. Hum Mutat. 17:305–316. 2001. View Article : Google Scholar

19 

Houston DW, Zhang J, Maines JZ, Wasserman SA and King ML: A Xenopus DAZ-like gene encodes an RNA component of germ plasm and is a functional homologue of Drosophila boule. Development. 125:171–180. 1998.

20 

Slee R, Grimes B, Speed RM, et al: A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc Natl Acad Sci USA. 96:8040–8045. 1999. View Article : Google Scholar : PubMed/NCBI

21 

Lin YM, Chen CW, Sun HS, et al: Expression patterns and transcript concentrations of the autosomal DAZL gene in testes of azoospermic men. Mol Hum Reprod. 7:1015–1022. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Nuti F and Krausz C: Gene polymorphisms/mutations relevant to abnormal spermatogenesis. Reprod Biomed Online. 16:504–513. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Poongothai J, Gopenath TS and Manonayaki S: Genetics of human male infertility. Singapore Med J. 50:336–347. 2009.

24 

Reynolds N and Cooke HJ: Role of the DAZ genes in male fertility. Reprod Biomed Online. 10:72–80. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Jenkins HT, Malkova B and Edwards TA: Kinked β-strands mediate high-affinity recognition of mRNA targets by the germ-cell regulator DAZL. Proc Natl Acad Sci USA. 108:18266–18271. 2011.

26 

Kim B, Lee Y, Kim Y, et al: Polymorphic expression of DAZ proteins in the human testis. Hum Reprod. 24:1507–1515. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Karashima T, Sugimoto A and Yamamoto M: Caenorhabditis elegans homologue of the human azoospermia factor DAZ is required for oogenesis but not for spermatogenesis. Development. 127:1069–1079. 2000.

28 

Ruggiu M, Speed R, Taggart M, et al: The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature. 389:73–77. 1997. View Article : Google Scholar : PubMed/NCBI

29 

Kuo PL, Wang ST, Lin YM, Lin YH, Teng YN and Hsu CC: Expression profiles of the DAZ gene family in human testis with and without spermatogenic failure. Fertil Steril. 81:1034–1040. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Dunbar SA: Applications of Luminex xMAP technology for rapid, high-throughput multiplexed nucleic acid detection. Clin Chim Acta. 363:71–82. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Lee SH, Walker DR, Cregan PB and Boerma HR: Comparison of four flow cytometric SNP detection assays and their use in plant improvement. Theor Appl Genet. 110:167–174. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu Y, Ma M, Wan L, Zhang D, Zhao L, Wei L and Li L: Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array. Mol Med Rep 10: 2949-2954, 2014.
APA
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., & Li, L. (2014). Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array. Molecular Medicine Reports, 10, 2949-2954. https://doi.org/10.3892/mmr.2014.2634
MLA
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., Li, L."Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array". Molecular Medicine Reports 10.6 (2014): 2949-2954.
Chicago
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., Li, L."Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array". Molecular Medicine Reports 10, no. 6 (2014): 2949-2954. https://doi.org/10.3892/mmr.2014.2634
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu Y, Ma M, Wan L, Zhang D, Zhao L, Wei L and Li L: Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array. Mol Med Rep 10: 2949-2954, 2014.
APA
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., & Li, L. (2014). Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array. Molecular Medicine Reports, 10, 2949-2954. https://doi.org/10.3892/mmr.2014.2634
MLA
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., Li, L."Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array". Molecular Medicine Reports 10.6 (2014): 2949-2954.
Chicago
Zhu, Y., Ma, M., Wan, L., Zhang, D., Zhao, L., Wei, L., Li, L."Analysis of DAZL SNP260 and SNP386 in infertile Chinese males using multi-analyte suspension array". Molecular Medicine Reports 10, no. 6 (2014): 2949-2954. https://doi.org/10.3892/mmr.2014.2634
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team