Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2015 Volume 11 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2015 Volume 11 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats

  • Authors:
    • Dongmei Gui
    • Yanfeng Li
    • Xiaolong Chen
    • Dianwen Gao
    • Yang Yang
    • Xun Li
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China, Department of Neurosurgery, The People's Hospital of Liaoning Province, Shenyang, Liaoning 110025, P.R. China
  • Pages: 1490-1496
    |
    Published online on: November 4, 2014
       https://doi.org/10.3892/mmr.2014.2859
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

This study aimed to investigate the impacts of erythropoietin (EPO) on the electroretinogram b‑wave (ERG‑b), and on the mRNA and protein expression levels of hypoxia‑inducible factor‑1α (HIF‑1α), inducible nitric oxide synthase (iNOS), cyclooxygenase‑2 (COX‑2) and caspase‑9 in chronic ocular hypertension rats. Episcleral vein cauterization (EVC) was used to establish the chronic ocular hypertension rat model based on the intraocular pressure (IOP) value. ERG‑b and mRNA and protein expression levels of HIF‑1α, iNOS, COX‑2 and caspase‑9 in normal, EVC‑treated and EVC combined with EPO (EVC+EPO)‑treated rats were measured by electroretinography, RT‑PCR and western blotting, respectively. Moreover, the correlations of HIF‑1α with IOP, ERG‑b, iNOS, COX‑2 and caspase‑9 were evaluated. The mRNA and protein expression levels of HIF‑1α, iNOS, COX‑2 and caspase‑9 in EVC‑treated rats were increased significantly compared with normal rats. The peak expression levels of HIF‑1α, iNOS, COX‑2 and caspase‑9 were respectively obtained 7, 7, 7 and 14 days postoperatively. Compared with EVC‑treated rats, EPO administration weakened the mRNA and protein expression levels of HIF‑1α, iNOS, COX‑2 and caspase‑9. The mRNA expression level of HIF‑1α demonstrated a significant positive correlation with IOP and ERG‑b. HIF‑1α was positively correlated with iNOS, COX‑2 and caspase‑9 at the mRNA and protein levels. The protective effect of EPO on the retina of chronic ocular hypertension rats may be mediated by the HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9.

Introduction

The ocular disorder of glaucoma, characterized by the progressive loss of retinal ganglion cells and their axons, accompanied by gradual loss of the visual field, is a leading cause of blindness, estimated to affect 79.6 million people worldwide by 2020 (1). Dysregulation of the blood flow with subsequent hypoxia has been suggested to be a mechanism of retinal damage in glaucoma (2). Hypoxia-inducible factor 1 (HIF-1) is a transcriptional activator that functions as a master regulator of oxygen homeostasis and plays an essential role in mammalian development, physiology and disease pathogenesis (3). HIF-1 is a heterodimer composed of the inducible expressed HIF-1α subunit and the constitutively expressed HIF-1β subunit (3,4). HIF-1α expression is induced in hypoxic cells with an exponential increase in expression as cells are exposed to an oxygen concentration of <6% (5). Previous studies have reported that the activation of the hypoxia-responsive transcription factor HIF-1α is involved in the pathophysiology of glaucoma (6,7). Moreover, a number of HIF-1α targeted genes have also been investigated in retinas with glaucoma, including EPO, FLT-1, HSP-27, PAI-1, VEGF-A, ET-1, IGF2 and TGFβ3 (7,8).

Our previous study investigated the expression levels of HIF-1α and inducible nitric oxide synthase (iNOS), and the effect of erythropoietin (EPO) on the HIF-1\iNOS signal transduction pathway in the retina of chronic ocular hypertension rats (9). EPO is capable of protecting retinal ganglion cells from degeneration induced by acute ischemia-reperfusion injury, axotomy injury and light- and genetic-induced degeneration, and promoting the survival of retinal ganglion cells in DBA/2J glaucoma mice (10). Significant advances have been made in understanding the molecular pathology of glaucoma, particularly through the development of rat models of experimental glaucoma and the characterization of a spontaneous secondary form of glaucoma in DBA/2 substrains of inbred mice (2). However, the correlation between HIF-1α and its targeted genes remains unclear and an investigation into EPO in glaucoma is warranted.

Cyclooxygenase-2 (COX-2) has been identified in the cornea, iris, ciliary body and various cell types within the neurosensory retina. The expression of the COX-2 enzyme in the ocular tissues plays a functional role for its prostanoid products (11). It has been reported that HIF-1 is an essential regulator of COX-2 induction in hypoxic monkey choroidal retinal endothelial cells (12). HIF-1α has been reported to promote apoptosis, since caspase-9 promoter contained HIF-1-binding elements and caspase-9 transcription could be induced by a hypoxic episode (13,14). Activation of caspase-9 has been identified in a rat model of experimental glaucoma (15). In the present study, chronic ocular hypertension rats were induced with episcleral vein cauterization (EVC). The mRNA and protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 were investigated in normal, EVC-treated, and EVC combined with EPO (EVC+EPO)-treated rats. In addition, the correlation of HIF-1α with intraocular pressure (IOP), electroretinogram b-wave (ERG-b), iNOS, COX-2 and caspase-9 was also studied.

Subjects and methods

Animals

A total of 120 male Wistar rats (age, 40–50 days; weight, 200–250 g) without eye disease were obtained from the Experimental Animal Center of China Medical University, Shenyang, China. All rats were housed in a specific pathogen-free facility. The rats were randomly divided into 12 groups: One blank group; one group with rats injected with EPO and without ocular hypertension; five groups with rats under ocular hypertension for 3, 7, 14, 21 and 28 days, respectively; and five groups with rats injected with EPO and under ocular hypertension for 3, 7, 14, 21 and 28 days, respectively. The right eyes of rats in each group were selected as the experimental eyes to receive treatments and the left eyes were used as controls. The study was approved by the Animal Ethics Committee of Shengjing Hospital Affiliated to China Medical University.

Model establishment and sample preparation

Chronic ocular hypertension rats were induced with EVC as described previously (9). Two or three of the episcleral veins were coagulated by heat cure hemostat in the experimental group, while nothing was done to the veins in the blank group. A Tono-Pen II tonometer (Mentor Opthalmics, Inc., Norwell, MA, USA) was used to measure the IOP of the Wistar rats prior to surgery, half an hour after surgery and 3, 7, 14, 21 and 28 days after surgery. The postoperative IOP was 40% higher than that prior to surgery, indicating that the chronic ocular hypertension model was established successfully. This model closely mimics the natural disease process in certain forms of secondary glaucoma, and is one of the most commonly used models in rats (16). The rats were sacrificed in each group following the correct treatment. The entire retina was separated and stored as described previously for subsequent experiments (9).

Drug administration and ERG-b detection

Recombinant human EPO was purchased from Shenyang Sunshine Pharmaceutical Co., Ltd. (China). Wistar rats in the drug group were intraperitoneally injected with EPO (5,000 U/kg) 1 day before surgery, and 2, 6, 13, 20 and 27 days after surgery. The change in ERG-b was detected by VETS-3 electrophysiolography as described previously (9).

Measurement of mRNA expression levels by semi-quantitative RT-PCR

First, total RNA from normal and glaucomatous whole retinas from each group was reverse transcribed into cDNA using random primers and SuperScriptTM II RT (Invitrogen, Carlsbad, CA, USA). The target levels in each retina were normalized with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin. The sequences of the PCR primers and the product length of target genes (HIF-1α, iNOS, COX-2 and caspase-9) are listed in Table I. The PCR conditions and the electrophoresis and gel imaging processes were as described in our previous study (9). Briefly, PCR was performed in a 25 μl reaction volume: 2.5 μl cDNA, 2.5 μl 10× PCR buffer (Takara Shuzo, Shiga, Japan), 2.0 μl dNTP (2.5 mM; Takara Shuzo), 1.0 μl of each primer (100 pm/μl), 1.0 μl of each primer (50 pm/μl) and 0.3 μl Taq DNA polymerase (5 U/μl, Takara Shuzon). The amplification was performed as follows: 95°C for 5 min followed by 32 cycles of 94°C for 40 sec, 60°C for 40 sec and 72°C for 60 sec, with a final extension step of 10 min at 72°C. mRNA expression levels were recorded by calculating the absorbance ratio of the target gene strap and GAPDH/β-actin strap.

Table I

Sequences of PCR primers and product length of genes.

Table I

Sequences of PCR primers and product length of genes.

GeneSequence (5′-3′)Product length (bp)
F-β-actin ACACTGTGCCCATCTACGAGG621
R-β-actin AGGGGCCGGACTCGTCATACT
F-GAPDH ACCACAGTCCATGCCATCAC452
R-GAPDH TCCACCACCCCTGTTGCTGTA
F-COX-2 GCAAATCCTTGCTGTTCCAACCCA482
R-COX-2 TTGGGGATCCGGGATGAACTCTCT
F-caspase-9 TTTAAGCTCTCAGAAGACATG363
R-caspase-9 TGTTGAAGTACAGACAGTACCCCCA
F-iNOS TCCAGGAGGACATGCAGCAC260
R-iNOS TCTTGACGCCTTCCCGC
F-HIF-1α CTGATTGCATCTCCACCTTCTACC343
R-HIF-1α TTCCAAGAAAGCGACATAGTAGGG

[i] GAPDH, glyceraldehyde-3-phosphate dehydrogenase; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; HIF-1α, hypoxia-inducible factor-1α.

Western blotting

The retinas were dissected and homogenized in lysis buffer (10 mM Tris, pH 7.4; 150 mM NaCl; 1 mM EDTA; 1 mM EGTA) supplemented with 10% protease inhibitor cocktail and 1% phosphatase inhibitor cocktail from Sigma (St. Louis, MO, USA). Cell debris was removed by centrifugation. The protein concentration of the supernatant was measured using a Bio-Rad DC protein assay kit (Bio-Rad, Hercules, CA, USA). A total of 40 μg protein from each group was subjected to 10% SDS polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes at 50 V for 2 h. The membranes were blocked with 5% non-fat dry milk and 2% bovine serum albumin in Tris-buffered saline containing 0.1% Tween-20 for 1 h. Incubations with primary polyclonal rabiit anti-rat antibodies of HIF-1α, iNOS, COX-2 and caspase-9 (1:200; Wuhan Boshide Company, China) in blocking buffer were performed overnight at 4°C. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary polyclonal anti-rabbit antibody (1:2,000; Wuhan Boshide Company, China) in blocking buffer for 1 h at room temperature. Bands were quantified and scanned using Floorchem V2.0 software provided by the UVI pro gel analysis system (Kodak, Rochester, NY, USA). β-actin was used as an internal control.

Statistical analysis

The results are expressed as the mean ± standard deviation. Comparisons among groups were performed by one way-analysis of variance using SPSS 12.0 (SPSS, Inc., Chicago, IL, USA). The correlations between the mRNA expression levels of HIF-1α and IOP and ERG-b, and the mRNA expression levels of iNOS, COX-2 and caspase-9 were analyzed using Pearson’s correlation, Kendall’s correlation and Spearman’s correlation. The correlation analysis of protein expression levels of HIF-1α with iNOS, COX-2 and caspase-9 was also performed using these three methods.

Results

Induction of experimental glaucoma

Cauterization of the major episcleral vein trunks resulted in increased IOP as aqueous outflow was interrupted (Table II). There was no significant difference in IOP between the experimental and control eyes of the 120 rats prior to the EVC procedure (0 days; P>0.05; Table II). At 0.5 h after the EVC procedure, the IOP of the experimental eyes was increased to 30.166±6.029 mmHg, which was significantly higher than that of the control eyes (P<0.01). The peak IOP (33.942±9.208 mmHg) was obtained 7 days after the EVC procedure, which was 2.66-fold higher than that at 0 days. The IOP of the experimental eyes 14, 21 and 28 days after surgery remained significantly increased, at >40% of that of the control eyes (P<0.01). The ERG-b level of the EVC+EPO group was significantly higher than that of the EVC group 7, 14, 21 and 28 days after surgery (P<0.05, Table III).

Table II

Intraocular pressure of eyes in experimental and control eyes preoperatively and at various times postoperatively.

Table II

Intraocular pressure of eyes in experimental and control eyes preoperatively and at various times postoperatively.

TimeExperimental (n=120, mmHg)Control (n=120, mmHg)
0 days12.767±3.17612.846±2.769
0.5 h30.166±6.029b12.517±2.429
3 days22.718±4.131a12.233±3.711
7 days33.942±9.208b13.466±2.270
14 days32.557±7.937b12.825±2.791
21 days25.395±2.703b12.634±3.109
28 days26.000±3.978b12.809±2.693

a P<0.05 and

b P<0.01, vs. controls.

Table III

Electroretinogram b-wave in retina following EPO injection.

Table III

Electroretinogram b-wave in retina following EPO injection.

Time (days)EVC groupEVC+EPO groupP-value
0113.05±9.53119.45±11.430.480
392.71±7.3897.34±8.450.430
772.37±8.1598.21±10.23a0.025
1465.51±0.04295.57±9.29b0.009
2168.65±0.05993.32±6.42a0.016
2869.91±0.03795.32±9.12a0.038

a P<0.05 and

b P<0.01, vs. EVC group.

{ label (or @symbol) needed for fn[@id='tfn6-mmr-11-02-1490'] } EPO, erythropoietin; EVC, episcleral vein cauterization.

mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9

The mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in normal, EVC-treated, and EVC and EPO-treated rat retinas were investigated (Table IV and Fig. 1). Compared with the preoperative rats (0 days), the mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in EVC-treated rats were increased. The peak expression levels of HIF-1α, iNOS, COX-2 and caspase-9 respectively occurred 7, 7, 7 and 14 days after surgery. Compared with the EVC-treated rats, the mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in the EPO-treated group were statistically significantly reduced 7, 14, 21 and 28 days after surgery (P<0.01, Table IV).

Figure 1

mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in experimental glaucoma rats. Lane 1, control; lane 2, 3 days after EVC treatment; lane 3, 7 days after EVC treatment; lane 4, 14 days after EVC treatment; lane 5, 21 days after EVC treatment; lane 6, 28 days after EVC treatment; lane 7, 3 days after EVC and EPO treatment; lane 8, 7 days after EVC and EPO treatment; lane 9, 14 days after EVC and EPO treatment; lane 10, 21 days after EVC and EPO treatment; lane 11, 28 days after EVC and EPO treatment; lane M, DNA marker. HIF-1α, hypoxia-inducible factor-1α; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; EVC, episcleral vein cauterization; EPO, erythropoietin.

Table IV

mRNA expression level of HIF-1α, iNOS, COX-2 and caspase-9 in retinas following EPO injection.

Table IV

mRNA expression level of HIF-1α, iNOS, COX-2 and caspase-9 in retinas following EPO injection.

GeneTime (days)EVC group (μV)EVC+EPO group (μV)P-value
HIF-1α00.248±0.0870.234±0.0720.790
30.408±0.0290.240±0.027a0.020
70.512±0.0280.288±0.031b0.000
140.406±0.0320.312±0.026a0.010
210.342±0.0440.226±0.027a0.015
280.338±0.0260.240±0.020a0.030
iNOS00.259±0.0530.284±0.0370.480
30.423±0.0850.358±0.0260.088
70.676±0.065 0.448±0.0441b0.005
140.526±0.0420.376±0.029b0.001
210.414±0.0590.336±0.032a0.036
280.394±0.0370.328±0.026a0.037
COX-200.218±0.0370.202±0.0310.317
30.392±0.0330.380±0.0220.550
70.622±0.0480.388±0.029b0.001
140.552±0.0430.402±0.033a0.010
210.438±0.0380.374±0.029a0.014
280.458±0.0310.312±0.032b0.000
Caspase-900.146±0.0440.154±0.0330.640
30.350±0.0420.240±0.032a0.018
70.530±0.0630.348±0.031b0.009
140.696±0.0450.232±0.027b0.000
210.390±0.0370.252±0.024b0.002
280.412±0.0430.300±0.043a0.032

a P<0.05 and

b P<0.01, vs. EVC group.

{ label (or @symbol) needed for fn[@id='tfn9-mmr-11-02-1490'] } HIF-1α, hypoxia-inducible factor-1α; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; EPO, erythropoietin; EVC, episcleral vein cauterization.

Protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9

The protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in normal, EVC-treated, and EVC and EPO-treated rat retinas were also investigated (Table V and Fig. 2). Similarly to mRNA expression levels, the protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in EVC-treated rats were increased compared with those of preoperative rats. The peak expression of HIF-1α, iNOS, COX-2 and caspase-9 respectively occurred 7, 7, 7 and 14 days after surgery. Compared with EVC-treated rats, the protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in the EPO-treated group were notably reduced 7, 14, 21 and 28 days after surgery (P<0.01, Table V).

Figure 2

Protein expression levels of COX-2 and caspase-9 in experimental glaucoma rats. Lane 1, control; lane 2, 3 days after EVC treatment; lane 3, 7 days after EVC treatment; lane 4, 14 days after EVC treatment; lane 5, 21 days after EVC treatment; lane 6, 28 days after EVC treatment; lane 7, 3 days after EVC and EPO treatment; lane 8, 7 days after EVC and EPO treatment; lane 9, 14 days after EVC and EPO treatment; lane 10, 21 days after EVC and EPO treatment; lane 11, 28 days after EVC and EPO treatment; lane M, DNA marker. COX-2, cyclooxygenase-2; EVC, episcleral vein cauterization; EPO, erythropoietin.

Table V

Protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in retinas following EPO injection.

Table V

Protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in retinas following EPO injection.

GeneTime (days)EVC groupEVC+EPO groupP-value
HIF-1α00.084±0.0210.118±0.0190.058
30.210±0.0260.164±0.011a0.045
70.624±0.0290.262±0.019b0.000
140.456±0.0320.216±0.019b0.000
210.274±0.0270.214±0.027b0.009
280.242±0.0190.176±0.017b0.005
iNOS00.264±0.0370.228±0.0290.0125
30.436±0.0340.404±0.0190.210
70.860±0.0500.472±0.038b0.000
140.792±0.0630.414±0.029b0.000
210.528±0.0320.370±0.027b0.000
280.378±0.0260.320±0.026a0.011
COX-200.108±0.0240.096±0.0180.470
30.188±0.0190.146±0.0320.058
70.462±0.0360.274±0.021b0.000
140.374±0.0240.252±0.028b0.001
210.324±0.0210.206±0.021b0.000
280.340±0.0270.188±0.038b0.002
Caspase-900.184±0.0310.172±0.0290.640
30.222±0.0260.180±0.0220.055
70.376±0.0210.252±0.026b0.003
140.552±0.0440.280±0.040b0.000
210.318±0.0410.216±0.031a0.031
280.306±0.0210.224±0.027a0.012

a P<0.05 and

b P<0.01, vs. EVC group.

{ label (or @symbol) needed for fn[@id='tfn12-mmr-11-02-1490'] } HIF-1α, hypoxia-inducible factor-1α; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; EPO, erythropoietin; EVC, episcleral vein cauterization.

Correlation analysis

Pearson’s correlation, Kendall’s correlation and Spearman’s correlation were used for correlation analysis. HIF-1α was positively correlated with iNOS, COX-2 and caspase-9 at the mRNA level (Table VI) and protein level (Table VII). Moreover, the mRNA expression level of HIF-1α also demonstrated a significant positive correlation with IOP and ERG-b (Table VI).

Table VI

Correlation analysis of mRNA expression level of HIF-1α with IOP, ERG-b and mRNA expression levels of iNOS, COX-2 and caspase-9 in chronic ocular hypertension rats.

Table VI

Correlation analysis of mRNA expression level of HIF-1α with IOP, ERG-b and mRNA expression levels of iNOS, COX-2 and caspase-9 in chronic ocular hypertension rats.

Pearson’s correlationKendall’s correlationSpearman’s correlation
IOP0.751b0.476a0.598a
ERG-b0.594b0.397a0.482a
iNOS0.821b0.572b0.733b
COX-20.791b0.518a0.672b
Caspase-90.599b0.345a0.516b

a P<0.05 and

b P<0.01.

{ label (or @symbol) needed for fn[@id='tfn15-mmr-11-02-1490'] } HIF-1α, hypoxia-inducible factor-1α; IOP, intraocular pressure; ERG-b, electroretinogram b-wave; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.

Table VII

Correlation analysis of protein expression levels of HIF-1α with iNOS, COX-2 and caspase-9 in chronic ocular hypertension rats.

Table VII

Correlation analysis of protein expression levels of HIF-1α with iNOS, COX-2 and caspase-9 in chronic ocular hypertension rats.

Pearson’s correlationKendall’s correlationSpearman’s correlation
iNOS0.950b0.726b0.901b
COX-20.882b0.765b0.908b
Caspase-90.715b0.705a0.881b

a P<0.05 and

b P<0.01.

{ label (or @symbol) needed for fn[@id='tfn18-mmr-11-02-1490'] } HIF-1α hypoxia-inducible factor-1α; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.

Discussion

Glaucoma is the second leading cause of blindness worldwide (17). It is imperative to explore the mechanisms of retinal damage in glaucoma. In the present study, EVC was used for the construction of chronic ocular hypertension rats. The mRNA and protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 were investigated in chronic ocular hypertension rats. Moreover, a correlation analysis of HIF-1α with IOP, ERG-b, iNOS, COX-2 and caspase-9 was also conducted.

First, an inducible rat model of elevated IOP was developed using the EVC method. Following cauterization of two episcleral veins in the rats, IOP increases of 50–80% were reported in treated eyes, with a loss of 4% of the retinal ganglion cells per week (18). Cauterization of three episcleral veins produced an IOP increase of 120–150%, with a loss of 5–6% of retinal ganglion cells per week (19). Two or three of the major episcleral veins were coagulated in the experimental group of the present study. The peak IOP (33.942±9.208, P<0.01) was obtained 7 days after the EVC procedure, and was 2.66-fold higher than that at 0 days. This result was in accordance with previous studies (18,19).

The mRNA expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in EVC-treated rats were increased significantly compared with those in normal rats. The peak expression levels of HIF-1α, iNOS, COX-2 and caspase-9 were obtained 7, 7, 7 and 14 days after surgery. The correlation analysis indicated that HIF-1α had a significant positive correlation with iNOS, COX-2 and caspase-9 at both the mRNA and protein level. Moreover, HIF-1α also demonstrated a significant positive correlation with IOP and ERG-b.

COX-2 is an inducible enzyme with a significant role in inflammation. It is overexpressed in a variety of cancer types and plays an essential role in the angiogenesis of gastric carcinoma (20,21). A previous study indicated that COX-2 is transcriptionally induced by hypoxia via HIF-1, and the upregulation of COX-2 contributes to maintaining tumor survival and potentially promoting angiogenesis in colorectal tumor cells (22). Lukiw et al reported coordinated activation of HIF-1 and COX-2 expression in retinal cells by hypoxia (12). Caspase-9 is the apex caspase of the mitochondrial pathway of apoptosis, which plays a critical role in apoptotic initiation and progression (14). Hänninen et al investigated retinal ganglion cell death and activation of caspase-9 in rats with experimental glaucoma and supported the activation of caspase-9, the intrinsic caspase cascade, in retinal ganglion cell death in experimental glaucoma (15). The upregulated caspase-9 in experimental glaucoma may result in retinal ganglion cell death and aggravate the development of glaucoma. These studies further support the results revealed in the present study. Thus, COX-2 and caspase-9 overexpression may be regarded as a critical adaptive response to hypoxia in glaucoma. Several studies have examined the observation that HIF-1α immunoreactivity is enhanced in the glaucomatous retina in a canine glaucoma model and in human glaucoma (4,6,9,23). Upon activation by hypoxia and/or receptor-mediated signals, the HIF-1α expression level was increased and several HIF-1 transcriptional targets were upregulated in the glaucomatous retina in the present study and our previous study (9). Moreover, significant positive correlations with HIF-1α, iNOS, COX-2, caspase-9, IOP and ERG-b were identified in the current study. It furthermore indicates the significant role of HIF-1α in the development and progression of glaucoma.

Compared with EVC-treated rats, EPO administration weakened the mRNA and protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9. Glaucoma is characterized by the progressive death of retinal ganglion cells and visual field loss. EPO has been reported to provide neuroprotection in cultured adult rat retinal ganglion cells, with anti-oxidative, anti-apoptotic and neurotrophic effects observed in several signaling pathways (24,25). The neuroprotection of EPO in retinal ganglion cells may be a potential reason for the downregulated expression levels of HIF-1α, iNOS, COX-2 and caspase-9 in experimental glaucoma rats.

In conclusion, the mRNA and protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9 were investigated in EVC-treated chronic ocular hypertension rats, and the correlation of HIF-1α with IOP, ERG-b, iNOS, COX-2 and caspase-9 was also studied. Upregulated levels of HIF-1α, iNOS, COX-2 and caspase-9 were observed in experimental glaucoma rats. HIF-1α demonstrated a significant correlation with iNOS, COX-2, caspase-9, IOP and ERG-b. HIF-1α, iNOS, COX-2 and caspase-9 overexpression may be regarded as a critical adaptive response to hypoxia in glaucoma. EPO administration weakened the mRNA and protein expression levels of HIF-1α, iNOS, COX-2 and caspase-9. To conclude, the protective effect of EPO on the retina of chronic ocular hypertension rats may be mediated by the HIF-1 signaling pathway involving iNOS, COX-2 and caspase-9.

References

1 

Vohra R, Tsai JC and Kolko M: The role of inflammation in the pathogenesis of glaucoma. Surv Ophthalmol. 58:311–320. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Nickells RW: Ganglion cell death in glaucoma: from mice to men. Vet Ophthalmol. 10(Suppl 1): 88–94. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Semenza GL: HIF-1 and mechanisms of hypoxia sensing. Curr Opin Cell Biol. 13:167–171. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Tezel G and Wax MB: Hypoxia-inducible factor 1 alpha in the glaucomatous retina and optic nerve head. Arch Ophthalmol. 122:1348–1356. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Jiang B-H, Semenza GL, Bauer C and Marti HH: Hypoxia-inducible factor 1 levels vary exponentially over a physiologically relevant range of O2 tension. Am J Physiol. 271:C1172–C1180. 1996.PubMed/NCBI

6 

Ergorul C, Ray A, Huang W, et al: Hypoxia inducible factor-1α (HIF-1α) and some HIF-1 target genes are elevated in experimental glaucoma. J Mol Neurosci. 42:183–191. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Zhu Y, Zhang L and Gidday JM: Role of hypoxia-inducible factor-1alpha in preconditioning-induced protection of retinal ganglion cells in glaucoma. Mol Vis. 19:2360–2372. 2013.

8 

Whitlock NA, Agarwal N, Ma J-X and Crosson CE: Hsp27 upregulation by HIF-1 signaling offers protection against retinal ischemia in rats. Invest Ophthalmol Vis Sci. 46:1092–1098. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Gui DM, Yang Y, Li X and Gao DW: Effect of erythropoietin on the expression of HIF-1 and iNOS in retina in chronic ocular hypertension rats. Int J Ophthalmol. 4:40–43. 2011.PubMed/NCBI

10 

Fu QL, Wu W, Wang H, Li X, Lee VW and So KF: Up-regulated endogenous erythropoietin/erythropoietin receptor system and exogenous erythropoietin rescue retinal ganglion cells after chronic ocular hypertension. Cell Mol Neurobiol. 28:317–329. 2008. View Article : Google Scholar

11 

Yanni SE, McCollum GW and Penn JS: Genetic deletion of COX-2 diminishes VEGF production in mouse retinal Müller cells. Exp Eye Res. 91:34–41. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Lukiw WJ, Ottlecz A, Lambrou G, et al: Coordinate activation of HIF-1 and NF-κB DNA binding and COX-2 and VEGF expression in retinal cells by hypoxia. Invest Ophthalmol Vis Sci. 44:4163–4170. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Soengas MS, Alarcón RM, Yoshida H, Giaccia H, Hakem R, Mak TW and Lowe SW: Apaf-1 and caspase-9 in p53-dependent apoptosis and tumor inhibition. Science. 284:156–159. 1999. View Article : Google Scholar : PubMed/NCBI

14 

Nishiyama J, Yi X, Venkatachalam M and Dong Z: cDNA cloning and promoter analysis of rat caspase-9. Biochem J. 360:49–56. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Hänninen VA, Pantcheva MB, Freeman EE, Poulin NR and Grosskreutz CL: Activation of caspase 9 in a rat model of experimental glaucoma. Curr Eye Res. 25:389–395. 2002. View Article : Google Scholar

16 

Goldblum D and Mittag T: Prospects for relevant glaucoma models with retinal ganglion cell damage in the rodent eye. Vision Res. 42:471–478. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Quigley HA and Broman AT: The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 90:262–267. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Laquis S, Chaudhary P and Sharma SC: The patterns of retinal ganglion cell death in hypertensive eyes. Brain Res. 784:100–104. 1998. View Article : Google Scholar : PubMed/NCBI

19 

Ahmed FA, Chaudhary P and Sharma SC: Effects of increased intraocular pressure on rat retinal ganglion cells. Int J Dev Neurosci. 19:209–218. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Huang SP, Wu MS, Shun CT, et al: Cyclooxygenase-2 increases hypoxia-inducible factor-1 and vascular endothelial growth factor to promote angiogenesis in gastric carcinoma. J Biomed Sci. 12:229–241. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Wang D and Dubois RN: The role of COX-2 in intestinal inflammation and colorectal cancer. Oncogene. 29:781–788. 2010. View Article : Google Scholar

22 

Kaidi A, Qualtrough D, Williams AC and Paraskeva C: Direct transcriptional up-regulation of cyclooxygenase-2 by hypoxia-inducible factor (HIF)-1 promotes colorectal tumor cell survival and enhances HIF-1 transcriptional activity during hypoxia. Cancer Res. 66:6683–6691. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Savagian CA, Dubielzig RR and Nork TM: Comparison of the distribution of glial fibrillary acidic protein, heat shock protein 60, and hypoxia-inducible factor-1α in retinas from glaucomatous and normal canine eyes. Am J Vet Res. 69:265–272. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Chang ZY, Yeh MK, Chiang CH, Chen YH and Lu DW: Erythropoietin protects adult retinal ganglion cells against NMDA-, trophic factor withdrawal-, and TNF-α-induced damage. PLoS One. 8:e552912013. View Article : Google Scholar

25 

Zhong L, Bradley J, Schubert W, et al: Erythropoietin promotes survival of retinal ganglion cells in DBA/2J glaucoma mice. Invest Ophthalmol Vis Sci. 48:1212–1218. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gui D, Li Y, Chen X, Gao D, Yang Y and Li X: HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats. Mol Med Rep 11: 1490-1496, 2015.
APA
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., & Li, X. (2015). HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats. Molecular Medicine Reports, 11, 1490-1496. https://doi.org/10.3892/mmr.2014.2859
MLA
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., Li, X."HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats". Molecular Medicine Reports 11.2 (2015): 1490-1496.
Chicago
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., Li, X."HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats". Molecular Medicine Reports 11, no. 2 (2015): 1490-1496. https://doi.org/10.3892/mmr.2014.2859
Copy and paste a formatted citation
x
Spandidos Publications style
Gui D, Li Y, Chen X, Gao D, Yang Y and Li X: HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats. Mol Med Rep 11: 1490-1496, 2015.
APA
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., & Li, X. (2015). HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats. Molecular Medicine Reports, 11, 1490-1496. https://doi.org/10.3892/mmr.2014.2859
MLA
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., Li, X."HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats". Molecular Medicine Reports 11.2 (2015): 1490-1496.
Chicago
Gui, D., Li, Y., Chen, X., Gao, D., Yang, Y., Li, X."HIF‑1 signaling pathway involving iNOS, COX‑2 and caspase‑9 mediates the neuroprotection provided by erythropoietin in the retina of chronic ocular hypertension rats". Molecular Medicine Reports 11, no. 2 (2015): 1490-1496. https://doi.org/10.3892/mmr.2014.2859
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team