Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2015 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2015 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia

  • Authors:
    • Joon Seol Bae
    • Jason Yongha Kim
    • Byung‑Lae Park
    • Hyun Sub Cheong
    • Jeong‑Hyun Kim
    • Suhg Namgoong
    • Ji‑On Kim
    • Chul Soo Park
    • Bong‑Jo Kim
    • Cheol‑Soon Lee
    • Migyung Lee
    • Woo Hyuk Choi
    • Tae‑Min Shin
    • Jaeuk Hwang
    • Hyoung Doo Shin
    • Sung‑Il Woo
  • View Affiliations / Copyright

    Affiliations: Laboratory of Translational Genomics, Samsung Genome Institute, Samsung Medical Center, Seoul 135‑710, Republic of Korea, Laboratory of Genomic Diversity, Department of Life Science, Sogang University, Seoul 121‑742, Republic of Korea, Department of Genetic Epidemiology, SNP Genetics, Inc., Sogang University, Seoul 121‑742, Republic of Korea, Department of Psychiatry, College of Medicine, Gyeongsang National University, Jinju, Gyeongsang Nam Do, 660‑751, Republic of Korea, Department of General Psychiatry, Seoul National Hospital, Seoul 110‑799, Republic of Korea, Department of Biomedical Engineering, Yonsei University, Wonju, Gangwon 220‑710, Republic of Korea, Department of Neuropsychiatry, Soonchunhyang University Hospital, Seoul 420‑767, Republic of Korea
  • Pages: 2975-2980
    |
    Published online on: December 4, 2014
       https://doi.org/10.3892/mmr.2014.3045
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Schizophrenia is a serious mental disorder that is affected by genetic and environmental factors. As the disease has a high heritability rate, genetic studies identifying candidate genes for schizophrenia have been conducted in various populations. The gene for human Ran‑binding protein 9 (RANBP9) is a newly discovered candidate gene for schizophrenia. As RANBP9 is a small guanosine‑5'‑triphosphate‑binding protein that interacts with the disrupted in schizophrenia 1 protein, it is considered to be an important molecule in the pathogenesis of schizophrenia. However, to date, no study has examined the possible association between the genetic variations of RANBP9 and the risk of schizophrenia. In the present study, it was hypothesized that RANBP9 variations may influence the risk of schizophrenia. In order to investigate the association between RANBP9 polymorphisms and the risk of schizophrenia and smooth pursuit eye movement (SPEM) abnormalities, a case‑control association analysis was performed. Using a TaqMan assay, five single‑nucleotide polymorphisms and an insertion/deletion variation within the start codon region of RANBP9 were genotyped. Five major haplotypes were identified in 449 patients with schizophrenia and 393 unrelated healthy individuals as controls (total, n=842). However, the association analyses revealed no associations between all genetic variants and schizophrenia and SPEM abnormality. To the best of our knowledge, this is the first study to investigate an association between RANBP9 polymorphisms and schizophrenia and SPEM abnormality. The findings of allele frequencies and association results in this study may aid in further genetic etiological studies in schizophrenia in various populations.

Introduction

Schizophrenia is a severe cognitive disorder that is characterized by psychosis, disorganized speech and behavioral symptoms. The observed lifetime prevalence estimates and morbidity rate of this condition in the general population is 4.0 in 1,000 and 7.2 in 1,000 people, respectively (1,2). In the etiology of schizophrenia, the disease development is attributable to a combination of environmental and genetic risk factors. Previous molecular genetic studies have identified abnormalities in the structure of oligodendrocytes and myelin in schizophrenic brains (3–8), factors that may contribute to the disorganized behavioral symptoms in schizophrenia patients (9). Despite the well-defined factors involved in disease development, the exact molecular mechanisms of schizophrenia remain unclear and require further investigation.

Proteins involved in the dopamine or glutamate signaling pathways, which regulate nerve growth and development, have been hypothesized to be candidate molecules for indicating the risk of schizophrenia. The human Ran-binding protein 9 (RANBP9; NM_005493.2) is a member of the Ran-binding family of proteins and interacts with multiple receptors, acting as a scaffold protein for signal transduction processes (10). To date, although the function of RANBP9 is poorly understood, it is considered to be an important regulator of neurite growth through interactions with neural cell adhesion molecules, including L1 (10). It has been suggested that RANBP9, as a ligand for Rho-GEF, may be involved in regulating dendritic spine and branch morphology (11). In addition, RANBP9 has been demonstrated to interact with several important proteins associated with schizophrenia, such as disrupted in schizophrenia 1 (DISC1) and the dopamine D1 receptor in brain tissue (12,13). DISC1 is hypothesized to be associated with major mental illnesses, including schizophrenia, autism and bipolar disorder, and is involved in the regulation of neuronal axon and dendrite outgrowth (14,15). The aberrant dopamine D1 receptor is linked to various neuropsychiatric disorders such as substance abuse, schizophrenia and Parkinson’s disease (16). Despite insufficient knowledge with regard to the association between RANBP9 and schizophrenia, RANBP9 is predicted to be involved in the pathogenesis of the disease.

In the present study, a case-control association analysis was conducted between genetic variations in RANBP9 and the risk of schizophrenia and smooth pursuit eye movement (SPEM) abnormalities in a Korean population.

Materials and methods

Subjects

Trained psychiatrists diagnosed schizophrenia based on the criteria set forth by the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (17). Patients with additional, complicating diagnoses of mental retardation, organic brain damage, drug or alcohol abuse, neurological disorders, autoimmune disorders or low comprehension skills were excluded from the study. Schizophrenia patients (n=449) were recruited over 10 years from Jinju Mental Hospital (Jinju, Korea), Soonyoung Hospital (Sacheon, Korea), Hadong Wooridle Hospital (Gyeongsang Nam Do, Korea), Seoul National University Hospital (Seoul, Korea) and Keyo Hospital (Kyunggi-Do, Korea). Unrelated healthy controls (n=393) were recruited from Hangang Sacred Heart Hospital and the Center for Health Promotion at Seoul National University Hospital. Peripheral blood leukocytes from 842 samples were collected in tubes containing sodium EDTA and genomic DNA was subsequently obtained using the QIAamp blood extraction kit (Qiagen, Valencia, CA, USA). The study protocols were approved by the institutional review boards of each hospital (Jinju Mental Hospital, Soonyoung Hospital, Hadong Wooridle Hospital, Seoul National University Hospital and Keyo Hospital) and the experiments were conducted with the understanding and written informed consent from each patient.

Measurement of SPEM

In total, 125 schizophrenia patients, who were able to understand the experimental procedure underwent an eye-tracking task as described previously (18). The electrooculographic recordings of the eye movements were used to quantify SPEM abnormality and calculate the natural logarithmic values of the signal/noise (Ln S/N) ratio.

Genetic variation selection and genotyping in the RANBP9 gene

In total, five single nucleotide polymorphisms (rs24023, rs442458, rs6940759, rs204226 and rs11759518) and an insertion/deletion (rs16724) variation in RANBP9 were selected from the International HapMap Database (http://hapmap.ncbi.nlm.nih.gov/). Commercially available predesigned TaqMan probes and designed primers (Applied Biosystems, Foster City, CA, USA) were used in genotyping (Table I). All polymorphisms satisfied the following criteria: (i) A minimum call rate of 95% and (ii) Hardy-Weinberg equilibrium (HWE) of P>0.05. Haplotypes were inferred from the genotyped polymorphisms using the PHASE algorithm, version. 2.0 (19) and those with a frequency of >0.05 were included in the association analysis.

Table I

Assay IDs of human Ran-binding protein 9 variations.

Table I

Assay IDs of human Ran-binding protein 9 variations.

LociProbe sequence or Assay-by-design ID*Method
rs24023C__11661329_10TaqMan assay
rs442458C____580920_10TaqMan assay
rs6940759Forward ACCAATGCAGCACAATGATAGGTTATaqMan assay by design
Reverse CAGTAGCAGTAGCAAAGGAGAAGTA
VIC® CTTATTCTGTGACTTTAAAG
FAM CTTATTCTGTGATTTTAAAG
rs204226C___7615918_20TaqMan assay
rs16724Forward GCTATTCCCTCCACCTTTCCTTTaqMan assay by design
Reverse TTGAGGAAGTAAAGCTTGAGCTAAGATTT
VIC® CCTGAGTAGGTAGGTCCTA
FAM TAGCCTGAGTAGGTCCTA
rs11759518C___2974708_10TaqMan assay

* TaqMan assay IDs from Applied Biosystems, Foster City, CA, USA.

{ label (or @symbol) needed for fn[@id='tfn2-mmr-11-04-2975'] } FAM, 6-carboxyfluorescein.

Statistical analysis

Lewontin’s D′ (|D′|) and linkage disequilibrium (LD) coefficient r2 between all pairs of biallelic loci using the Haploview algorithm were examined (20). The odds ratio (95% confidence interval) and corresponding P-values were calculated using a logistic model, controlling for age (continuous value) as a covariate. P<0.05 was considered to indicated a statistically significant difference between values. The Ln S/N ratio was calculated from analysis of the power spectrum curves and the results were used in logistic analysis of SPEM abnormality, controlling for age as a covariate. Values are presented as the mean ± standard deviation.

Results

Characteristics of study subjects

To elucidate whether there is a genetic association between RANBP9 polymorphisms and schizophrenia, a case-control association analysis with 449 schizophrenia patients and 393 healthy subjects was conducted. Table II provides a summary of the clinical profiles in this study. Although the mean age of the control subjects was slightly higher than that of the experimental group, the range of ages was similar in the two groups (Table II). The percentage of males in both groups was also similar (males in case vs. control groups, 55.7% vs. 56.5% respectively). Among the case subjects, 125 schizophrenia patients were measured for Ln S/N ratios of SPEM abnormality using an eye-tracking task. The patients were categorized into ‘good’ and ‘poor’ performers, according to their SPEM function, based on whether their Ln S/N ratio was above or below 3.97. The Ln S/N ratios (mean ± standard deviation) of the good and poor SPEM function groups were 4.32±0.30 and 3.23±0.65, respectively. A significant difference between good and poor groups (P<0.001) was observed (Table II). Association analysis of SPEM function abnormality in normal controls was not performed due to the low incidence of SPEM impairment in healthy subjects (<10%) and association analysis could not retain adequate statistical power due to the low number of samples.

Table II

Summary of clinical profiles.

Table II

Summary of clinical profiles.

ParametersSchizophrenia patientsHealthy controls
Subjects, n449393
Average age, years (range)44.92 (23–76)54.62 (28–80)
Gender, n (male/female)250/199222/171


Poor (<3.97)Good (≥3.97)

Subjects, n5867
Average age, years46.0 ± 9.1844.2 ± 9.27
Ln S/N ratio*3.23 ± 0.654.32 ± 0.30

* Significant difference between poor and good smooth pursuit eye movement groups (P<0.001). Data are presented as the mean ± standard error of the mean.

{ label (or @symbol) needed for fn[@id='tfn4-mmr-11-04-2975'] } Ln S/N, natural logarithmic values of the signal/noise.

Genotyping of RANBP9 polymorphisms

All RANBP9 polymorphisms were successfully genotyped in a total of 842 subjects; two variations were localized in the promoter (rs24023 and rs442458) and the other four variants in the intron (rs6940759, rs204226, rs16724 and rs11759518) of the gene (Fig. 1A). No significant deviations from HWE were observed in any of the polymorphisms (P>0.05). Based on the results of a pair-wise comparison of the variations, a total of 13 haplotypes were inferred (Fig. 1B). Of these, five common haplotypes with frequencies >0.05 were identified.

Figure 1

Schematic physical map, haplotypes and LD plot of RANBP9. (A) Physical map of RANBP9. Black boxes indicate an exon region and the white box indicates an UTR. (B) Haplotypes of six RANBP9 polymorphisms. Only the five haplotypes with a frequency of >0.05 were used for further analysis. (C) LD plot of six RANBP9 polymorphisms. UTR, untranslated region; LD, linkage disequilibrium; RANBP9, Ran-binding protein 9.

Association analysis of RANBP9 polymorphisms with schizophrenia and SPEM abnormality

Allele frequencies of six polymorphisms were compared between schizophrenia patients and healthy controls using logistic analysis, controlling for age as a covariate. However, no associations between RANBP9 variations and schizophrenia were identified (Table III). In the analysis of SPEM abnormality, no significant association was revealed following the logistic analysis of RANBP9 polymorphisms and haplotypes (Table IV).

Table III

Association analysis of RANBP9 variations with schizophrenia in a Korean population.

Table III

Association analysis of RANBP9 variations with schizophrenia in a Korean population.

MAF

LociSchizophrenia (n=449)Control (n=393)OR (95% CI)P-valueStatistical powera
rs240230.3890.3941.01 (0.81–1.26)0.9495.04
rs4424580.2190.2171.08 (0.83–1.41)0.5687.56
rs69407590.1790.180.98 (0.74–1.30)0.8983.04
rs2042260.4220.3881.14 (0.91–1.42)0.2594.97
rs167240.1740.1770.96 (0.72–1.27)0.7682.58
rs117595180.0890.0871.04 (0.71–1.53)0.8458.15
ht10.4170.3771.16 (0.93–1.45)0.1994.81
ht20.2130.2131.06 (0.81–1.38)0.6887.16
ht30.1770.2130.77 (0.58–1.03)0.0887.16
ht40.0840.0831.04 (0.70–1.55)0.8656.40
ht50.0730.0810.89 (0.59–1.34)0.5755.50

a Statistical power was calculated using the Power for Genetic Association Analyses software.

{ label (or @symbol) needed for fn[@id='tfn6-mmr-11-04-2975'] } OR, odds ratio; CI, confidence interval; MAF, minor allele frequency.

Table IV

Association analysis of RAN binding protein 9 variations with smooth pursuit eye movement abnormality.

Table IV

Association analysis of RAN binding protein 9 variations with smooth pursuit eye movement abnormality.

MAF

LociPoor (<3.97, n=58)Good (≥3.97, n=67)OR (95% CI)P-value
rs240230.4390.3681.28 (0.78–2.10)0.33
rs4424580.2390.1931.14 (0.62–2.08)0.67
rs69407590.2060.2021.15 (0.65–2.04)0.62
rs2042260.4250.4210.99 (0.61–1.61)0.98
rs167240.2060.2021.15 (0.65–2.04)0.62
rs117595180.1080.0881.46 (0.60–3.54)0.41
ht10.3960.4210.90 (0.56–1.46)0.67
ht20.2090.1930.98 (0.52–1.84)0.95
ht30.1570.1840.85 (0.44–1.62)0.62
ht40.1040.0881.45 (0.59–3.54)0.41
ht50.0750.0880.91 (0.34–2.41)0.84

[i] OR, odds ratio; CI, confidence interval; MAF, minor allele frequency.

Discussion

RANBP9, also known as RanBPM, was first reported in 2002 as a protein that interacts with the MET proto-oncogene (21). In previous studies, RANBP9 was revealed to interact with other important molecules such as amyloid precursor protein (APP) and protein kinase C (PKC) δ and γ (16,22). The two kinases have been reported to be associated with mental disorders. Missense mutations in APP have been shown to be associated with cerebral hemorrhage, multi-infarct dementia and Alzheimer’s disease, but not directly with schizophrenia (23). However, a recent study has reported the defective metabolism of APP in older schizophrenia patients (age, >70), suggesting that APP may be involved in schizophrenia etiology (24). PKC is known to phosphorylate the dopamine D1 receptor and negatively regulate dopaminergic signaling (12). A defect in dopamine signaling has been associated with cognitive disorders such as alcohol abuse and schizophrenia and dopamine D1 receptor antagonist SKF-38393 treatment was revealed to improve the cognitive function in animal models with cognitive deficits similar to schizophrenia (25).

Despite the potentially critical role of RANBP9 in mental disorders as previously demonstrated, relatively few studies have been conducted investigating this gene. In a previous study, RANBP9 was observed to be highly expressed in the neurons of the cerebral cortex and the cerebral Purkinje cells in a similar pattern to fragile X mental retardation protein (FMRP) (26). FMRP is known to cause fragile X syndrome, a common form of hereditary mental retardation. The authors reported that RANBP9 was closely associated with the disorder, and was found to modulate the RNA binding properties of FMRP. In another study, researchers revealed that the concentration of RANBP9-N60, a processed form of RANBP9 almost identical to the RANBP9-Delta1/N60 mutant, was increased in the brain cells of Alzheimer’s patients (22). In the study, the authors demonstrated that RANBP9-N60 increased the amyloid β generation rate by more than five-fold and therefore drove the amyloid cascade in Alzheimer’s disease. The authors hypothesized that the proteolytic processing of RANBP9 may be an ideal therapeutic target.

Although several reports have suggested a possible association between RANBP9 and schizophrenia, the results presented in the current study demonstrated that the genetic variants of RANBP9 were not associated with schizophrenia and SPEM abnormality in a Korean population. However, the present study is the first to conduct association analyses between RANBP9 polymorphisms and schizophrenia. To the best of our knowledge, although, an association study of RANBP9 variants with cognitive disorders such as schizophrenia has not been previously conducted, genetic variants of RANBP1 were recently investigated by our group for possible associations with schizophrenia and SPEM abnormality in a Korean population (27). In the study, two polymorphisms of RANBP1, rs2238798 and rs175162, were genotyped for association analysis. The results indicated that, while the two variations did not exhibit any association with schizophrenia, the haplotype rs2238978G-rs175162T was significantly associated with the risk of SPEM abnormality. According to these results, although RANBP1 and RANBP9 have a similar role, their effects on SPEM abnormality vary. While the exact functions of the proteins are not fully understood, the most prominent difference between the two is that RANBP1 binds specifically with guanosine-5′-triphosphate (GTP)-charged RAN and increases GTP hydrolysis (28). This difference may account for the association between RANBP1 and SPEM abnormality, however further studies would be required to confirm this hypothesis.

To the best of our knowledge, while the present study is the first to investigate the possible association of RANBP9 variants with schizophrenia and SPEM abnormality, certain limitations are apparent. Due to the rarity of the disease, the number of patients in the study may not have been large enough to generate adequate statistical power. Moreover, the number of schizophrenia patients who were able to test for SPEM was also small. Despite this, the method used to measure SPEM function is used worldwide and is adequate for a genetic association analysis. However, a larger number patient population may be required to confirm the results of the present study. Furthermore, a functional study comparing and contrasting the roles of RANBP1 and RANBP9 may be crucial for deducing the causal variation in SPEM abnormality.

In conclusion, association analyses between RANBP9 variants and the risk of schizophrenia were conducted, however no significant association was identified. Logistic analyses were also conducted to search for a possible association between RANBP9 variants and SPEM abnormality. However, no significant difference was identified. As RANBP9 was only recently discovered, the exact mechanism and function of the protein is not fully understood. Therefore, despite the lack of positive results, the present study may provide a meaningful insight into the role of RANBP9. Further studies comparing a larger number of samples may be beneficial to confirm the results of the present study, as well as elucidate the precise differences between RANBP1 and RANBP9, which may be critical in determining the exact cause of SPEM abnormality.

Acknowledgements

This study was supported by a grant from the Korea Healthcare Technology R and D Project, Ministry of Health and Welfare, Republic of Korea (grant no. A101023), The National Research Foundation of Korea grant, funded by the Korean government (grant no. 2011-0011935) and the Ministry of Education, Science and Technology, Republic of Korea (grant no. 2009-0093822).

References

1 

McGrath J, Saha S, Chant D and Welham J: Schizophrenia: a concise overview of incidence, prevalence, and mortality. Epidemiol Rev. 30:67–76. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Torrey EF: Prevalence studies in schizophrenia. Br J Psychiatry. 150:598–608. 1987. View Article : Google Scholar : PubMed/NCBI

3 

Park HJ, Westin CF, Kubicki M, et al: White matter hemisphere asymmetries in healthy subjects and in schizophrenia: a diffusion tensor MRI study. Neuroimage. 23:213–223. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Hof PR, Haroutunian V, Friedrich VL Jr, et al: Loss and altered spatial distribution of oligodendrocytes in the superior frontal gyrus in schizophrenia. Biol Psychiatry. 53:1075–1085. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Hulshoff Pol HE, Schnack HG, Mandl RC, et al: Focal white matter density changes in schizophrenia: reduced inter-hemispheric connectivity. Neuroimage. 21:27–35. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Kubicki M, McCarley RW and Shenton ME: Evidence for white matter abnormalities in schizophrenia. Curr Opin Psychiatry. 18:121–134. 2005. View Article : Google Scholar

7 

Uranova N, Orlovskaya D, Vikhreva O, et al: Electron microscopy of oligodendroglia in severe mental illness. Brain Res Bull. 55:597–610. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Uranova NA, Vostrikov VM, Orlovskaya DD and Rachmanova VI: Oligodendroglial density in the prefrontal cortex in schizophrenia and mood disorders: a study from the Stanley Neuropathology Consortium. Schizophr Res. 67:269–275. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Mitterauer B: The incoherence hypothesis of schizophrenia: based on decomposed oligodendrocyte-axonic relations. Med Hypotheses. 69:1299–1304. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Murrin LC and Talbot JN: RanBPM, a scaffolding protein in the immune and nervous systems. J Neuroimmune Pharmacol. 2:290–295. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Nakayama AY, Harms MB and Luo L: Small GTPases Rac and Rho in the maintenance of dendritic spines and branches in hippocampal pyramidal neurons. J Neurosci. 20:5329–5338. 2000.PubMed/NCBI

12 

Rex EB, Rankin ML, Ariano MA and Sibley DR: Ethanol regulation of D(1) dopamine receptor signaling is mediated by protein kinase C in an isozyme-specific manner. Neuropsychopharmacology. 33:2900–2911. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Kutay U, Hartmann E, Treichel N, et al: Identification of two novel RanGTP-binding proteins belonging to the importin beta superfamily. J Biol Chem. 275:40163–40168. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Blackwood DH, Fordyce A, Walker MT, St Clair DM, Porteous DJ and Muir WJ: Schizophrenia and affective disorders--cosegregation with a translocation at chromosome 1q42 that directly disrupts brain-expressed genes: clinical and P300 findings in a family. Am J Hum Genet. 69:428–433. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Millar JK, Christie S, Anderson S, et al: Genomic structure and localisation within a linkage hotspot of Disrupted In Schizophrenia 1, a gene disrupted by a translocation segregating with schizophrenia. Mol Psychiatry. 6:173–178. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Rex EB, Rankin ML, Yang Y, et al: Identification of RanBP 9/10 as interacting partners for protein kinase C (PKC) gamma/delta and the D1 dopamine receptor: regulation of PKC-mediated receptor phosphorylation. Mol Pharmacol. 78:69–80. 2010. View Article : Google Scholar : PubMed/NCBI

17 

American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders. 4th edition. American Psychiatric Association; Washington, D.C., WA: 1994

18 

Park BL, Shin HD, Cheong HS, et al: Association analysis of COMT polymorphisms with schizophrenia and smooth pursuit eye movement abnormality. J Hum Genet. 54:709–712. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Stephens M, Smith NJ and Donnelly P: A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 68:978–989. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar

21 

Wang D, Li Z, Messing EM and Wu G: Activation of Ras/Erk pathway by a novel MET-interacting protein RanBPM. J Biol Chem. 277:36216–36222. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Lakshmana MK, Hayes CD, Bennett SP, et al: Role of RanBP9 on amyloidogenic processing of APP and synaptic protein levels in the mouse brain. FASEB J. 26:2072–2083. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Morris S, Leung J, Sharp C, Blackwood D, Muir W and St Clair D: Screening schizophrenic patients for mutations in the amyloid precursor protein gene. Psychiatr Genet. 4:23–27. 1994. View Article : Google Scholar : PubMed/NCBI

24 

Albertini V, Benussi L, Paterlini A, et al: Distinct cerebrospinal fluid amyloid-beta peptide signatures in cognitive decline associated with Alzheimer’s disease and schizophrenia. Electrophoresis. 33:3738–3744. 2012. View Article : Google Scholar : PubMed/NCBI

25 

McLean SL, Idris NF, Woolley ML and Neill JC: D(1)-like receptor activation improves PCP-induced cognitive deficits in animal models: Implications for mechanisms of improved cognitive function in schizophrenia. Eur Neuropsychopharmacol. 19:440–450. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Menon RP, Gibson TJ and Pastore A: The C terminus of fragile X mental retardation protein interacts with the multi-domain Ran-binding protein in the microtubule-organising centre. J Mol Biol. 343:43–53. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Cheong HS, Park BL, Kim EM, et al: Association of RANBP1 haplotype with smooth pursuit eye movement abnormality. Am J Med Genet B Neuropsychiatr Genet. 156B:67–71. 2011. View Article : Google Scholar

28 

Kehlenbach RH, Dickmanns A, Kehlenbach A, Guan T and Gerace L: A role for RanBP1 in the release of CRM1 from the nuclear pore complex in a terminal step of nuclear export. J Cell Biol. 145:645–657. 1999. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bae JS, Kim JY, Park BL, Cheong HS, Kim JH, Namgoong S, Kim JO, Park CS, Kim BJ, Lee CS, Lee CS, et al: Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia. Mol Med Rep 11: 2975-2980, 2015.
APA
Bae, J.S., Kim, J.Y., Park, B., Cheong, H.S., Kim, J., Namgoong, S. ... Woo, S. (2015). Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia. Molecular Medicine Reports, 11, 2975-2980. https://doi.org/10.3892/mmr.2014.3045
MLA
Bae, J. S., Kim, J. Y., Park, B., Cheong, H. S., Kim, J., Namgoong, S., Kim, J., Park, C. S., Kim, B., Lee, C., Lee, M., Choi, W. H., Shin, T., Hwang, J., Shin, H. D., Woo, S."Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia". Molecular Medicine Reports 11.4 (2015): 2975-2980.
Chicago
Bae, J. S., Kim, J. Y., Park, B., Cheong, H. S., Kim, J., Namgoong, S., Kim, J., Park, C. S., Kim, B., Lee, C., Lee, M., Choi, W. H., Shin, T., Hwang, J., Shin, H. D., Woo, S."Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia". Molecular Medicine Reports 11, no. 4 (2015): 2975-2980. https://doi.org/10.3892/mmr.2014.3045
Copy and paste a formatted citation
x
Spandidos Publications style
Bae JS, Kim JY, Park BL, Cheong HS, Kim JH, Namgoong S, Kim JO, Park CS, Kim BJ, Lee CS, Lee CS, et al: Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia. Mol Med Rep 11: 2975-2980, 2015.
APA
Bae, J.S., Kim, J.Y., Park, B., Cheong, H.S., Kim, J., Namgoong, S. ... Woo, S. (2015). Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia. Molecular Medicine Reports, 11, 2975-2980. https://doi.org/10.3892/mmr.2014.3045
MLA
Bae, J. S., Kim, J. Y., Park, B., Cheong, H. S., Kim, J., Namgoong, S., Kim, J., Park, C. S., Kim, B., Lee, C., Lee, M., Choi, W. H., Shin, T., Hwang, J., Shin, H. D., Woo, S."Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia". Molecular Medicine Reports 11.4 (2015): 2975-2980.
Chicago
Bae, J. S., Kim, J. Y., Park, B., Cheong, H. S., Kim, J., Namgoong, S., Kim, J., Park, C. S., Kim, B., Lee, C., Lee, M., Choi, W. H., Shin, T., Hwang, J., Shin, H. D., Woo, S."Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia". Molecular Medicine Reports 11, no. 4 (2015): 2975-2980. https://doi.org/10.3892/mmr.2014.3045
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team