Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
August-2015 Volume 12 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2015 Volume 12 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene

  • Authors:
    • Xiaoming Zhu
    • Yang Yang
    • Tao Han
    • Guowu Yin
    • Ping Gao
    • Yunfeng Ni
    • Xiaohua Su
    • Yuying Liu
    • Yuanqing Yao
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, Tangdu Hospital, Fourth Military Medical University, Xi'an, Shanxi 710038, P.R. China, Department of Obstetrics and Gynecology, Affiliated Hospital of Xi'an Medical University, Xi'an, Shanxi 710077, P.R. China, Department of Orthopedics, Hainan Branch of PLA General Hospital, Sanya, Hainan 572013, P.R. China, Department of Obstetrics and Gynecology, General Hospital of Chinese People's Liberation Army, Beijing 100853, P.R. China, Department of Thoracic Surgery, Tangdu Hospital, Fourth Military Medical University, Xi'an, Shanxi 710038, P.R. China
  • Pages: 2701-2706
    |
    Published online on: May 4, 2015
       https://doi.org/10.3892/mmr.2015.3724
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The purpose of the present study was to gain further understanding of the function of microRNA-18a (miR-18a) expression in the JEG‑3 human trophoblast cell line. JEG‑3 cells were transfected with pre‑miR‑18a mimics or miR‑18a inhibitors. The effects of miR‑18a on trophoblast cell invasion and apoptosis, and on the expression of estrogen receptor α (ESRα) were analyzed using a Transwell invasion assay, flow cytometry, reverse transcription‑polymerase chain reaction, western blot analysis and a luciferase assay. The results of the present study suggested that miR‑18a expression suppression led to a decrease in JEG‑3 cell invasion and an increase in JEG‑3 cell apoptosis, by inducing ESRα expression. The present study provides evidence for the involvement of miR‑18a in the pathogenesis of pre-eclamptic pregnancies.

Introduction

MicroRNAs (miRs) are a class of small (21–24 bp), noncoding RNAs, which are involved in the negative regulation of gene expression. miRs bind to complementary sequences in the 3′-untranslated region (3′-UTR) of their target mRNAs, causing destabilization of the transcript or inhibition of translation (1–3). miRs are involved in a number of biological and pathological processes, including cell proliferation, cell differentiation and carcinogenesis (4,5). Previous studies have suggested that miR expression is tissue-specific and that a number of miRs are expressed in the human placenta (6,7). A previous study demonstrated that miR-18a is downregulated in pre-eclamptic placentas (8). miR-18a is a component of the miR-17-92 gene cluster, which is located on chromosome 13q31.3. Evidence has suggested that miR-18a targets the estrogen receptor α-3′ (ESRα-3′) UTR in human hepatocellular carcinoma cells (9).

ESRs are ligand-activated transcription factors. They are members of the nuclear hormone receptor superfamily, which mediate the pleiotropic effects of the steroid hormone, estrogen via a range of developmental and physiological processes (10). There are two forms of ESR: ESRα and ESRβ, which are encoded by ESR1 and ESR2, respectively. ESRα is predominantly expressed in the ovaries, uterus and placenta (11), while ESRβ is expressed in a number of types of tissues (12). A previous study suggested that ESRα mRNA and protein levels were significantly increased in pre-eclamptic pregnancies compared with levels in healthy pregnancies (13).

Previous studies have demonstrated that miR-18a is under-expressed (8), and ESRα is overexpressed, in pre-eclamptic placentas (13). The results of previous studies have suggested that miR-18a may be involved in the pathogenesis of pre-eclamptic pregnancies via ESRα regulation. In order to gain further understanding of the association between miR-18a and ESRα in human trophoblast cells, the present study analyzed the effect of miR-18a on trophoblast invasion, cell apoptosis and ESRα expression in JEG-3 cells.

Materials and methods

Cell culture and transient transfection

JEG-3 human trophoblast choriocarcinoma cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). JEG-3 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco Life Technologies, Carlsbad, CA, USA), containing 10% fetal bovine serum (FBS; Gibco Life Technologies, Carlsbad, CA, USA). Cells were cultured at 37°C, in a humidified atmosphere at 5% CO2.

Pre-miR-18a mimics (pre-miR-18a), pre-miR negative control (NC), an miR-18a inhibitor and miR-18a inhibitor FAM-labeled controls were used to determine the transfection efficiency and were purchased from Jima (Beijing, China). JEG-3 cells were transfected with pre-miR-18a or miR-18a inhibitors using Lipofectamine 2000® (Gibco Life Technologies) according to the manufacturer’s instructions. The medium was replaced with fresh growth medium following 12 h of transfection. Following 48–72 h of transfection, a Transwell invasion assay was conducted.

Transwell invasion assay

Transfected cells were seeded at 4×105 cells/insert in Transwell inserts (8-μm pore size; Costar, Corning, Cambridge, MA, USA) pre-coated with BD matrigel matrix (BD Biosciences, USA), and they were incubated with DMEM medium, without FBS. Lower chambers were loaded with DMEM medium, containing 10% FBS.

Cells were incubated at 37°C for 24 h. Following incubation, invading cells were fixed with 95% ethanol and stained using crystal violet (Beyotime Institue of Biotechnology, Nanjing, China). Non-invading cells were removed with a cotton swab. The cell invasion index was determined by counting the number of stained cells in ten randomly selected non-overlapping fields of the membranes, using a light microscope (TE2000S; Nikon, Japan; magnification, x200).

Cell apoptosis assay via flow cytometry

Following transfection for 48 h, JEG-3 cell apoptosis was analyzed using flow cytometry. 5×105 treated cells/well were seeded into 24-well plates and were incubated with annexin V and propidium iodide (BD Biosciences, San Diego, CA, USA) for 15 min at room temperature, in darkness. Cells were then analyzed using a fluorescence activated cell sorting (FACS) flow cytometer (BD Biosciences). Experiments were repeated three times.

Reverse transcription-polymerase chain reaction (RT-PCR) analysis

Total RNA was isolated from JEG-3 cells using TRIzol® (Invitrogen Life Technologies, Carlsbad, CA, USA). RNA integrity was confirmed using electrophoresis in a 1.5% agarose denaturing gel (Sangon Biotech, Shanghai, China). In order to detect the presence of ESRα, 1 μg total RNA was reverse transcribed into cDNA and primed with oligonucleotides, using a RevertAid first-strand cDNA synthesis kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania). β-Actin was used as a positive control.

In order to detect the miR, 2 μg of total RNA was reverse transcribed into cDNA with a gene-specific RT primer, which is capable of folding into a stem-loop structure. The highly conserved and universally expressed small nuclear RNA, U6, was used as an endogenous control. Primer sequences and PCR conditions are provided in Table I. A 25-μl PCR master mix was prepared as follows: RT products (1 μl), dNTPs (200 μmol/l), MgCl2 (2 mmol/l), Taq DNA polymerase (1 IU)and primers (10 pmol).

Table I

Primer sequences and reaction conditions for reverse transcription-polymerase chain reaction.

Table I

Primer sequences and reaction conditions for reverse transcription-polymerase chain reaction.

GenePrimer sequencesAnnealing temperature (°C)Cycle (n)
ESRαF: CCTGGCTAGAGATCCTGAT5631
R: CCCTGGTTCCTGTCCAAGA
β-actinF: TCATCACTATTGGCAACGAGC5525
R: AACAGTCCGCCTAGAAGCAC
miR-18aRT: GTCGTATCCAGTGCAGGGTCCGAG5030
GTATTCGCACTGGATACGACTATCTG
F: GTGCTAAGGTGCATCTAGTGCAG
R: GTGCAGGGTCCGAGGT
U6RT: AACGCTTCACGAATTTGCGT5529
F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT

[i] RT-PCR, reverse-transcription polymerase chain reaction; F, forward; R, reverse; miR, microRNA; ESRα, estrogen receptor α.

PCR amplification was verified within the exponential phase of PCR using preliminary experiments. PCR products were subjected to electrophoresis on agarose gels, and the relative densities of target genes, standardized against that of the control genes was analyzed, using Image-Pro Plus (version 6.0; Media Cybernetics, Inc., Rockville, MD, USA).

Western blot analysis

Infected cells were washed three times with ice-cold phosphate-buffered saline (PBS) and then lysed with 1X lysis buffer (Cell Signaling Technology, Inc., Danvers, MA, USA). The supernatant was collected following centrifugation at 12,000 × g for 10 min at 4°C and protein estimation was conducted using a Bradford assay (14). Protein (30 μg) per lane was separated using 10% SDS-polyacry1-amide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane (Hybond; GE Healthcare, Chalfont, UK) via semidry electroblotting. The membrane was blocked in 5% non-fat milk in PBS with Tween-20® (PBST) for 1 h at room temperature, and incubated with rabbit antibodies against human ESRα (1:2,500; rabbit monolonal; cat. no. ab32063; Epitomics, Burlingame, CA, USA), in PBS at 4°C overnight.

The membrane was washed PBST and incubated with a horseradish peroxidase-conjugated secondary antibody (1:5,000; cat. no. cw0111; Kangwei, Beijing, China) for 1 h at room temperature. Expression signals were detected using the Enhanced Chemiluminescent Substrate (Pierce Biotechnology, Inc., Rockford, IL, USA). The membrane was stripped and reprobed with the rabbit-anti-human β-actin antibody (1:3,000; Abcam, Cambridge, UK), which was used as a positive control. ESRα expression was standardized against that of β-actin, which was determined using densi-tometric analysis (Image-Pro Plus 6.0; Media Cybernetics, Inc., Rockville, MD, USA).

Luciferase reporter assay

In order to perform a luciferase reporter assay, the 3′-UTR segment of ESRα, which contains the miR-18a binding site (NM_000125), was PCR amplified using the total RNA extracted from JEG-3 cells and the following primers for ESRα: Forward: 5′-CCTAGCTAGCCAATGACCCAGGTGAGCTGCTCG-3′ and reverse: 5′-CCTAGCTAGCCATTCAATTGTCTGATAAACAAGC-3′ (9). The reporter plasmid was cloned by inserting the 3′-UTR segment of ESRα into the XbaI site of a pGL3-Promoter vector (Promega Corporation, Madison, WI, USA), in order to generate pMIR-UTR. The mutant ESRα-3′-UTR fragment was generated using a QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, USA). Transfection was performed using a Lipofectamine 2000 reagent.

Transfections of JEG-3 cells were performed using pMIR-UTR and pre-miR-18a for the experimental group. For the negative control group, transfections were performed using pMIR-UTR and pre-miR-control. Transfections were performed with pMIR-UTR-mutant and pre-miR-18a, for the mutant control group. Following 48 h of transfection, cells were lysed and measured for luciferase activity using a luciferase assay system (Promega Corporation, Madison, WI, USA), according to the manufacturer’s instructions. Cells were also transfected with 50 ng pRL-TK vector as an internal standard.

Statistical analysis

Values are presented as the mean ± standard deviation of three individual experiments. Comparisons between groups were performed using one-way analysis of variance. In all cases P<0.05 was considered to indicate a statistically significant difference. Statistical analyses were performed using SPSS version 13.0 (SPSS, Inc., Chicago, IL, USA).

Results

Suppression of miR-18a expression inhibits JEG-3 cell invasion

A cell invasion assay was performed in order to investigate the effect of miR-18a on JEG-3 cell invasion. As shown in Fig. 1, the suppression of miR-18a significantly inhibited cell invasion in JEG-3 cells (29.67±3.06; P<0.05) compared with that in the NC and FAM control cells (66.67±3.06 and 57.67±2.52, respectively). The data suggested that suppression of miR-18a may inhibit the invasive capacity of JEG-3 cells.

Figure 1

Suppression of miR-18a expression inhibits JEG-3 cell invasion. (A) Invasion assay of JEG-3 cells transfected with an miR-18a inhibitor, miR-18a inhibitor FAM control or NC. The cells were stained with crystal violet and observed by microscopy (magnification, x200). (B) Densitometric analysis of invasion assay. Values represent the mean ± standard deviation of three independent experiments. *P<0.05 vs. FAM control and NC. miR, microRNA, NC, pre-miR-18a negative control.

Suppression of miR-18a leads to increased cell apoptosis in JEG-3 cells

A cell apoptosis assay was performed using flow cytometry, in order to investigate whether decreased miR-18a expression in JEG-3 cells was associated with a change in cell apoptosis. Following transfection with the miR-18a inhibitor, JEG-3 cell apoptosis was higher (58.63±3.27; P<0.05) than that in the control cells (NC, 19.50±0.92; FAM control, 23.30±1.37; Fig. 2). The results of the present study, therefore, suggested that the suppression of miR-18a expression may promote JEG-3 cell apoptosis.

Figure 2

Suppression of miR-18a leads to increased JEG-3 cell apoptosis. (A) Cell apoptosis assay of JEG-3 cells, transfected with miR-18a inhibitor, miR-18a inhibitor FAM control or NC. (B) Densitometric analysis of cell apoptosis assay. Values are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. controls. miR, microRNA; ESRα, estrogen receptor α; NC, negative control; B1, necrotic cells; B2, late apoptotic cells; B3, normal cells; B4, early apoptotic cells.

Validation of ESRα as a target of miR-18a in JEG-3 cells

In order to assess whether miR-18a affects ESRα expression, the levels of ESRα mRNA and protein were measured in JEG-3 cells that had been transfected with pre-miR-18a or miR-18a inhibitor. RT-PCR analysis suggested that transfection was effective (Fig. 3A). Significant differences were observed in ESRα mRNA expression levels: Pre-miR-18a, 0.25±0.01; NC, 0.32±0.01; miR-18a inhibitor, 0.82±0.02; P<0.05 (Fig. 3B). Significant differences were also observed in ESRα protein expression levels: pre-miR-18a, 0.66±0.02; NC, 0.96±0.01; miR-18a inhibitor, 1.03±0.01; P<0.05 (Fig. 3C). The results of the present study indicated that miR-18a downregulated ESRα mRNA and protein expression in JEG-3 cells compared with that in control cells.

Figure 3

miR-18a suppressed ESRα expression in JEG-3 cells, transfected with miR-18a inhibitor, miR-18a inhibitor FAM control or NC. (A) RT-PCR analysis of miR-18a expression in JEG-3 cells. Human U6 small nuclear RNA was used as an endogenous control. (B) RT-PCR analysis of ESRα mRNA levels in JEG-3 cells, following transfection for 48 h. β-actin was used as an endogenous control. (C) Western blot analysis of ESRα protein levels in JEG-3 cells following transfection for 72 h. β-actin was used as internal loading control. Values are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. NC. miR, microRNA; ESRα, estrogen receptor α; NC, negative control, RT-PCR, reverse transcription-polymerase chain reaction; pre-miR-18a, pre-miR mimic.

It has been shown that miRs modulate gene expression through association with the 3′-UTR region of target genes (1–3). A luciferase reporter assay was conducted, and a significant reduction (0.68±0.29; P<0.05) in luciferase activity was observed in pre-miR-18a-transfected cells, compared with cells in the control groups (NC, 0.98±0.35; mutant control, 0.98±0.19; Fig. 4). The results of the present study suggested that ESRα is involved in the regulation of miR-18a expression in JEG-3 cells.

Figure 4

miR-18a interacted with the 3′-UTR of the ESRα mRNA. For the experimental group, JEG-3 cells were transfected with pMIR-UTR and pre-miR-18a. For the negative control group, JEG-3 cells were transfected with pMIR-UTR and pre-miR-control. For the mutant control group, JEG-3 cells were trans-fected with pMIR-UTR-mutant and pre-miR-18a. Cells were also transfected with 50 ng pRL-TK vector as an internal standard. Values are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. controls. miR, microRNA; Luc, luciferase; ESRα, estrogen receptor α.

Discussion

Suppression of miR-18a expression leads to decreased cell invasion and increased cell apoptosis in JEG-3 human trophoblast cells, by inducing ESRα expression. The results of the present study supported the findings of Liu et al (9), which demonstrated that miR-18a may suppress ESRα expression in human hepatocellular carcinoma cells.

The JEG-3 cell line is a well-established human trophoblast cell model that has been used in studies investigating failed pregnancies (15–17). In the present study, in vitro experiments were performed in order to determine the effect of miR-18a on JEG-3 cell invasion. The results suggested that the suppression of miR-18a expression may inhibit the invasive capacity of JEG-3 cells. Xu et al (18) demonstrated that overexpression of miR-18a may promote cell invasion in HTR8/SVneo human trophoblast cells by targeting Smad2 expression. Smad2 mediates TGF-β signaling, which is involved in regulating trophoblast cell invasion (19–21). Therefore, miR-18a may regulate trophoblast cell invasion via the TGF-β signaling pathways. Furthermore, different types of miRs may be involved in the regulation of a single gene (22). Therefore, it will useful to examine other targets of miR-18a in future studies.

The suppression of miR-18a expression led to an increase in JEG-3 cell apoptosis. The results of the present study suggested that miR-18a may function as an antiapoptotic factor in human trophoblast cells. Previous studies have demonstrated that miR-18a is downregulated (8), whilst ESRα expression is upregulated (13), in pre-eclamptic placentas, compared with levels in healthy placentas. The expression of miR-18a was negatively correlated with ESRα expression in pre-eclampsia, which suggests that miR-18a is involved in the pathogenesis of pre-eclampsia, via negative regulation of ESRα expression (8–13). Recent studies have shown that ESRα expression is involved in cell apoptosis (23), and that a change in cell apoptosis is associated with the pathogenesis of pre-eclampsia (24). Therefore, the low expression of miR-18a may affect trophoblast cell apoptosis by regulating ESRα expression, which may contribute to pre-eclampsia. Further investigation is therefore required, in order to clarify the involvement of miR-18a in pre-eclamptic pregnancies.

The results of the present study demonstrated that miR-18a suppressed ESRα expression by targeting its 3′-UTR binding sites. However, ESRα expression was not completely inhibited in response to miR-18a overexpression (Fig. 4). miR-18a gene overexpression led to a decrease in luciferase reporter gene expression by ~30% (Fig. 4), which suggests that additional miRs may participate in the regulation of ESRα expression. Studies have demonstrated that a single gene may be regulated by a number of different miRs (1–3,22). Therefore, further studies are required, in order to investigate the involvement of other miRs in the regulation of ESRα expression.

In conclusion, the present study demonstrated that miR-18a expression suppresses ESRα expression by targeting binding sites in the 3′-UTR. The suppression of miR-18a led to a decrease in invasion and an increase in the apoptosis of JEG-3 cells. The present study, therefore, provides evidence for the involvement of miR-18a in the pathogenesis of pre-eclampsia.

Acknowledgments

This study was supported by the Chinese Natural Science Foundation (grant nos. 81471474/31000660 and 81170582), the Postdoctoral Science Foundation of China (grant nos. 2014T70964 and 2013M532203), and Tangdu Hospital Reserve Personnel Fund.

References

1 

Zeng Y: Principles of micro-RNA production and maturation. Oncogene. 25:6156–62. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Lai EC: microRNAs: runts of the genome assert themselves. Curr Biol. 13:R925–R936. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Ke XS, Liu CM, Liu DP and Liang CC: MicroRNAs: key participants in gene regulatory networks. Curr Opin Chem Biol. 7:516–23. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Bushati N and Cohen SM: microRNA functions. Annu Rev Cell Dev Biol. 23:175–205. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Sun BK and Tsao H: Small RNAs in development and disease. J Am Acad Dermatol. 59:725–737. 2008. View Article : Google Scholar

6 

Barad O, Meiri E, Avniel A, Aharonov R, Barzilai A, Bentwich I, Einav U, Gilad S, Hurban P, Karov Y, et al: MicroRNA expression detected by oligonucleotide microarrays: system establishment and expression profiling in human tissues. Genome Res. 14:2486–2494. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS and Johnson JM: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 433:769–773. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Zhu XM, Han T, Sargent IL, Yin GW and Yao YQ: Differential expression profile of microRNAs in human placentas from preeclamptic pregnancies vs normal pregnancies. Am J Obstet Gynecol. 200:661.e1–e7. 2009. View Article : Google Scholar

9 

Liu WH, Yeh SH, Lu CC, Yu SL, Chen HY, Lin CY, Chen DS and Chen J: MicroRNA-18a prevents estrogen receptor-alpha expression, promoting proliferation of hepatocellular carcinoma cells. Gastroenterology. 136(2): 683–693. 2009. View Article : Google Scholar

10 

Shao W and Brown M: Advances in estrogen receptor biology: prospects for improvements in targeted breast cancer therapy. Breast Cancer Res. 6:39–52. 2004. View Article : Google Scholar :

11 

Kuiper GG, Carlsson B, Grandien K, Enmark E, Häggblad J, Nilsson S and Gustafsson JA: Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology. 138:863–870. 1997.PubMed/NCBI

12 

Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S and Gustafsson JA: Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA. 93:5925–5930. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Yin G, Zhu X, Guo C, Yang Y, Han T, Chen L, Yin W, Gao P, Zhang H, Geng J, et al: Differential expression of estradiol and estrogen receptor α in severe preeclamptic pregnancies compared with normal pregnancies. Mol Med Rep. 7:981–985. 2013.PubMed/NCBI

14 

Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofproteindye binding. Anal Biochem. 72:248–254. 1976. View Article : Google Scholar : PubMed/NCBI

15 

Kilburn BA, Wang J, Duniec-Dmuchowski ZM, Leach RE, Romero R and Armant DR: Extracellular matrix composition and hypoxia regulate the expression of HLA-G and integrins in a human trophoblast cell line. Biol Reprod. 62:739–747. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Mouillot G, Marcou C, Zidi I, Guillard C, Sangrouber D, Carosella ED and Moreau P: Hypoxia modulates HLA-G gene expression in tumor cells. Hum Immunol. 68:277–285. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Yie SM, Li LH, Li GM, Xiao R and Librach CL: Progesterone enhances HLA-G gene expression in JEG-3 choriocarcinoma cells and human cytotrophoblasts in vitro. Hum Reprod. 21:46–51. 2006. View Article : Google Scholar

18 

Xu P, Zhao Y, Liu M, Wang Y, Wang H, Li YX, Zhu X, Yao Y, Wang H, Qiao J, et al: Variations of microRNAs in human placentas and plasma from preeclamptic pregnancy. Hypertension. 63:1276–1284. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Irving JA and Lala PK: Functional role of cell surface integrins on human trophoblast cell migration: regulation by TGF-beta, IGF-II, and IGFBP-1. Exp Cell Res. 217:419–427. 1995. View Article : Google Scholar : PubMed/NCBI

20 

Morrish DW, Dakour J and Li H: Functional regulation of human trophoblast differentiation. J Reprod Immunol. 39:179–195. 1998. View Article : Google Scholar : PubMed/NCBI

21 

Caniggia I, Grisaru-Gravnosky S, Kuliszewsky M, Post M and Lye SJ: Inhibition of TGF-beta 3 restores the invasive capability of extravillous trophoblasts in preeclamptic pregnancies. J Clin Invest. 103:1641–1650. 1999. View Article : Google Scholar : PubMed/NCBI

22 

Jackson RJ and Standart N: How do microRNAs regulate gene expression? Sci STKE. 2007:re12007. View Article : Google Scholar : PubMed/NCBI

23 

Chen P, Wang H, Duan Z, Zou JX, Chen H, He W and Wang J: Estrogen-related receptor alpha confers methotrexate resistance via attenuation of reactive oxygen species production and P53 mediated apoptosis in osteosarcoma cells. Biomed Res Int. 2014:6160252014. View Article : Google Scholar : PubMed/NCBI

24 

Levy R: The role of apoptosis in preeclampsia. Isr Med Assoc J. 7:178–181. 2005.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu X, Yang Y, Han T, Yin G, Gao P, Ni Y, Su X, Liu Y and Yao Y: Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene. Mol Med Rep 12: 2701-2706, 2015.
APA
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y. ... Yao, Y. (2015). Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene. Molecular Medicine Reports, 12, 2701-2706. https://doi.org/10.3892/mmr.2015.3724
MLA
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y., Su, X., Liu, Y., Yao, Y."Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene". Molecular Medicine Reports 12.2 (2015): 2701-2706.
Chicago
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y., Su, X., Liu, Y., Yao, Y."Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene". Molecular Medicine Reports 12, no. 2 (2015): 2701-2706. https://doi.org/10.3892/mmr.2015.3724
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu X, Yang Y, Han T, Yin G, Gao P, Ni Y, Su X, Liu Y and Yao Y: Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene. Mol Med Rep 12: 2701-2706, 2015.
APA
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y. ... Yao, Y. (2015). Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene. Molecular Medicine Reports, 12, 2701-2706. https://doi.org/10.3892/mmr.2015.3724
MLA
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y., Su, X., Liu, Y., Yao, Y."Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene". Molecular Medicine Reports 12.2 (2015): 2701-2706.
Chicago
Zhu, X., Yang, Y., Han, T., Yin, G., Gao, P., Ni, Y., Su, X., Liu, Y., Yao, Y."Suppression of microRNA-18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor α gene". Molecular Medicine Reports 12, no. 2 (2015): 2701-2706. https://doi.org/10.3892/mmr.2015.3724
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team