Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility

  • Authors:
    • Malgorzata Szczepańska
    • Adrianna Mostowska
    • Przemyslaw Wirstlein
    • Jana Skrzypczak
    • Matthew Misztal
    • Paweł P. Jagodziński
  • View Affiliations

  • Published online on: September 10, 2015     https://doi.org/10.3892/mmr.2015.4309
  • Pages: 7109-7115
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

It has recently been reported that vitamin D blood plasma levels are associated with reduced risk of endometriosis. The present study aimed to investigate whether the vitamin D binding protein (GC), vitamin D receptor (VDR), and retinoid X receptor (RXR) gene variants may be genetic risk factors for endometriosis‑associated infertility. The subjects consisted of 154 women with endometriosis‑associated infertility and 347 controls. Using polymerase chain reaction restriction fragment length polymorphism and high resolution melt techniques, the GC rs1155563, rs2298849 and rs7041; RXRA rs10881578, rs10776909 and rs749759; VDR BsmI rs1544410; and FokI rs2228570 single nucleotide polymorphisms (SNPs) were investigated in the patients with endometriosis and the healthy controls. The results indicated that no significant differences were observed between the genotype and allele frequencies of all experimental SNPs in the vitamin D signaling pathway genes in women with endometriosis-associated infertility and controls. However, a significant association was present between the A‑T haplotype, consisting of VDR rs1544410 and rs222857 minor alleles, and endometriosis-associated infertility [OR=1.659 (1.122‑2.453), P=0.011]. The results of the present study suggested that VDR gene variants act as genetic risk factors for endometriosis‑associated infertility.

Introduction

Endometriosis is a gynecological disorder that affects ~10% of women of reproductive age (1). The disease prevalence increases to 30–40% among infertile women (2,3). The development and persistence of endometriosis is associated with alterations in the immune and endocrine systems (3,4). The exact cause of endometriosis and accompanied infertility remains elusive (3,4). Development of endometriosis is hypothesized to be associated with genetic predisposition factors (5). The heritable traits of endometriosis have previously been reported, with a 5–7-fold increased risk of endometriosis development in first-degree relatives (6) There are numerous recognized endometriosis susceptibility genes, which are associated with steroid hormone action, immune response, oxidative stress, glucose homeostasis, vascular and tissue remodeling, and apoptosis (7,8). Endometriosis is characterized by the abnormal survival and growth of endometrial tissue in the abdominal organs (1), which are resistant to apoptosis (8,9). Among the critical factors affecting apoptosis in endometriosis, it has been proposed that survivinl may inhibit apoptosis (10). A recent study reported that increased blood plasma levels of vitamin D are associated with reduced risk of endometriosis, indicating that vitamin D has a beneficial role in the disease (11). Vitamin D is able to inhibit cell proliferation and trigger apoptosis of various types of cancer cell in animal models, as well as in vitro (12). Furthermore, the effects of vitamin D on malignant cells is mediated by inhibition of survivin overexpression (13).

Several proteins mediate the biological effects of vitamin D, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], in humans. Among these are vitamin D binding protein (VDBP), vitamin D receptor (VDR), and retinoid X receptor (RXR) (1416).

VDBP is encoded by the GC gene and is a protein involved in the blood transport of vitamin D and its metabolites (14). VDR binds to RXR, and these heterodimers interact with DNA to induce vitamin D gene expression in target cells (15,16).

A previous study demonstrated that GC single nucleotide polymorphisms (SNP) may affect blood plasma vitamin D levels (17). The VDR gene also exists in certain genetic variants, which may modulate the biological effect of vitamin D in target cells (18). Furthermore, RXRA gene variants are associated with the development of certain tumor types (19). In order to investigate whether RXRA, GC and VDR gene variants may be genetic risk factors of endometriosis-associated infertility, eight SNPs of these genes located in various blocks of linkage disequilibrium (LD) were selected for the present study.

Materials and methods

Patients and controls

Peripheral blood samples from women with endometriosis and healthy women were obtained from the Gynecologic and Obstetrical University Hospital, Division of Reproduction at Poznań University of Medical Sciences (Poznań, Poland). A total of 154 subjects were primary infertile women with endometriosis, and 347 women were used as fertile controls (Table I). The stage of endometriosis was assessed according to the revised classification of the American Society for Reproductive Medicine (20). The inclusion and exclusion criteria for the women with endometriosis and the fertile control women have been previously described (21). The fertile women assigned to the control group were examined for the cause of chronic pelvic pain in the absence of any pelvic abnormalities, as determined by laparoscopy. The controls were diagnosed as having varicose veins in the pelvic floor but no signs of past or present inflammation. Patients and controls were matched by age and were all Caucasian of Polish descent (Table I). Written informed consent was obtained from all participating individuals, and the present study was approved by the Local Ethical Committee of the Poznań University of Medical Sciences.

Table I

Clinical characteristics of women with endometriosis and controls.

Table I

Clinical characteristics of women with endometriosis and controls.

CharacteristicEndometriosisControls
Number154347
Age (years)33 (20–42)a33 (19–39)a
ParityNA1 (14)a
Duration of infertility (years)3 (17)aNA
rASRM (stage)
 Stage I (n=85)NANA
 Stage II (n=69)NANA

a Median range; rASRM, revised American Society for Reproductive Medicine classification; NA, not applicable.

Genotyping

Genomic DNA was obtained from peripheral blood leucocytes by salt extraction, as previously described (22). The DNA samples were subsequently genotyped for the eight SNPs in the RXRA, GC and VDR genes (Table II). The SNPs were selected with the use of the genome browsers of the International HapMap Consortium (http://www.hapmap.org/index.html.en), the UCSC genome browser (http://genome.ucsc.edu), and the dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/). The SNPs were selected based on functional significance, distinct location in the LD blocks, and minor allele frequency (>0.1) in the Caucasian population. Genotyping of the GC rs1155563 and rs2298849 and RXRA rs10881578 and rs10776909 SNPs was conducted by high resolution melting (HRM) using a LightCycler 480 system (Roche Diagnostics GmbH, Mannheim, Germany), with 5X HOT FIREPol® EvaGreen® quantitative polymerase chain reaction (PCR) Mix (Solis BioDyne, Tartu, Estonia). Genotyping of the GC rs7041, VDR BsmI rs1544410, FokI rs2228570, and RXRA rs749759, SNPs were performed by PCR followed by appropriate restriction enzyme digestion (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with PCR-restriction fragment length polymorphism (PCR-RFLP) according to the manufacturer's instructions (Thermo Fisher Scientific). The primer sequences and thermocycling conditions of the HRM and PCR-RFLP are presented in Table II. Genotyping quality was evaluated by repeated genotyping of 15% randomly selected samples.

Table II

Characteristics of the polymorphisms genotyped in the vitamin D associated genes, and genotyping conditions.

Table II

Characteristics of the polymorphisms genotyped in the vitamin D associated genes, and genotyping conditions.

GeneChr.rs no.SNP functionAllelesaMAFbPCR primers (5′–3′)Annealing temp. (ºC)PCR product length (bp)Melt. temp. range (ºC)HRMRFLP RE/RFL (bp)
GC4ql3.3rs7041missense (p.Asp432Glu)G/T0.42F: GGAGGTGAGTTTATGGAACAGC66.3493HaeIIIT=493
R: GGCATTAAGCTGGTATGAGGTCG=414+79
rs 1155563intronC/T0.25F: GGTTATTCTAAGACTGTGCTCTTGC63.011671–78
R: ATGTGTTCTCACTGTTCGACTCC
rs2298849intronC/T0.19F: TCCACTGGCAAAACACATTAC60.611873–83
R: GGGACATCTGCATTTATCCTG
RXRA9q34.2rsl0881578intronA/G0.29F: TCTTGAGCAATGCCAGCAG60.67580–90
R: CCACAGCTCACACATCCAATC
rs10776909intronC/T0.21F: CAGCCTGTGGCCTGCTCA60.69582–92
R: AACCTCCGGCCCTTGGAG
rs749759intronA/G0.24F: ATAGGGCTTGCCTGCCTAGA62.6382BstXIA=382
R: CTCCACCATAGCCCAAGTGAG=243+139
VDR12ql3.11rs1544410intronA/G0.40F: GGAGACACAGATAAGGAAATAC60.6248FspIA(B)=248
B/bR: CCGCAAGAAACCTCAAATAACAG(b)=175+73
rs2228570missense (p.Met51Thr)C/T0.40F: GCACTGACTCTGGCTCTGAC72.5341FokIC (F)=341
F/fR: ACCCTCCTGCTCCTGTGGCTT (f)=282+59

a According to the single nucleotide polymorphism database. Underline denotes the minor allele.

b MAF from the 1,000 genomes project for EUR samples. RE, restriction enzyme. RFL, restriction fragment length; SNP, single nucleotide polymorphism; PCR, polymerase chain reaction; HRM, high resolution melting; RFLP, restriction fragment length polymorphism.

Statistical analysis

For each SNP, the Hardy-Weinberg equilibrium (HWE) was assessed by Pearson's goodness-of-fit χ2 statistical test. The differences in allele and genotype frequencies between the patients and the controls were determined using standard χ2 or Fisher tests. The odds ratio (OR) and associated 95% confidence intervals (95% CI) were also calculated. The data were analyzed under recessive and dominant inheritance models. For the additive inheritance model, the SNPs were tested for association with endometriosis using the Cochran-Armitage trend test. To adjust for the multiple testing, a Bonferroni correction was used. Haplotype based association analysis was performed using the UNPHASED 3.1.5 program (http://sourceforge.net/projects/unphased/files/unphased-3.1.5.zip/download) with the following analysis options: All window sizes, full model and uncertain haplotype (23). The P-values for the global and individual tests of haplotype distribution between cases and controls were determined. Statistical significance was assessed using 1,000-fold permutation testing. P<0.05 was considered to indicate a statistically significant difference.

High order gene-gene interactions among all tested polymorphic loci were investigated using a multifactor dimensionality reduction (MDR) approach with MDR version 2.0 β5 (http://www.epistasis.org/). A detailed explanation on the MDR method has been described previously (24). Based on the obtained testing balanced accuracy and cross-validation consistency values, the best statistical gene-gene interaction models were established. A 1,000-fold permutation test was used to assess the statistical significance of the MDR models (MDR permutation testing module 0.4.9α).

Results

Prevalence of the GC, RXRA and VDR SNPs in women with endometriosis-associated infertility

The distribution of the RXRA, GC and VDR genotypes did not display deviation from the HWE between patients and control groups (P>0.05). The number of genotypes, OR, and 95% CI evaluation for the eight GC, RXRA and VDR SNPs are shown in Table III. No association was reported between the GC, RXRA and VDR SNPs of either the dominant or recessive inheritance models and endometriosis-associated infertility. The statistical significance of the multiple testing determined by correction of SNPs was P=0.00625. The lowest P-values of the trend test were demonstrated for VDR FokI rs2228570 and RXRA rs749759 in women with endometriosis-associated infertility (Ptrend=0.044 and Ptrend=0.076, respectively).

Table III

Association of polymorphic variants of vitamin D-associated genes and risk of endometriosis.

Table III

Association of polymorphic variants of vitamin D-associated genes and risk of endometriosis.

Geners no.AllelesaGenotypes casesbGenotypes controlsbptrend value pgenotypic valuepallelic value ORdominant (95% CI)c; P-value ORrecessive(95%CI)d; P-value
GCrs7041G/T32/73/4949/184/1140.2420.1640.2551.048 (0.698–1.574); 0.8201.595 (0.974–2.611); 0.062
rs 1155563C/T15/69/6925/142/1800.1280.3140.1331.312 (0.896–1.922); 0.1631.400 (0.716–2.738); 0.324
rs2298849C/T5/55/9314/106/2260.4910.4870.4941.215 (0.820–1.800); 0.3310.801 (0.283–2.266); 0.675
RXRArsl0881578A/G10/66/7833/147/1660.3580.5200.3620.899 (0.615–1.314); 0.5810.659 (0.316–1.373); 0.262
rs 10776909C/T2/51/10114/114/2190.3280.2720.3390.898 (0.603–1.336); 0.5950.313 (0.070–1.395); 0.166e
rs749759A/G2/57/9515/141/1910.0760.1320.0940.760 (0.516–1.121); 0.1660.291 (0.066–1.290); 0.109e
VDRrs1544410A (B)/G (b)22/76/5645/154/1470.2630.4370.2621.293 (0.874–1.912); 0.1981.115 (0.644–1.931); 0.698
rs2228570C (F)/T (f)37/88/2965/189/920.0440.1220.0581.561 (0.977–2.496); 0.0611.367 (0.865–2.161); 0.180

a Underline denotes the minor allele in the control samples.

b Order of genotypes: dd/Dd/DD (d is the minor allele in the control samples).

c Dominant model: dd+Dd, vs. DD (d is the minor allele).

d Recessive model: dd vs. Dd+DD (d is the minor allele).

e Fisher exact test. GC, vitamin D binding protein; RXRA, retinoid X receptor A; VDR, vitamin D receptor.

Association of GC, RXRA, and VDR haplotypes with endometriosis-associated infertility

Haplotype analysis of the GC, RXRA and VDR SNPs is presented in Table IV. A significant association was demonstrated to exist between the A-T VDR (rs1544410 and rs2228570) haplotype and endometriosis-associated infertility [OR=1.659 (1.122–2.453), P=0.011]. However, no other associations between VDR haplotypes and endometriosis were demonstrated. Furthermore, there was no association between SNP GC and RXRA and increased risk of endometriosis-associated infertility. The empirical 5% quantile of the best P-value following 1,000 permutations was 0.01487 for GC, 0.01273 for RXRA and 0.02565 for VDR haplotypes.

Table IV

Haplotype analysis of SNPs genotyped in the GC, RXRA and VDR genes.

Table IV

Haplotype analysis of SNPs genotyped in the GC, RXRA and VDR genes.

GeneSNP combinationχ2Global P-valueaHaplotypePatients (frequency)Controls (frequency)OR (95%CI)P-valueb
GCc rs7041_rs11555633.0220.388G-T162 (0.53)396 (0.57)Reference
T-C91 (0.30)179 (0.26)1.243 (0.910-1.697)0.171
T-T45 (0.15)102 (0.15)1.078 (0.726-1.602)0.708
G-C8 (0.02)11 (0.02)1.778 (0.702-4.502)0.219
rs1155563_rs22988494.3050.230T-T154 (0.51)376 (0.55)Reference
C-T86 (0.28)178 (0.26)1.180 (0.858-1.622)0.309
T-C51 (0.17)121 (0.17)1.029 (0.706-1.501)0.882
C-C13 (0.04)13 (0.02)2.442 (1.106-5.388)0.023
rs7041_rs1155563_rs22988495.1820.521G-T-T119 (0.39)295 (0.43)Reference
T-C-T78 (0.26)165 (0.24)1.172 (0.831-1.652)0.365
G-T-C42 (0.14)97 (0.14)1.073 (0.705-1.634)0.741
T-T-T35 (0.11)76 (0.11)1.142 (0.725-1.797)0.567
T-T-C9 (0.03)23 (0.04)0.970 (0.436-2.158)0.941
T-C-C13 (0.04)13 (0.02)2.479 (1.116-5.505)0.022
G-C-T8 (0.03)11 (0.02)1.803 (0.707- 4.595)0.211
RXRAd rs10881578_rs107769091.3480.718A-C202 (0.66)423 (0.62)Reference
G-C51 (0.17)124 (0.18)0.861 (0.597-1.243)0.424
G-T35 (0.11)87 (0.13)0.842 (0.550-1.291)0.431
A-T20 (0.06)52 (0.07)0.805 (0.468-1.385)0.433
rs10776909_rs7497592.8120.422C-G229 (0.74)486 (0.70)Reference
T-A37 (0.12)108 (0.16)0.727 (0.485-1.090)0.122
C-A24 (0.08)60 (0.09)0.849 (0.516-1.398)0.519
T-G18 (0.06)34 (0.05)1.124 (0.621-2.032)0.700
rs10881578_rs10776909_rs7497597.9230.339A-C-G176 (0.57)370 (0.54)Reference
G-C-G52 (0.17)112 (0.16)0.976 (0.671-1.420)0.899
G-T-A17 (0.055)59 (0.09)0.606 (0.343-1.070)0.082
A-C-A24 (0.08)47 (0.07)1.074 (0.636-1.812)0.791
A-T-A20 (0.06)46 (0.07)0.914 (0.525-1.592)0.751
G-T-G17 (0.055)27 (0.04)1.324 (0.703-2.493)0.384
G-C-A0 (0.00)11 (0.02)0.091 (0.005-1.559)0.020f
A-T-G2 (0.01)8 (0.01)0.526 (0.110-2.502)0.514f
VDRe rs1544410_rs22285706.8370.077G-C94 (0.305)227 (0.33)Reference
G-T94 (0.305)217 (0.32)1.046 (0.744-1.471)0.796
A-C52 (0.17)145 (0.21)0.866 (0.582-1.289)0.478
A-T68 (0.22)99 (0.14)1.659 (1.122-2.453)0.011

{ label (or @symbol) needed for fn[@id='tfn9-mmr-12-05-7109'] } The most common haplotype was used as the reference.

a Likelihood ratio statistic.

b χ2 analysis.

c Empirical 5% quantile of the best P-value: 0.01487.

d Empirical 5% quantile of the best p-value: 0.01273.

e Empirical 5% quantile of the best P-value: 0.02565.

f Fisher exact test. OR, odds ratio; GC, vitamin D binding protein; RXRA, retinoid X receptor A; VDR, vitamin D receptor; SNP, single nucleotide polymorphism.

Analysis of gene-gene interactions between the GC, RXRA and VDR polymorphisms

Exhaustive MDR analysis evaluating 2–4 loci combinations of all investigated SNPs for each comparison did not indicate statistical significance in predicting susceptibility to endometriosis-associated infertility (Table V). The best combination of possibly interactive polymorphisms was observed for GC rs7041 and rs2298849, and VDR rs2228570 (testing balanced accuracy, 0.496; cross validation consistency, 70%; permutation test P=0.895).

Table V

Results of gene-gene interactions, as determined by the multifactor dimensionality reduction method.

Table V

Results of gene-gene interactions, as determined by the multifactor dimensionality reduction method.

Genes and rs numbersTesting balanced accuracyCross validation consistencyP-valuea
RXRA_rs749759, VDR_rs22285700.47830%0.977
GC_rs7041, GC_rs2298849, VDR_rs22285700.49670%0.895
RXRA_rs749759, GC_rs7041, GC_rs2298849, VDR_rs22285700.49650%0.895

a Significance of accuracy, empirical P-value based on 1,000 permutations. GC, vitamin D binding protein; RXRA, retinoid X receptor A; VDR, vitamin D receptor.

Discussion

The role of vitamin D in maintaining calcium and phosphorus homeostasis and bone health has been well-established (18,25). However, numerous studies have demonstrated the contribution of vitamin D to several other aspects of health, including human reproduction (26). Vitamin D regulates the expression of numerous genes, including genes associated with steroidogenesis of sex hormones in female reproductive tissues, which also extends to estradiol and progesterone (26,27). Previous studies on humans and animals demonstrated that low vitamin D levels are associated with reduced fertility, poor in vitro fertilization outcome, and polycystic ovary syndrome (27,28). In addition, the predicted plasma 25 (OH) D3 levels have been observed to be inversely associated with endometriosis (27,11).

The role of vitamin D in the development and progression of endometriosis has also been extensively investigated in animal models. Abbas et al (29) reported the regression of endometriotic implants treated with vitamin D3 in a rat model (29). Recently, Yildirim et al (30) demonstrated the regression of endometriosis in rats treated with vitamin D, as well as associated changes in vascular endothelial growth factor, matrix metalloproteinase-9 and tissue inhibitor of metalloproteinase-2 expression levels (29).

Polymorphisms located in genes encoding proteins mediated by vitamin D may be risk factors for endometriosis and infertility. The results of the present study demonstrated that GC, RXRA and VDR SNPs were not separate risk factors for endometriosis-associated infertility. A previous study reported that no association was observed between FokI and BmsI VDR polymorphisms and endometriosis and/or infertility in Brazilian women (31). However, in the present genetic study, the A-T BmsI/FokI VDR haplotype was a significant risk factor for endometriosis-associated infertility.

The function of BsmI and FokI SNPs on the biological effects of VDR have been extensively studied (18,3234). The BsmI polymorphism may change the length of the polyadenylate sequence in VDR transcript (18). Recently, Luo et al (32) demonstrated that the BsmI polymorphism significantly reduced the mRNA expression levels of VDR in carriers of the A (B) allele, as compared with subjects carrying the GG (bb) genotype (32). The FokI SNP gives rise to two protein forms: A long VDR, encoded by the minor allele form (ATG; f), which contains three additional amino acids, and a shorter form, encoded by (ACG; F) (33). The longer form exhibits 1.7x less efficiency than the shorter form (33). Furthermore, high frequency of the VDR (ATG) (f) allele was associated with a decrease in Th1 immune response (17). A previous study on the role of the FokI SNP demonstrated the presence of increased vitamin D levels in carriers of the TT (ff) genotype, as compared with carriers of the CC (FF) genotype (34).

The presence of the VDR in normal endometrium and endometriotic implants has been demonstrated (35). Furthermore, women suffering from endometriosis express higher levels of VDRs in their endometrial tissue (35,36). In addition, VDRs have been detected in female reproductive tissues, including the ovary, uterus and placenta (37). The expression levels of VDR may also have an important role in the development of endometriosis. Mariani et al (38) demonstrated that the VDR agonist elocalcitol exerts protective effects on the implantation and organization of transferred endometriotic implants in murine model of endometriosis.

In conclusion, the present study demonstrated that the A–T (B–f) VDR haplotype may be a risk factor for endometriosis-associated infertility. However, in order to further validate the role of this haplotype in endometriosis-associated infertility, similar studies must be conducted in independent ethnicities and in women with idiopathic infertility.

Acknowledgments

The present study was supported by a grant from the Poznań University of Medical Sciences (grant. no. 502-01-01124182 -07474). The authors of the present study are grateful for the technical assistance of Ms. Sylwia Matuszewska.

References

1 

Mahmood TA and Templeton A: Prevalence and genesis of endometriosis. Hum Reprod. 6:544–549. 1991.PubMed/NCBI

2 

Meuleman C, Vandenabeele B and Fieuws S: High prevalence of endometriosis in infertile women with normal ovulation and normospermic partners. Fertil Steril. 92:68–74. 2009. View Article : Google Scholar

3 

de Ziegler D, Borghese B and Chapron C: Endometriosis and infertility: Pathophysiology and management. Lancet. 376:730–738. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Brosens I and Benagiano G: Endometriosis, a modern syndrome. Indian J Med Res. 133:581–593. 2011.PubMed/NCBI

5 

Montgomery GW, Zondervan KT and Nyholt DR: The future for genetic studies in reproduction. Mol Hum Reprod. 20:1–14. 2014. View Article : Google Scholar

6 

Bischoff FZ and Simpson JL: Heritability and molecular genetic studies of endometriosis. Hum Reprod Update. 6:37–44. 2000. View Article : Google Scholar : PubMed/NCBI

7 

Montgomery GW, Nyholt DR, Zhao ZZ, Treloar SA, Painter JN, Missmer SA, Kennedy SH and Zondervan KT: The search for genes contributing to endometriosis risk. Hum Reprod Update. 14:447–457. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Braun DP, Ding J, Shaheen F, Willey JC, Rana N and Dmowski WP: Quantitative expression of apoptosis-regulating genes in endometrium from women with and without endometriosis. Fertil Steril. 87:263–268. 2007. View Article : Google Scholar

9 

Gebel HM, Braun DP, Tambur A, Frame D, Rana N and Dmowski DP: Spontaneous apoptosis of endometrial tissue is impaired in women with endometriosis. Fertil Steril. 69:1042–1047. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Fujino K, Ueda M, Takehara M, Futakuchi H, Kanda K, Yamashita Y, Terai Y and Ueki M: Transcriptional expression of survivin and its splice variants in endometriosis. Mol Hum Reprod. 12:383–388. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Harris HR, Chavarro JE, Malspeis S, Willett WC and Missmer SA: Dairy-food, calcium, magnesium and vitamin D intake and endometriosis: A prospective cohort study. Am J Epidemiol. 177:420–430. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Basit S: Vitamin D in health and disease: A literature review. Br J Biomed Sci. 70:161–172. 2013.

13 

Li F, Ling X, Huang H, Brattain L, Apontes P, Wu J, Binderup L and Brattain MG: Differential regulation of survivin expression and apoptosis by vitamin D3 compounds in two isogenic MCF-7 breast cancer cell sublines. Oncogene. 24:1385–1395. 2005. View Article : Google Scholar

14 

Daiger SP, Schanfield MS and Cavalli-Sforza LL: Group-specific component (Gc) proteins bind vitamin D and 25 hydroxyvitamin D. Proc Natl Acad Sci USA. 72:2076–2080. 1975. View Article : Google Scholar

15 

Yang L, Ma J, Zhang X, Fan Y and Wang L: Protective role of the vitamin D receptor. Cell Immunol. 279:160–166. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Zhang J, Chalmers MJ, Stayrook KR, Burris LL, Wang Y, Busby SA, Pascal BD, Garcia-Ordonez RD, Bruning JB, Istrate MA, et al: DNA binding alters coactivator interaction surfaces of the intact VDR-RXR complex. Nat Struct Mol Biol. 18:556–563. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Larcombe L, Mookherjee N, Slater J, Slivinski C, Singer M, Whaley C, Denechezhe L, Matyas S, Turner-Brannen E, Nickerson P and Orr P: Vitamin D in a northern Canadian first nation population: Dietary intake, serum concentrations and functional gene polymorphisms. PLoS One. 7:e498722012. View Article : Google Scholar : PubMed/NCBI

18 

Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA and Van Leeuwen JP: Genetics and biology of vitamin D receptor polymorphisms. Gene. 338:143–156. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Lee JJ, Wu X, Hildebrandt MA, Yang H, Khuri FR, Kim E, Gu J, Ye Y, Lotan R, Spitz MR and Hong WK: Global assessment of genetic variation influencing response to retinoid chemo-prevention in head and neck cancer patients. Cancer Prev Res (Phila). 4:185–193. 2011. View Article : Google Scholar

20 

No authors listed. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil Steril. 67:817–821. 1997. View Article : Google Scholar : PubMed/NCBI

21 

Szczepańska M, Wirstlein P, Skrzypczak J and Jagodziński PP: Polymorphic variants of CYP17 and CYP19A and risk of infertility in endometriosis. Acta Obstet Gynecol Scand. 92:1188–1193. 2013.

22 

Aljanabi SM and Martinez I: Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 25:4692–4693. 1997. View Article : Google Scholar

23 

Dudbridge F: Pedigree disequilibrium tests for multilocus haplotypes. Genet Epidemiol. 25:115–121. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Hahn LW, Ritchie MD and Moore JH: Multifactor dimensionality reduction software for detecting gene-gene and gene-environment interactions. Bioinformatics. 19:376–382. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Maruotti N and Cantatore FP: Vitamin D and the immune system. J Rheumatol. 37:491–495. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Parikh G, Varadinova M, Suwandhi P, Araki T, Rosenwaks Z, Poretsky L and Seto-Young D: Vitamin D regulates steroidogenesis and insulin-like growth factor binding protein-1 (IGFBP-1) production in human ovarian cells. Horm Metab Res. 42:754–757. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Grundmann M and von Versen-Höynck F: Vitamin D-roles in women's reproductive health? Reprod Biol Endocrinol. 9:1462011. View Article : Google Scholar

28 

Anagnostis P, Karras S and Goulis DG: Vitamin D in human reproduction: A narrative review. Int J Clin Pract. 67:225–235. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Abbas MA, Taha MO, Disi AM and Shomaf M: Regression of endometrial implants treated with vitamin D3 in a rat model of endometriosis. Eur J Pharmacol. 715:72–75. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Yildirim B, Guler T, Akbulut M, Oztekin O and Sariiz G: 1-alpha,25-dihydroxyvitamin D3 regresses endometriotic implants in rats by inhibiting neovascularization and altering regulation of matrix metalloproteinase. Postgrad Med. 126:104–110. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Vilarino FL, Bianco B, Lerner TG, Teles JS, Mafra FA, Christofolini DM and Barbosa CP: Analysis of vitamin D receptor gene polymorphisms in women with and without endometriosis. Hum Immunol. 72:359–363. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Luo XY, Yang MH, Wu FX, Wu LJ, Chen L, Tang Z, Liu NT, Zeng XF, Guan JL and Yuan GH: Vitamin D receptor gene BsmI polymorphism B allele, but not BB genotype, is associated with systemic lupus erythematosus in a Han Chinese population. Lupus. 21:53–59. 2012. View Article : Google Scholar

33 

Arai H, Miyamoto K, Taketani Y, Yamamoto H, Iemori Y, Morita K, Tonai T, Nishisho T, Mori S and Takeda E: A vitamin D receptor gene polymorphism in the translation initiation codon: Effect on protein activity and relation to bone mineral density in Japan women. J Bone Miner Res. 12:915–921. 1997. View Article : Google Scholar : PubMed/NCBI

34 

Monticielo OA, Brenol JC, Chies JA, Longo MG, Rucatti GG, Scalco R and Xavier RM: The role of BsmI and FokI vitamin D receptor gene polymorphisms and serum 25-hydroxyvitamin D in Brazilian patients with systemic lupus erythematosus. Lupus. 21:43–52. 2012. View Article : Google Scholar

35 

Agic A, Xu H, Altgassen C, Noack F, Wolfler MM, Diedrich K, Friedrich M, Taylor RN and Hornung D: Relative expression of 1,25-dihydroxyvitamin D3 receptor, vitamin D 1 alpha-hydroxylase, vitamin D 24-hydroxylase and vitamin D 25-hydroxylase in endometriosis and gynecologic cancers. Reprod Sci. 14:486–497. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Zelenko Z, Aghajanova L, Irwin JC and Giudice LC: Nuclear receptor, coregulator signaling and chromatin remodeling pathways suggest involvement of the epigenome in the steroid hormone response of endometrium and abnormalities in endometriosis. Reprod Sci. 19:152–162. 2012. View Article : Google Scholar :

37 

Smolikova K, Mlynarcikova A and Scsukova S: Effect of 1α,25-dihydroxyvitamin D3 on progesterone secretion by porcine ovarian granulosa cells. Endocr Regul. 47:123–131. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Mariani M, Viganò P, Gentilini D, Camisa B, Caporizzo E, Di Lucia P, Monno A, Candiani M, Somigliana E and Panina-Bordignon P: The selective vitamin D receptor agonist, elocalcitol, reduces endometriosis development in a mouse model by inhibiting peritoneal inflammation. Hum Reprod. 27:2010–2019. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2015
Volume 12 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Szczepańska M, Mostowska A, Wirstlein P, Skrzypczak J, Misztal M and Jagodziński PP: Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility. Mol Med Rep 12: 7109-7115, 2015
APA
Szczepańska, M., Mostowska, A., Wirstlein, P., Skrzypczak, J., Misztal, M., & Jagodziński, P.P. (2015). Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility. Molecular Medicine Reports, 12, 7109-7115. https://doi.org/10.3892/mmr.2015.4309
MLA
Szczepańska, M., Mostowska, A., Wirstlein, P., Skrzypczak, J., Misztal, M., Jagodziński, P. P."Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility". Molecular Medicine Reports 12.5 (2015): 7109-7115.
Chicago
Szczepańska, M., Mostowska, A., Wirstlein, P., Skrzypczak, J., Misztal, M., Jagodziński, P. P."Polymorphic variants in vitamin D signaling pathway genes and the risk of endometriosis-associated infertility". Molecular Medicine Reports 12, no. 5 (2015): 7109-7115. https://doi.org/10.3892/mmr.2015.4309