International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Obesity is an increasingly prevalent metabolic disorder and has become an epidemic condition in developed countries in recent decades (1). In addition, the prevalence of metabolic syndromes and various chronic diseases, including diabetes, fatty liver, coronary artery disease and hypertension, are increasing due to the rise of obesity (2). Increases in body fat mass result from an increase in the number and size of adipocytes (3,4). Previous studies have demonstrated that the induction of obesity, resulting in alterations in the number of adipocytes (adipogenic differentiations) and adipocyte size (lipid accumulations) can be initiated by dietary factors (3,4). A previous study demonstrated that increases in the number of adipocytes during the aging process may influence the development of obesity observed in older individuals (5). Thus, adipogenesis may be an important factor in the development of obesity.
Adipocytes differentiate from mesenchymal stem cells, which have the capacity for differentiation into myoblasts, chondroblasts, osteoblasts or adipocytes (6). Tissue-specific differentiation is regulated by a variety of differentiation factors in accordance with the cells' conditions. Among the differentiation factors influencing adipogenesis, peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding proteins (C/EBP-α, C/EBP-β and C/EBP-γ) are considered the key factors for the induction of adipogenesis in mesenchymal stem cell-mediated differentiation. These two factors are required for the expression of adipocyte-specific genes such as adiponectin (7).
Sphingosine-1-phosphate (S1P) is part of a key group of signaling sphingolipids recognized to serve diverse roles in a variety of cellular processes, including apoptosis, migration, differentiation and proliferation in a variety of cell types, including endothelial cells, smooth muscle cells, mesenchymal stem cells and macrophages (8–10). S1P has been demonstrated to act as a ligand of G-protein-coupled receptors, namely S1P receptors (11). Five members of the S1P receptor group (S1P1–5) have been identified in mammals, which possess distinct expression profiles and affinities toward S1P (12,13). In particular, S1P2 receptors are widely expressed throughout the body, including in the brain, heart, lung, thymus, kidney, spleen and adipose tissues (14,15). S1P2 receptors are associated with differentiation of various tissue types, including those associated with the central nervous system (CNS), as well as the differentiation of mesenchymal stem cells and osteoblasts (10,16,17). During early stages of CNS development, S1P2 receptors have been identified to be expressed in young animals and differentiate into neuronal cells (16). In addition, S1P2 receptors upregulate myogenic differentiation of myoblast cells and adipose-derived mesenchymal stem cells (10,17,18). However, to date, the effect of S1P-mediated S1P2 receptors on adipogenic differentiation has remained to be fully elucidated.
The present study investigated the hypothesis that S1P inhibits adipocyte differentiation via the regulation of S1P2 receptors. Therefore the effects of up- or downregulation of S1P2 receptors on differentiation of adipocytes were examined. Furthermore, the levels of the adipogenic differentiation markers PPARγ, C/EBP-α and adiponectin were assessed.
S1P was purchased from Cayman Chemical Company (Ann Arbor, MI, USA). S1P was prepared as a 2-mM solution in 0.3 M NaOH and then further diluted in cell culture medium. 3-isobutyl-1-methylxanthine, dexamethasone and insulins were purchased from Sigma-Aldrich (St. Louis, MO, USA). S1P2 antibody and normal goat immunoglobulin G (IgG) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).
Pre-adipocyte cell line 3T3-L1 cells and human embryonic kidney cell line HEK 293 cells were obtained from the American Type Culture collection (Rockville, MD, USA). The 3T3-L1 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum and antibiotics: 100 µg/ml gentamycin (Invitrogen Life Technologies, Carlsbad, CA, USA) and 100 µg/ml penicillin-streptomycin (HyClone, Logan, UT, USA). To induce differentiation, 2 days post-confluent 3T3-L1 cells were incubated in MDI induction media (DMEM containing 10% fetal bovine serum, 0.5 mM 3-isobutyl-1-methylxanthine, 1 µm dexamethasone and 1 µg/ml insulin) for 2 days. In certain experiments, S1P (10 µM) was added at the time of the induction of differentiation. Two days subsequent to the addition of MDI (day 2), the media was replaced with insulin media. The AdipoRed assay and detection of glycerol release contents were performed on day 7.
Mouse S1P2-expressing adenoviruses and empty vector adenoviruses were purchased from Genenmed, Inc. (Seoul, Korea; Gen-E008-001). Recombinant adenoviruses were amplified in human embryonic kidney HEK-293 cells and purified using the Vivapure AdenoPACK kit (Sartorius AG, Göttingen, Germany) according to the manufacturer's instructions (19).
3T3-L1 cells were transfected with validated Stealth™ small interfering (si)RNAs (Invitrogen Life Technologies) directed against S1P2 using Lipofectamine 2000 (Invitrogen Life Technologies) RNA interference transfection protocol. Sequences of the S1P2 siRNAs used were as follows: Sense, 5′-AGAAGAUUCUCCACCACGAUGGCGC-3′ and anti-sense, 5′-GCGCCAUCGUGGUGGAGAAUCUUCU-3′. The Stealth™ RNA interference negative control (medium G/C) were also obtained from Invitrogen Life Technologies.
Lipid content was quantified using the commercially available AdipoRed Assay Reagent (Lonza, Verviers, Belgium) in accordance with the manufacturer's instructions. In brief, pre-adipocytes were grown in 24-well plates and then incubated with MDI media with or without S1P during the adipogenic phase. On day 7, the culture supernatant was removed and the cells were carefully washed with 500 µl phosphate-buffered saline (PBS). The wells were then filled with 300 µl PBS and 30 µl AdipoRed reagent, followed by incubation for 10 min at 37°C. Fluorescence was measured with excitation at 485 nm and emission at 572 nm.
Total RNA was extracted from 3T3-L1 cells treated with S1P using the Easy-spin™ total RNA extraction kit (Intron Biotechnology, Inc., Seongnam, Korea). cDNA synthesis was performed following the instructions of the Takara Prime Script™ 1st Strand cDNA Synthesis kit (Takara Bio, Inc., Otsu, Japan). For RT-qPCR, 1 µl gene primers with iTaq SYBR Green supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a 20-µl reaction volume was used. The sequences of the primers used for RT-qPCR were as follows: S1P2 forward, 5′AACAGCAAGTTCCACTCAGCAATG3′ and reverse, 5′GGCGGAGAGCGTGATGAAGG3′; PPARγ forward, 5′CGGAAGCCCTTTGGTGACTTTATG3′ and reverse, 5′GCAGCAGGTTGTCTTGGATGTC3′; C/EBP-α forward, 5′CGGGAACGCAACAACATCGC3′ and reverse, 5′TGTCCAGTTCACGGCTCAGC3′; adiponectin forward, 5′TGACGGCAGCACTGGCAAG3′ and reverse, 5′TGATACTGGTCGTAGGTGAAGAGAAC3′; and β-actin forward, 5′TGAGAGGGAAATCGTGCGTGAC3′ and reverse, 5′GCTCGTTGCCAATAGTGATGACC3′. All primers were purchased from Bioneer Inc. (Daejeon, Korea).
All reactions with iTaq SYBR Green Supermix were performed on the CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The PCR program was as follows: Denaturation (95°C for 10 min), amplification and quantification for 40 cycles (95°C for 10 sec, 55–60°C for 30 sec, and 72°C for 30 sec with a single fluorescent measurement), melting curve analysis (65–95°C, with a heating rate 0.2°C/sec and continuous fluorescence measurement), and final cooling to 12°C.
The amplification of specific RT-qPCR products was confirmed by performing a melting-curve step at the end of each run. Across all the assays, none of the quantification cycle (Cq) values were higher than 40. No-template and no-reverse transcription controls were run to determine any contamination or the generation of primer dimers. All amplifications were run in triplicate.
The 3T3-L1 cells were lysed in lysis buffer [25 mM 4-(2-hydroxyethyl)-1-piperazineethane-sulfonic acid; pH 7.4, 100 mM NaCl, 1 mM EDTA, 5 mM MgCl2, 0.1 mM dithiothreitol and protease inhibitor mixture]. All reagents for cell lysis were purchased from Sigma-Aldrich. Proteins were electrophoretically resolved by 8–15% SDS-PAGE and immunoblotting was performed as previously described (20). Images were captured using the Fusion FX7 Acquisition system (Vilbert Lourmat GmbH, Eberhardzell, Germany). The immunoreactive bands were detected with an enhanced chemiluminescence detection system (Thermo Fisher Scientific). The antibodies used for immunoblotting were PPARγ (cat. no. sc-7273; Santa Cruz Biotechnology, Inc.), S1P2 (cat. no. sc-31577; Santa Cruz Biotechnology), phosphorylated-c-Jun N-terminal kinase (p-JNK) (cat. no. 9255; Cell Signaling Technology, Inc., Danvers, MA, USA) and β-actin (cat. no. A5441; Sigma-Aldrich). Goat, (cat. no. sc-3887) mouse (cat. no. sc-2025) and rabbit (cat. no. sc-2027) secondary antibodies were purchased from Santa Cruz Biotechnology, Inc.
All values are expressed as the mean ± standard error and were compared using Student's t-test and analysis of variance with Duncan's test. The SAS statistical package version 8.1 (SAS Institute, Inc., Cary, NC, USA) was used for analysis. P<0.05 was considered to indicate a statistically significant difference.
To verify the differentiative role of S1P2 receptors in adipogenesis, 3T3-L1 cells were infected with adenovirus for the expression of either the S1P2 receptor or an adenovirus carrying an empty vector at multiplicity of infection values of 500, 1,000 and 2,000, followed by incubation in MDI. Overexpression of S1P2 receptor proteins reduced the triglyceride accumulation induced by MDI-mediated adipocyte differentiation, whereas empty vector-transfected cells showed similar amounts of lipid accumulation to those in the control group incubated in MDI only (Fig. 1A and B). To confirm the anti-adipogenic function of the S1P2 receptor, S1P2 receptor-overexpressing cells were co-treated with S1P. The results showed that S1P treatment inhibited MDI-mediated adipogenesis and that simultaneous S1P2 receptor overexpression markedly enhanced the inhibition of MDI-mediated adipogenesis of 3T3-L1 adipocytes (Fig. 1C and D). These results provided further evidence for the anti-adipogenic effects of S1P being mediated via the activation of S1P2 receptor signaling.
The present study further investigated whether the anti-adipogenic effects of S1P2 receptors are involved in mediating the mRNA and protein expression levels of adipogenic transcriptional factors (Fig. 2A–C). The expression levels of PPARγ, C/EBP-α and adiponectin mRNA were observed to be increased in MDI-treated adipocytes, and the elevated mRNA expression levels were suppressed by S1P2 receptor overexpression. Western blot analysis confirmed that the S1P2 receptor was overexpressed in the adipocytes treated with the adenoviral S1P2 overexpression vector; furthermore, S1P2 receptor overexpression downregulated the phosphorylation of JNK and expression of PPARγ protein (Fig. 2D). These results indicated that the activation of the S1P2 receptor caused by S1P2 receptor overexpression suppressed mRNA and protein expression levels of adipogenic factors, which exerted anti-adipogenic effects on 3T3-L1 adipocytes.
siRNA was used to eliminate the S1P2 in pre-adipocytes and determine the effects of S1P2 knockdown on the S1P-mediated adipocyte differentiation. 3T3-L1 cells were transfected with either S1P2 siRNA or negative control siRNA, and 3T3-L1 cells at 2 days post-confluence were then incubated in MDI induction media with or without S1P (10 µM) for 2 days. The media was then replaced with insulin media to further induce adipogenesis. Following S1P2 knockdown, S1P completely lost its ability to impair adipogenic differentiation (Fig. 3A and B). S1P2 mRNA and protein expression levels were markedly reduced in cells treated with S1P2 siRNA, relative to those in cells treated with control siRNA (Fig. 3C and D). Of note, S1P2 protein expression was upregulated following treatment with S1P, indicating that S1P may inhibit adipogenic differentiation via upregulation of S1P2 (Fig. 3D).
The present study further investigated whether the downregulation of the expression of major adipogenic transcriptional factors by S1P was a S1P2 receptor-mediated process. Silencing of the S1P2 receptor resulted in restoration of the mRNA expression levels of PPARγ, C/EBP-α to levels similar to those in the control group incubated with MDI only, and an increased adiponectin expression compared to that in the MDI-non-treated group (Fig. 4A–C). The results indicated that S1P inhibits adipogenic differentiation by downregulation of the major adipogenic transcriptional factors, which were involved in S1P2 receptor-mediated signaling. Silencing of the S1P2 receptor additionally blocked the downregulation of PPARγ protein and phospho-JNK protein induced by S1P treatment (Fig. 4D). These results demonstrated that silencing of the S1P2 receptor using S1P2 siRNA abolishes the inhibitory effect of S1P on adipogenesis, indicating that the S1P2 receptor may serve a pivotal role in the regulation of adipogenic differentiation.
Adipocytes are generated by differentiation of mesenchymal stem cells (6). Mesenchymal stem cells possess the ability to differentiate into numerous cell types, including adipocytes, osteoblasts, chondrocytes and smooth muscle cells. Previous studies have suggested that myogenesis, adipo-genesis and fibrogenesis are competitive processes in the differentiation of mesenchymal stem cells (6,10). In addition, Nincheri et al (10) demonstrated that adipose tissue-derived mesenchymal stem cells differentiated into smooth muscle cells via the upregulation of S1P2 receptors. Thus, it was hypothesized that upregulation of S1P2 receptors may inhibit the differentiation of progenitor adipocytes into adipocytes. The results of previous studies are in agreement with those of the present study, indicating that overexpression of S1P2 receptors inhibits the differentiation of 3T3-L1 pre-adipocytes into adipocytes.
The recruitment of fat cells in adipose tissue requires the differentiation of pre-adipocytes into adipocytes (adipogenesis), a process tightly controlled by the transcription factors PPARγ and C/EBP-α (21,22). In particular, PPARγ is regarded as the key regulator of adipogenesis. Forced expression of PPARγ is sufficient to induce adipocyte differentiation in fibroblasts, and no factor is known that promotes adipogenesis in the absence of PPARγ (21–23). In the present study, overexpression of S1P2 had inhibitory effects on PPARγ and C/EBP-α expression in 3T3-L1 adipocytes. In addition, S1P2 knockdown abrogated the downregulation of PPARγ and C/EBP-α. These observations suggested that S1P2 activation may have anti-adipogenic effects in adipogenic differentiation.
Studies have been conducted on the effects of S1P on cell differentiation. S1P has been reported to act as a regulator of osteoclast differentiation (24) in addition to myogenic differentiation (18,25). It is widely accepted that S1P and the S1P2 receptor are associated with myogenic differentiation of mesenchymal stem cells through G(i)-coupled S1P receptor interactions. In addition, S1P interferes with the differentiation of human monocytes into competent dendritic cells (26). Numerous signaling pathways that are activated in response to stimulation of cells by S1P are initiated by activation of S1P-specific receptors (10,27,28). However, it had yet to be clarified whether direct treatment with S1P is able to influence adipogenic differentiation (10,17,18). Therefore, the direct effect of S1P was examined in the present study, and the results demonstrated that S1P exerted anti-adipogenic effects via upregulation of S1P2 protein levels.
The extracellular signal-regulated kinase, p38 and JNK pathways are intracellular mitogen-activated protein kinase (MAPK) signaling pathways that serve pivotal roles in numerous essential cellular processes, including proliferation and differentiation (3,18,29). MAPKs are activated by a large variety of stimuli and one of their major functions is to connect cell surface receptors to transcription factors in the nucleus, which consequently triggers long-term cellular responses (29). Overexpression of S1P2 was observed to inhibit MDI-induced phosphorylation of JNK in the present study. When induced to differentiate, growth-arrested 3T3-L1 pre-adipocytes synchronously re-enter the cell cycle and undergo mitotic clonal expansion (MCE). MCE is a pre-requisite for differentiation of 3T3-L1 pre-adipocytes into adipocytes (30).
In conclusion, the results of the present study suggested that the anti-adipogenic activity of S1P is mediated via S1P2. The present study identified for the first time, to the best of our knowledge, that the inhibitory effect of S1P on adipogenic differentiation proceeded via the upregulation of S1P2 and additionally suggested that S1P2 activation may be a therapeutic target for obesity. Therefore, the development of S1P2 receptor sub-type-specific ligands may be beneficial for potential medical interventions.
The present study was supported by a grant from the National Research Foundation of Korea, funded by the Korean government (grant no. 2013R1A1A2063931).
|
Lei F, Zhang XN, Wang W, Xing DM, Xie WD, Su H and Du LJ: Evidence of anti-obesity effects of the pomegranate leaf extract in high-fat diet induced obese mice. Int J Obes (Lond). 31:1023–1029. 2007. View Article : Google Scholar | |
|
Boyle KB, Hadaschik D, Virtue S, Cawthorn WP, Ridley SH, O'Rahilly S and Siddle K: The transcription factors Egr1 and Egr2 have opposing influences on adipocyte differentiation. Cell Death Differ. 16:782–789. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Kim KJ, Lee OH and Lee BY: Fucoidan, a sulfated polysac-charide, inhibits adipogenesis through the mitogen-activated protein kinase pathway in 3T3-L1 preadipocytes. Life Sci. 86:791–797. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Gregoire FM, Smas CM and Sul HS: Understanding adipocyte differentiation. Physiol Rev. 78:783–809. 1998.PubMed/NCBI | |
|
Yanagiya T, Tanabe A and Hotta K: Gap-junctional communication is required for mitotic clonal expansion during adipogenesis. Obesity (Silver Spring). 15:572–582. 2007. View Article : Google Scholar | |
|
Rayalam S, Della-Fera MA and Baile CA: Phytochemicals and regulation of the adipocyte life cycle. J Nutr Biochem. 19:717–726. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Xing Y, Yan F, Liu Y and Zhao Y: Matrine inhibits 3T3-L1 preadipocyte differentiation associated with suppression of ERK1/2 phosphorylation. Biochem Biophys Res Commun. 396:691–695. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Johnstone ED, Chan G, Sibley CP, Davidge ST, Lowen B and Guilbert LJ: Sphingosine-1-phosphate inhibition of placental trophoblast differentiation through a G(i)-coupled receptor response. J Lipid Res. 46:1833–1839. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Goetzl EJ, Wang W, McGiffert C, Liao JJ and Huang MC: Sphingosine 1-phosphate as an intracellular messenger and extracellular mediator in immunity. Acta Paediatr Suppl. 96:49–52. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Nincheri P, Luciani P, Squecco R, Donati C, Bernacchioni C, Borgognoni L, Luciani G, Benvenuti S, Francini F and Bruni P: Sphingosine 1-phosphate induces differentiation of adipose tissue-derived mesenchymal stem cells towards smooth muscle cells. Cell Mol Life Sci. 66:1741–1754. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Schüppel M, Kurschner U, Kleuser U, Schäfer-Korting M and Kleuser B: Sphingosine 1-phosphate restrains insulin-mediated keratinocyte proliferation via inhibition of Akt through the S1P2 receptor subtype. J Invest Dermatol. 128:1747–1756. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Bieberich E: There is More to a lipid than just being a fat: Sphingolipid-guided differentiation of oligodendroglial lineage from embryonic stem cells. Neurochem. 36:1601–1611. 2011. View Article : Google Scholar | |
|
Pyne S and Pyne NJ: Sphingosine 1-phosphate signalling in mammalian cells. Biochem J. 349:385–402. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang G, Contos JJ, Weiner JA, Fukushima N and Chun J: Comparative analysis of three murine G-protein coupled receptors activated by sphingosine-1-phosphate. Gene. 227:89–99. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Ishii I, Friedman B, Ye X, Kawamura S, McGiffert C, Contos JJ, Kingsbury MA, Zhang G, Brown JH and Chun J: Selective loss of sphingosine 1-phosphate signaling with no obvious phenotypic abnormality in mice lacking its G protein-coupled receptor, LP(B3)/EDG-3. J Biol Chem. 276:33697–33704. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Maclennan AJ, Marks L, Gaskin AA and Lee N: Embryonic expression pattern of H218, a G-protein coupled receptor homolog, suggests roles in early mammalian nervous system development. Neuroscience. 79:217–224. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Roelofsen T, Akkers R, Beumer W, Apotheker M, Steeghs I, van de Ven J, Gelderblom C, Garritsen A and Dechering K: Sphingosine-1-phosphate acts as a developmental stage specific inhibitor of platelet-derived growth factor-induced chemotaxis of osteoblasts. J Cell Biochem. 105:1128–1138. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Donati C, Meacci E, Nuti F, Becciolini L, Farnararo M and Bruni P: Sphingosine 1-phosphate regulates myogenic differentiation: A major role for S1P2 receptor. FASEB J. 19:449–451. 2005. | |
|
Seo JS, Moon MH, Jeong JK, Seol JW, Lee YJ, Park BH and Park SY: SIRT1, a histone deacetylase, regulates prion protein-induced neuronal cell death. Neurobiol Aging. 33:1110–1120. 2012. View Article : Google Scholar | |
|
Moon MH, Jeong JK, Seo JS, Seol JW, Lee YJ, Xue M, Jackson CJ and Park SY: Bisphosphonate enhances TRAIL sensitivity to human osteosarcoma cells via death receptor 5 upregulation. Exp Mol Med. 43:138–145. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Simon MF, Daviaud D, Pradère JP, Grès S, Guigné C, Wabitsch M, Chun J, Valet P and Saulnier-Blache JS: Lysophosphatidic acid inhibits adipocyte differentiation via lysophosphatidic acid 1 receptor-dependent downregulation of peroxisome proliferator-activated receptor gamma2. J Biol Chem. 280:14656–14662. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Fu L, Tang T, Miao Y, Zhang S, Qu Z and Dai K: Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone. 43:40–47. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Rosen ED and MacDougald OA: Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol. 7:885–896. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Ryu J, Kim HJ, Chang EJ, Huang H, Banno Y and Kim HH: Sphingosine 1-phosphate as a regulator of osteoclast differentiation and osteoclastosteoblast coupling. EMBO J. 25:5840–5851. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Meacci E, Cencetti F, Donati C, Nuti F, Farnararo M, Kohno T, Igarashi Y and Bruni P: Down-regulation of EDG5/S1P2 during myogenic differentiation results in the specific uncoupling of sphingosine 1-phosphate signalling to phospholipase D. Biochim Biophys Acta. 1633:133–142. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Martino A, Volpe E, Auricchio G, Izzi V, Poccia F, Mariani F, Colizzi V and Baldini PM: Sphingosine 1-phosphate interferes on the differentiation of human monocytes into competent dendritic cells. Scand J Immunol. 65:84–91. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Jiang L, Liu T, Song K, Guan S, Li X and Ge D: Stimulation of sphingosine-1-phosphate on cardiomyogenic differentiation of mesenchymal stem cells. Sheng Wu Gong Cheng Xue Bao. 29:1617–1628. 2013.In Chinese. | |
|
Zhao Z, Chen Z, Zhao X, et al: Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions. J Biomed Sci. 18:372011. View Article : Google Scholar : PubMed/NCBI | |
|
Bost F, Aouadi M, Caron L and Binétruy B: The role of MAPKs in adipocyte differentiation and obesity. Biochimie. 87:51–56. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Tang QQ, Otto TC and Lane MD: Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc Natl Acad Sci USA. 100:44–49. 2003. View Article : Google Scholar : |