Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2015 Volume 12 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2015 Volume 12 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes

  • Authors:
    • Jae‑Kyo Jeong
    • Myung‑Hee Moon
    • Sang‑Youel Park
  • View Affiliations / Copyright

    Affiliations: Biosafety Research Institute, College of Veterinary Medicine, Chonbuk National University, Jeonju, Jeonbuk 561‑756, Republic of Korea
  • Pages: 7496-7502
    |
    Published online on: September 29, 2015
       https://doi.org/10.3892/mmr.2015.4388
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Sphingosine 1-phosphate (S1P) is a bioactive lipid mediator that regulates multiple signals through S1P receptors responsible for biological responses. In particular, the S1P2 receptor has distinct roles in the S1P‑mediated differentiation of certain cell types. The present study was the first, to the best of our knowledge, to report the role of the S1P2 receptor in the adipocyte differentiation of 3T3‑L1 pre‑adipocytes. In order to investigate the influence of S1P2 receptors in the anti‑adipogenic effects of S1P, S1P2 receptor silencing and overexpression of were used. S1P2 overexpression with adenoviral vectors inhibited adipogenesis and inhibited the expression of peroxisome proliferator‑activated receptor γ (PPARγ), adiponectin and CCAAT/enhancer binding protein‑α, which were upregulated following incubation in differentiation media. Furthermore, S1P completely lost its ability to impair adipogenic differentiation following silencing of S1P2. Silencing of the S1P2 receptor additionally blocked the downregulation of PPARγ protein and phospho‑c‑Jun N‑terminal kinase protein induced by S1P treatment. In conclusion, the present study demonstrated that the S1P2 receptor is a key signaling molecule in the S1P‑dependent inhibition of adipogenic differentiation and additionally suggested that selective targeting of S1P2 receptors may have clinical applications for the treatment of obesity.

Introduction

Obesity is an increasingly prevalent metabolic disorder and has become an epidemic condition in developed countries in recent decades (1). In addition, the prevalence of metabolic syndromes and various chronic diseases, including diabetes, fatty liver, coronary artery disease and hypertension, are increasing due to the rise of obesity (2). Increases in body fat mass result from an increase in the number and size of adipocytes (3,4). Previous studies have demonstrated that the induction of obesity, resulting in alterations in the number of adipocytes (adipogenic differentiations) and adipocyte size (lipid accumulations) can be initiated by dietary factors (3,4). A previous study demonstrated that increases in the number of adipocytes during the aging process may influence the development of obesity observed in older individuals (5). Thus, adipogenesis may be an important factor in the development of obesity.

Adipocytes differentiate from mesenchymal stem cells, which have the capacity for differentiation into myoblasts, chondroblasts, osteoblasts or adipocytes (6). Tissue-specific differentiation is regulated by a variety of differentiation factors in accordance with the cells' conditions. Among the differentiation factors influencing adipogenesis, peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding proteins (C/EBP-α, C/EBP-β and C/EBP-γ) are considered the key factors for the induction of adipogenesis in mesenchymal stem cell-mediated differentiation. These two factors are required for the expression of adipocyte-specific genes such as adiponectin (7).

Sphingosine-1-phosphate (S1P) is part of a key group of signaling sphingolipids recognized to serve diverse roles in a variety of cellular processes, including apoptosis, migration, differentiation and proliferation in a variety of cell types, including endothelial cells, smooth muscle cells, mesenchymal stem cells and macrophages (8–10). S1P has been demonstrated to act as a ligand of G-protein-coupled receptors, namely S1P receptors (11). Five members of the S1P receptor group (S1P1–5) have been identified in mammals, which possess distinct expression profiles and affinities toward S1P (12,13). In particular, S1P2 receptors are widely expressed throughout the body, including in the brain, heart, lung, thymus, kidney, spleen and adipose tissues (14,15). S1P2 receptors are associated with differentiation of various tissue types, including those associated with the central nervous system (CNS), as well as the differentiation of mesenchymal stem cells and osteoblasts (10,16,17). During early stages of CNS development, S1P2 receptors have been identified to be expressed in young animals and differentiate into neuronal cells (16). In addition, S1P2 receptors upregulate myogenic differentiation of myoblast cells and adipose-derived mesenchymal stem cells (10,17,18). However, to date, the effect of S1P-mediated S1P2 receptors on adipogenic differentiation has remained to be fully elucidated.

The present study investigated the hypothesis that S1P inhibits adipocyte differentiation via the regulation of S1P2 receptors. Therefore the effects of up- or downregulation of S1P2 receptors on differentiation of adipocytes were examined. Furthermore, the levels of the adipogenic differentiation markers PPARγ, C/EBP-α and adiponectin were assessed.

Materials and methods

Reagents

S1P was purchased from Cayman Chemical Company (Ann Arbor, MI, USA). S1P was prepared as a 2-mM solution in 0.3 M NaOH and then further diluted in cell culture medium. 3-isobutyl-1-methylxanthine, dexamethasone and insulins were purchased from Sigma-Aldrich (St. Louis, MO, USA). S1P2 antibody and normal goat immunoglobulin G (IgG) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Cell culture and differentiation

Pre-adipocyte cell line 3T3-L1 cells and human embryonic kidney cell line HEK 293 cells were obtained from the American Type Culture collection (Rockville, MD, USA). The 3T3-L1 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum and antibiotics: 100 µg/ml gentamycin (Invitrogen Life Technologies, Carlsbad, CA, USA) and 100 µg/ml penicillin-streptomycin (HyClone, Logan, UT, USA). To induce differentiation, 2 days post-confluent 3T3-L1 cells were incubated in MDI induction media (DMEM containing 10% fetal bovine serum, 0.5 mM 3-isobutyl-1-methylxanthine, 1 µm dexamethasone and 1 µg/ml insulin) for 2 days. In certain experiments, S1P (10 µM) was added at the time of the induction of differentiation. Two days subsequent to the addition of MDI (day 2), the media was replaced with insulin media. The AdipoRed assay and detection of glycerol release contents were performed on day 7.

Construction of recombinant adenoviruses

Mouse S1P2-expressing adenoviruses and empty vector adenoviruses were purchased from Genenmed, Inc. (Seoul, Korea; Gen-E008-001). Recombinant adenoviruses were amplified in human embryonic kidney HEK-293 cells and purified using the Vivapure AdenoPACK kit (Sartorius AG, Göttingen, Germany) according to the manufacturer's instructions (19).

S1P2 RNA interference

3T3-L1 cells were transfected with validated Stealth™ small interfering (si)RNAs (Invitrogen Life Technologies) directed against S1P2 using Lipofectamine 2000 (Invitrogen Life Technologies) RNA interference transfection protocol. Sequences of the S1P2 siRNAs used were as follows: Sense, 5′-AGAAGAUUCUCCACCACGAUGGCGC-3′ and anti-sense, 5′-GCGCCAUCGUGGUGGAGAAUCUUCU-3′. The Stealth™ RNA interference negative control (medium G/C) were also obtained from Invitrogen Life Technologies.

Quantification of lipid content

Lipid content was quantified using the commercially available AdipoRed Assay Reagent (Lonza, Verviers, Belgium) in accordance with the manufacturer's instructions. In brief, pre-adipocytes were grown in 24-well plates and then incubated with MDI media with or without S1P during the adipogenic phase. On day 7, the culture supernatant was removed and the cells were carefully washed with 500 µl phosphate-buffered saline (PBS). The wells were then filled with 300 µl PBS and 30 µl AdipoRed reagent, followed by incubation for 10 min at 37°C. Fluorescence was measured with excitation at 485 nm and emission at 572 nm.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from 3T3-L1 cells treated with S1P using the Easy-spin™ total RNA extraction kit (Intron Biotechnology, Inc., Seongnam, Korea). cDNA synthesis was performed following the instructions of the Takara Prime Script™ 1st Strand cDNA Synthesis kit (Takara Bio, Inc., Otsu, Japan). For RT-qPCR, 1 µl gene primers with iTaq SYBR Green supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a 20-µl reaction volume was used. The sequences of the primers used for RT-qPCR were as follows: S1P2 forward, 5′AACAGCAAGTTCCACTCAGCAATG3′ and reverse, 5′GGCGGAGAGCGTGATGAAGG3′; PPARγ forward, 5′CGGAAGCCCTTTGGTGACTTTATG3′ and reverse, 5′GCAGCAGGTTGTCTTGGATGTC3′; C/EBP-α forward, 5′CGGGAACGCAACAACATCGC3′ and reverse, 5′TGTCCAGTTCACGGCTCAGC3′; adiponectin forward, 5′TGACGGCAGCACTGGCAAG3′ and reverse, 5′TGATACTGGTCGTAGGTGAAGAGAAC3′; and β-actin forward, 5′TGAGAGGGAAATCGTGCGTGAC3′ and reverse, 5′GCTCGTTGCCAATAGTGATGACC3′. All primers were purchased from Bioneer Inc. (Daejeon, Korea).

All reactions with iTaq SYBR Green Supermix were performed on the CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The PCR program was as follows: Denaturation (95°C for 10 min), amplification and quantification for 40 cycles (95°C for 10 sec, 55–60°C for 30 sec, and 72°C for 30 sec with a single fluorescent measurement), melting curve analysis (65–95°C, with a heating rate 0.2°C/sec and continuous fluorescence measurement), and final cooling to 12°C.

The amplification of specific RT-qPCR products was confirmed by performing a melting-curve step at the end of each run. Across all the assays, none of the quantification cycle (Cq) values were higher than 40. No-template and no-reverse transcription controls were run to determine any contamination or the generation of primer dimers. All amplifications were run in triplicate.

Western blot analysis

The 3T3-L1 cells were lysed in lysis buffer [25 mM 4-(2-hydroxyethyl)-1-piperazineethane-sulfonic acid; pH 7.4, 100 mM NaCl, 1 mM EDTA, 5 mM MgCl2, 0.1 mM dithiothreitol and protease inhibitor mixture]. All reagents for cell lysis were purchased from Sigma-Aldrich. Proteins were electrophoretically resolved by 8–15% SDS-PAGE and immunoblotting was performed as previously described (20). Images were captured using the Fusion FX7 Acquisition system (Vilbert Lourmat GmbH, Eberhardzell, Germany). The immunoreactive bands were detected with an enhanced chemiluminescence detection system (Thermo Fisher Scientific). The antibodies used for immunoblotting were PPARγ (cat. no. sc-7273; Santa Cruz Biotechnology, Inc.), S1P2 (cat. no. sc-31577; Santa Cruz Biotechnology), phosphorylated-c-Jun N-terminal kinase (p-JNK) (cat. no. 9255; Cell Signaling Technology, Inc., Danvers, MA, USA) and β-actin (cat. no. A5441; Sigma-Aldrich). Goat, (cat. no. sc-3887) mouse (cat. no. sc-2025) and rabbit (cat. no. sc-2027) secondary antibodies were purchased from Santa Cruz Biotechnology, Inc.

Statistical evaluation

All values are expressed as the mean ± standard error and were compared using Student's t-test and analysis of variance with Duncan's test. The SAS statistical package version 8.1 (SAS Institute, Inc., Cary, NC, USA) was used for analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

S1P2 receptor overexpression suppresses adipogenesis and enhances the anti-adipogenic effects of S1P

To verify the differentiative role of S1P2 receptors in adipogenesis, 3T3-L1 cells were infected with adenovirus for the expression of either the S1P2 receptor or an adenovirus carrying an empty vector at multiplicity of infection values of 500, 1,000 and 2,000, followed by incubation in MDI. Overexpression of S1P2 receptor proteins reduced the triglyceride accumulation induced by MDI-mediated adipocyte differentiation, whereas empty vector-transfected cells showed similar amounts of lipid accumulation to those in the control group incubated in MDI only (Fig. 1A and B). To confirm the anti-adipogenic function of the S1P2 receptor, S1P2 receptor-overexpressing cells were co-treated with S1P. The results showed that S1P treatment inhibited MDI-mediated adipogenesis and that simultaneous S1P2 receptor overexpression markedly enhanced the inhibition of MDI-mediated adipogenesis of 3T3-L1 adipocytes (Fig. 1C and D). These results provided further evidence for the anti-adipogenic effects of S1P being mediated via the activation of S1P2 receptor signaling.

Figure 1

Overexpression of the S1P2 receptor suppresses adipogenesis and enhances anti-adipogenic effects resulting from S1P treatment. (A) 3T3-L1 cells infected with adenoviruses expressing empty vector (Ad-Con; MOI, 2,000) or mouse S1P2 receptor (Ad-S1P2) for 48 h were induced to differentiate for 6 days. AdipoRed assays were performed. Adipocytes are indicated by red staining (magnification, x200). (B) Quantified fluorescence intensities. (C) 3T3-L1 cells infected with adenoviruses expressing empty vector (Ad-Con; MOI, 2,000) or mouse S1P2 (Ad-S1P2) for 48 h were treated with S1P (0.1 µM) and induced to differentiate for 6 days. AdipoRed assays were performed as described (magnification, x200). (D) Quantified fluorescence intensities. Values are expressed as the mean ± standard error (n=3). #P<0.05, ##P<0.01 vs. MDI control. The experiments were performed in triplicate and data represent three independent experiments. S1P2, sphingosine 1-phosphate 2; Ad, adenovirus; Con, control; MOI, multiplicity of infection; MDI, media.

S1P2 receptor overexpression suppresses mRNA expression of adipogenic factors

The present study further investigated whether the anti-adipogenic effects of S1P2 receptors are involved in mediating the mRNA and protein expression levels of adipogenic transcriptional factors (Fig. 2A–C). The expression levels of PPARγ, C/EBP-α and adiponectin mRNA were observed to be increased in MDI-treated adipocytes, and the elevated mRNA expression levels were suppressed by S1P2 receptor overexpression. Western blot analysis confirmed that the S1P2 receptor was overexpressed in the adipocytes treated with the adenoviral S1P2 overexpression vector; furthermore, S1P2 receptor overexpression downregulated the phosphorylation of JNK and expression of PPARγ protein (Fig. 2D). These results indicated that the activation of the S1P2 receptor caused by S1P2 receptor overexpression suppressed mRNA and protein expression levels of adipogenic factors, which exerted anti-adipogenic effects on 3T3-L1 adipocytes.

Figure 2

Overexpression of the S1P2 receptor suppresses adipogenic factors. (A–C) 3T3-L1 cells infected with adenoviruses expressing empty vector (Ad-Con; multiplicity of infection, 2,000), or mouse S1P2 (Ad-S1P2) for 48 h were induced to differentiate for 2 days and harvested at day 2 during the differentiation period. The mRNA expression of (A) PPARγ, (B) C/EBP-α and (C) adiponectin was analyzed by reverse transcription-quantitative polymerase chain reaction. Values are expressed as the mean ± standard deviation of data from three separate experiments; each experiment was performed in triplicate. (D) Pre-adipocytes were treated as described. At day 2, the protein levels of S1P2, PPARγ and p-JNK were analyzed by western blot analysis. The experiments were repeatedly performed to confirm the results. The data were analyzed using Student's t-test. #P<0.05, ##P<0.01 vs. MDI control. S1P2, sphingosine 1-phosphate 2; Ad, adenovirus; Con, control; PPARγ, peroxisome proliferator-activated receptor γ; p-JNK, phosphorylated c-Jun N-terminal kinase; MDI, media.

Silencing of the S1P2 receptor abolishes the inhibition of lipid accumulation by S1P

siRNA was used to eliminate the S1P2 in pre-adipocytes and determine the effects of S1P2 knockdown on the S1P-mediated adipocyte differentiation. 3T3-L1 cells were transfected with either S1P2 siRNA or negative control siRNA, and 3T3-L1 cells at 2 days post-confluence were then incubated in MDI induction media with or without S1P (10 µM) for 2 days. The media was then replaced with insulin media to further induce adipogenesis. Following S1P2 knockdown, S1P completely lost its ability to impair adipogenic differentiation (Fig. 3A and B). S1P2 mRNA and protein expression levels were markedly reduced in cells treated with S1P2 siRNA, relative to those in cells treated with control siRNA (Fig. 3C and D). Of note, S1P2 protein expression was upregulated following treatment with S1P, indicating that S1P may inhibit adipogenic differentiation via upregulation of S1P2 (Fig. 3D).

Figure 3

Knockdown of the S1P2 receptor inhibited adipogenesis and lipid accumulation by S1P. (A) 3T3-L1 cells were transfected with either S1P2 siRNA or negative control siRNA for 24 h, then cells were induced to differentiate for 6 days and AdipoRed assays were performed. (B) Quantified fluorescence intensities. (C and D) 3T3-L1 cells were transfected with either S1P2 siRNA or negative control siRNA for 24 h, and then cells were induced to differentiate for 2 days. S1P2 expression levels were evaluated by real-time reverse transcription-quantitative polymerase chain reaction and western blotting. #P<0.05, ##P<0.01; vs. MDI control. Values are expressed as the mean ± standard error (n=3). The experiments were performed in triplicate and data represent three independent experiments. S1P2, sphingosine 1-phosphate 2; siRNA, small interfering RNA; MDI, media; Scr, scrambled.

Silencing of the S1P2 receptor abolishes the S1P-induced downregulation of PPARγ, C/EBP-α and adiponectin expression

The present study further investigated whether the downregulation of the expression of major adipogenic transcriptional factors by S1P was a S1P2 receptor-mediated process. Silencing of the S1P2 receptor resulted in restoration of the mRNA expression levels of PPARγ, C/EBP-α to levels similar to those in the control group incubated with MDI only, and an increased adiponectin expression compared to that in the MDI-non-treated group (Fig. 4A–C). The results indicated that S1P inhibits adipogenic differentiation by downregulation of the major adipogenic transcriptional factors, which were involved in S1P2 receptor-mediated signaling. Silencing of the S1P2 receptor additionally blocked the downregulation of PPARγ protein and phospho-JNK protein induced by S1P treatment (Fig. 4D). These results demonstrated that silencing of the S1P2 receptor using S1P2 siRNA abolishes the inhibitory effect of S1P on adipogenesis, indicating that the S1P2 receptor may serve a pivotal role in the regulation of adipogenic differentiation.

Figure 4

Silencing of the S1P2 receptor abolishes the downregulation of PPARγ, C/EBP-α and adiponectin expression induced by S1P. (A–C) 3T3-L1 cells were transfected with either S1P2 siRNA or negative control siRNA for 24 h; then the transfected pre-adipocytes were induced to differentiate with S1P (10 µM) and harvested at day 2 during the differentiation period. The mRNA expression of (A) PPARγ, (B) C/EBP-α and (C) adiponectin was analyzed by reverse transcription-quantitative polymerase chain reaction. Values are expressed as the mean ± standard deviation of data from three separate experiments; each experiment was performed in triplicate. (D) Pre-adipocytes were treated as described. At day 2, the protein levels of PPARγ and p-JNK were analyzed by western blotting. The experiments were repeatedly performed to confirm the results. #P<0.05, ##P<0.01 vs. MDI control. S1P2, sphingosine 1-phosphate 2; PPAR, peroxisome proliferator-activated receptor γ; p-JNK, phosphorylated c-Jun N-terminal kinase; MDI, media.

Discussion

Adipocytes are generated by differentiation of mesenchymal stem cells (6). Mesenchymal stem cells possess the ability to differentiate into numerous cell types, including adipocytes, osteoblasts, chondrocytes and smooth muscle cells. Previous studies have suggested that myogenesis, adipo-genesis and fibrogenesis are competitive processes in the differentiation of mesenchymal stem cells (6,10). In addition, Nincheri et al (10) demonstrated that adipose tissue-derived mesenchymal stem cells differentiated into smooth muscle cells via the upregulation of S1P2 receptors. Thus, it was hypothesized that upregulation of S1P2 receptors may inhibit the differentiation of progenitor adipocytes into adipocytes. The results of previous studies are in agreement with those of the present study, indicating that overexpression of S1P2 receptors inhibits the differentiation of 3T3-L1 pre-adipocytes into adipocytes.

The recruitment of fat cells in adipose tissue requires the differentiation of pre-adipocytes into adipocytes (adipogenesis), a process tightly controlled by the transcription factors PPARγ and C/EBP-α (21,22). In particular, PPARγ is regarded as the key regulator of adipogenesis. Forced expression of PPARγ is sufficient to induce adipocyte differentiation in fibroblasts, and no factor is known that promotes adipogenesis in the absence of PPARγ (21–23). In the present study, overexpression of S1P2 had inhibitory effects on PPARγ and C/EBP-α expression in 3T3-L1 adipocytes. In addition, S1P2 knockdown abrogated the downregulation of PPARγ and C/EBP-α. These observations suggested that S1P2 activation may have anti-adipogenic effects in adipogenic differentiation.

Studies have been conducted on the effects of S1P on cell differentiation. S1P has been reported to act as a regulator of osteoclast differentiation (24) in addition to myogenic differentiation (18,25). It is widely accepted that S1P and the S1P2 receptor are associated with myogenic differentiation of mesenchymal stem cells through G(i)-coupled S1P receptor interactions. In addition, S1P interferes with the differentiation of human monocytes into competent dendritic cells (26). Numerous signaling pathways that are activated in response to stimulation of cells by S1P are initiated by activation of S1P-specific receptors (10,27,28). However, it had yet to be clarified whether direct treatment with S1P is able to influence adipogenic differentiation (10,17,18). Therefore, the direct effect of S1P was examined in the present study, and the results demonstrated that S1P exerted anti-adipogenic effects via upregulation of S1P2 protein levels.

The extracellular signal-regulated kinase, p38 and JNK pathways are intracellular mitogen-activated protein kinase (MAPK) signaling pathways that serve pivotal roles in numerous essential cellular processes, including proliferation and differentiation (3,18,29). MAPKs are activated by a large variety of stimuli and one of their major functions is to connect cell surface receptors to transcription factors in the nucleus, which consequently triggers long-term cellular responses (29). Overexpression of S1P2 was observed to inhibit MDI-induced phosphorylation of JNK in the present study. When induced to differentiate, growth-arrested 3T3-L1 pre-adipocytes synchronously re-enter the cell cycle and undergo mitotic clonal expansion (MCE). MCE is a pre-requisite for differentiation of 3T3-L1 pre-adipocytes into adipocytes (30).

In conclusion, the results of the present study suggested that the anti-adipogenic activity of S1P is mediated via S1P2. The present study identified for the first time, to the best of our knowledge, that the inhibitory effect of S1P on adipogenic differentiation proceeded via the upregulation of S1P2 and additionally suggested that S1P2 activation may be a therapeutic target for obesity. Therefore, the development of S1P2 receptor sub-type-specific ligands may be beneficial for potential medical interventions.

Acknowledgments

The present study was supported by a grant from the National Research Foundation of Korea, funded by the Korean government (grant no. 2013R1A1A2063931).

References

1 

Lei F, Zhang XN, Wang W, Xing DM, Xie WD, Su H and Du LJ: Evidence of anti-obesity effects of the pomegranate leaf extract in high-fat diet induced obese mice. Int J Obes (Lond). 31:1023–1029. 2007. View Article : Google Scholar

2 

Boyle KB, Hadaschik D, Virtue S, Cawthorn WP, Ridley SH, O'Rahilly S and Siddle K: The transcription factors Egr1 and Egr2 have opposing influences on adipocyte differentiation. Cell Death Differ. 16:782–789. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Kim KJ, Lee OH and Lee BY: Fucoidan, a sulfated polysac-charide, inhibits adipogenesis through the mitogen-activated protein kinase pathway in 3T3-L1 preadipocytes. Life Sci. 86:791–797. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Gregoire FM, Smas CM and Sul HS: Understanding adipocyte differentiation. Physiol Rev. 78:783–809. 1998.PubMed/NCBI

5 

Yanagiya T, Tanabe A and Hotta K: Gap-junctional communication is required for mitotic clonal expansion during adipogenesis. Obesity (Silver Spring). 15:572–582. 2007. View Article : Google Scholar

6 

Rayalam S, Della-Fera MA and Baile CA: Phytochemicals and regulation of the adipocyte life cycle. J Nutr Biochem. 19:717–726. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Xing Y, Yan F, Liu Y and Zhao Y: Matrine inhibits 3T3-L1 preadipocyte differentiation associated with suppression of ERK1/2 phosphorylation. Biochem Biophys Res Commun. 396:691–695. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Johnstone ED, Chan G, Sibley CP, Davidge ST, Lowen B and Guilbert LJ: Sphingosine-1-phosphate inhibition of placental trophoblast differentiation through a G(i)-coupled receptor response. J Lipid Res. 46:1833–1839. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Goetzl EJ, Wang W, McGiffert C, Liao JJ and Huang MC: Sphingosine 1-phosphate as an intracellular messenger and extracellular mediator in immunity. Acta Paediatr Suppl. 96:49–52. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Nincheri P, Luciani P, Squecco R, Donati C, Bernacchioni C, Borgognoni L, Luciani G, Benvenuti S, Francini F and Bruni P: Sphingosine 1-phosphate induces differentiation of adipose tissue-derived mesenchymal stem cells towards smooth muscle cells. Cell Mol Life Sci. 66:1741–1754. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Schüppel M, Kurschner U, Kleuser U, Schäfer-Korting M and Kleuser B: Sphingosine 1-phosphate restrains insulin-mediated keratinocyte proliferation via inhibition of Akt through the S1P2 receptor subtype. J Invest Dermatol. 128:1747–1756. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Bieberich E: There is More to a lipid than just being a fat: Sphingolipid-guided differentiation of oligodendroglial lineage from embryonic stem cells. Neurochem. 36:1601–1611. 2011. View Article : Google Scholar

13 

Pyne S and Pyne NJ: Sphingosine 1-phosphate signalling in mammalian cells. Biochem J. 349:385–402. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Zhang G, Contos JJ, Weiner JA, Fukushima N and Chun J: Comparative analysis of three murine G-protein coupled receptors activated by sphingosine-1-phosphate. Gene. 227:89–99. 1999. View Article : Google Scholar : PubMed/NCBI

15 

Ishii I, Friedman B, Ye X, Kawamura S, McGiffert C, Contos JJ, Kingsbury MA, Zhang G, Brown JH and Chun J: Selective loss of sphingosine 1-phosphate signaling with no obvious phenotypic abnormality in mice lacking its G protein-coupled receptor, LP(B3)/EDG-3. J Biol Chem. 276:33697–33704. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Maclennan AJ, Marks L, Gaskin AA and Lee N: Embryonic expression pattern of H218, a G-protein coupled receptor homolog, suggests roles in early mammalian nervous system development. Neuroscience. 79:217–224. 1997. View Article : Google Scholar : PubMed/NCBI

17 

Roelofsen T, Akkers R, Beumer W, Apotheker M, Steeghs I, van de Ven J, Gelderblom C, Garritsen A and Dechering K: Sphingosine-1-phosphate acts as a developmental stage specific inhibitor of platelet-derived growth factor-induced chemotaxis of osteoblasts. J Cell Biochem. 105:1128–1138. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Donati C, Meacci E, Nuti F, Becciolini L, Farnararo M and Bruni P: Sphingosine 1-phosphate regulates myogenic differentiation: A major role for S1P2 receptor. FASEB J. 19:449–451. 2005.

19 

Seo JS, Moon MH, Jeong JK, Seol JW, Lee YJ, Park BH and Park SY: SIRT1, a histone deacetylase, regulates prion protein-induced neuronal cell death. Neurobiol Aging. 33:1110–1120. 2012. View Article : Google Scholar

20 

Moon MH, Jeong JK, Seo JS, Seol JW, Lee YJ, Xue M, Jackson CJ and Park SY: Bisphosphonate enhances TRAIL sensitivity to human osteosarcoma cells via death receptor 5 upregulation. Exp Mol Med. 43:138–145. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Simon MF, Daviaud D, Pradère JP, Grès S, Guigné C, Wabitsch M, Chun J, Valet P and Saulnier-Blache JS: Lysophosphatidic acid inhibits adipocyte differentiation via lysophosphatidic acid 1 receptor-dependent downregulation of peroxisome proliferator-activated receptor gamma2. J Biol Chem. 280:14656–14662. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Fu L, Tang T, Miao Y, Zhang S, Qu Z and Dai K: Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone. 43:40–47. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Rosen ED and MacDougald OA: Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol. 7:885–896. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Ryu J, Kim HJ, Chang EJ, Huang H, Banno Y and Kim HH: Sphingosine 1-phosphate as a regulator of osteoclast differentiation and osteoclastosteoblast coupling. EMBO J. 25:5840–5851. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Meacci E, Cencetti F, Donati C, Nuti F, Farnararo M, Kohno T, Igarashi Y and Bruni P: Down-regulation of EDG5/S1P2 during myogenic differentiation results in the specific uncoupling of sphingosine 1-phosphate signalling to phospholipase D. Biochim Biophys Acta. 1633:133–142. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Martino A, Volpe E, Auricchio G, Izzi V, Poccia F, Mariani F, Colizzi V and Baldini PM: Sphingosine 1-phosphate interferes on the differentiation of human monocytes into competent dendritic cells. Scand J Immunol. 65:84–91. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Jiang L, Liu T, Song K, Guan S, Li X and Ge D: Stimulation of sphingosine-1-phosphate on cardiomyogenic differentiation of mesenchymal stem cells. Sheng Wu Gong Cheng Xue Bao. 29:1617–1628. 2013.In Chinese.

28 

Zhao Z, Chen Z, Zhao X, et al: Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions. J Biomed Sci. 18:372011. View Article : Google Scholar : PubMed/NCBI

29 

Bost F, Aouadi M, Caron L and Binétruy B: The role of MAPKs in adipocyte differentiation and obesity. Biochimie. 87:51–56. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Tang QQ, Otto TC and Lane MD: Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc Natl Acad Sci USA. 100:44–49. 2003. View Article : Google Scholar :

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jeong JK, Moon MH and Park SY: Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes. Mol Med Rep 12: 7496-7502, 2015.
APA
Jeong, J., Moon, M., & Park, S. (2015). Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes. Molecular Medicine Reports, 12, 7496-7502. https://doi.org/10.3892/mmr.2015.4388
MLA
Jeong, J., Moon, M., Park, S."Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes". Molecular Medicine Reports 12.5 (2015): 7496-7502.
Chicago
Jeong, J., Moon, M., Park, S."Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes". Molecular Medicine Reports 12, no. 5 (2015): 7496-7502. https://doi.org/10.3892/mmr.2015.4388
Copy and paste a formatted citation
x
Spandidos Publications style
Jeong JK, Moon MH and Park SY: Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes. Mol Med Rep 12: 7496-7502, 2015.
APA
Jeong, J., Moon, M., & Park, S. (2015). Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes. Molecular Medicine Reports, 12, 7496-7502. https://doi.org/10.3892/mmr.2015.4388
MLA
Jeong, J., Moon, M., Park, S."Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes". Molecular Medicine Reports 12.5 (2015): 7496-7502.
Chicago
Jeong, J., Moon, M., Park, S."Modulation of the expression of sphingosine 1-phosphate 2 receptors regulates the differentiation of pre-adipocytes". Molecular Medicine Reports 12, no. 5 (2015): 7496-7502. https://doi.org/10.3892/mmr.2015.4388
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team