Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2016 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation

  • Authors:
    • Jing Qin
    • Yongmei Hua
  • View Affiliations / Copyright

    Affiliations: Department of Orthodontics, School and Hospital of Stomatology, Tongji University, Shanghai Engineering Research Center of Tooth Restoration and Regeneration, Shanghai 200072, P.R. China
  • Pages: 3871-3877
    |
    Published online on: August 26, 2016
       https://doi.org/10.3892/mmr.2016.5680
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Periodontal ligament cells (PDLCs) are important in homeostasis and remodeling in the mechanically‑stimulated periodontium. The aim of the present study was to investigate the effects of hydrogen sulfide (H2S) on periodontal tissue remodeling by examining the mRNA and protein expression levels of alkaline phosphatase (ALP), osteocalcin (OCN) and collagen type I (COL‑1) in human (h)PDLCs induced by tension force application. Cultured hPDLCs were treated with H2S for 24 h, followed by application of a tension force for 1, 3 and 6 h. Cell proliferation and apoptosis were determined using a Cell Counting Kit 8 assay and flow cytometric analysis, respectively. The mRNA expression levels of ALP, OCN and COL‑1 were quantified using reverse transcription‑quantitative polymerase chain reaction analysis, and western blot analysis was used to detect the protein levels of ALP, OCN and COL‑1. The results demonstrated that the mRNA and protein expression levels of ALP, OCN and COL‑1 increased with H2S treatment in a concentration‑dependent manner, which was enhanced by the application of tension force in a relatively short period of time. These findings suggested that H2S may be important in periodontal tissue remodeling during orthodontic tooth movement via increasing hPDLC differentiation, tissue mineralization, bone formation and collagen synthesis.

Introduction

The periodontium is composed of gingival tissue, periodontal ligament, alveolar bone and cementum. During orthodontic tooth movement, periodontal ligament cells (PDLCs) are directly subject to mechanical stress, and are critical in regulating the processes of periodontal tissue repair and remodeling (1). Previously, several studies have shown that orthodontic tooth movement is regulated by PDLCs via modulation of the activity of alkaline phosphatase (ALP), production of osetocalcin (OCN) and synthesis of collagen type I (COL-1). In addition, the biological characteristics of PDLCs can be altered under the action of mechanical force (2–5). It is generally accepted that ALP is involved in the process of calcification in various mineralizing tissues (6). OCN is considered to be a marker of bone formation (7,8). Collagen fibers are the predominant component of the periodontal ligament extracellular matrix (ECM), and collagen types I and III are important in periodontal tissue remodeling (9). Therefore, the synthesis and degradation of ECM are key processes in the regulation of bone remodeling (10).

Hydrogen sulfide (H2S) is an endogenous gaseous signaling molecule, which has been traditionally classified as a toxic gas (11). In previous years, it was reported that low concentrations of H2S have anti-inflammatory, cytoprotective and chemopreventative potential (12), and have shown anticancer effects (13,14). H2S is synthesized endogenously from L-cysteine in mammals by at least two pyridoxal-5′-phosphate-dependent enzymes, cystathionine-γ-lyase and cystathionine β-synthase, in various organs (15,16). This molecule can permeate the cellular membrane without the assistance of a specific transporter. There are limited reports regarding with the effects of H2S on the biological activity of human PDLCs (hPDLCs), particularly during mechanical stress. Our previous results showed that H2S upregulated the expression ratio of OPG/receptor activator of nuclear factor-κB ligand (RANKL) in hPDLCs, with the maximum effect being observed at 0.5 mM, and tension force enhanced the effect of H2S on the expression of OPG/RANKL (17). The present study, investigated the effect of H2S on the expression levels of ALP, OCN and COL-1 in hPDLCs with and without tension force in order to further understand the effects of H2S on periodontal tissue remodeling.

Materials and methods

Cell isolation and culture

The hPDLCs were obtained from 21 patients (10 male and 11 female) aged between 12 and 16 years who required premolar extraction during the course of orthodontic treatment between August 2014 and October 2014 at Affiliated Stomatology Hospital of Tongji University (Shanghai, China). All patients signed informed consent and the study was approved by the Ethics Committee (2013-NSFC002) of Tongji University (Shanghai, China). The teeth, which were absent of inflammation, were immediately placed into a tube containing 1% Dulbecco's modified Eagle's medium (DMEM; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin and 100 U/ml streptomycin. The cells were scraped from the middle third of the root and maintained in DMEM supplemented with 15% charcoal-stripped serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml penicillin and 100 mg/ml streptomycin at 37°C in a 5% CO2 incubator, with replacement of the medium every 2 days. On reaching confluence, the cells were detached with 0.25% trypsin without EDTA and subcultured at a 1:3 ratio (18). In the subsequent experiments, cells between the third and eighth passages were used.

Cell viability assay

To determine cell viability, the hPDLCs were seeded into two 96-well plates with a cell density of 5×103 cells per well. Each treatment group was evaluated in triplicate. Sodium hydrosulfide (NaHS), as an exogenous donor (19), has been used to examine various biological activities of H2S. In the present study, NaHS (Aladdin, Shanghai, China) was dissolved in phosphate-buffered saline (PBS) and diluted into four concentrations (0.01, 0.05, 0.1 and 0.5 mM) with DMEM supplemented with 2% charcoal-stripped serum. The cells were then treated with H2S (0.01–0.5 mM) for 1–5 days and incubated at 37°C in 5% CO2. A Cell Counting Kit 8 (CCK 8) was then used to determine the viability of the cells. The optical density (OD) values of the media were measured at λ=450 nm using a microplate reader (Infinite™ 200; Tecan Austria GmbH, Grödig, Austria).

Flow cytometric analysis

The hPDLCs (1×106 cells/ml) were seeded in six-well plates and treated with H2S (0.01, 0.05, 0.1 and 0.5 mM) for 1–5 days at 37°C in 5% CO2. An Annexin V-fluorescein isothiocyanate (FITC) kit (BioVison, Inc., Mountain View, CA, USA) was used to assess the apoptosis of cells following treatment with H2S for different durations.

Tension force stimulation

The cells (1×106 cells/ml) were seeded into four flexible plates and pre-treated with H2S (0, 0.01, 0.05, 0.1 and 0.5 mM) in DMEM containing 2% charcoal-stripped serum for 24 h at 37°C in 5% CO2. The four flexible plates were subjected to a wave of 5% elongation, 0.5Hz (2 sec) (20) for 1, 3 and 6 h every time. The cells were collected for western blot and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analyses.

RT-qPCR analysis

Total cellular mRNA was obtained using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Complementary DNA was synthesized using a PrimeScript 1st Strand cDNA Synthesis kit (Takara Bio, Inc., Tokyo, Japan). The qPCR was performed using a SYBR Premix Ex Taq II (Tli RNase H Plus) kit (Takara Bio, Inc.) in an ABI Prism 7500 Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primer sequences are listed in Table I. The thermocycling conditions were as follows: 37°C for 15 min and 85°C for 5 sec (for the reverse transcription); followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec. Relative fold changes were calculated using the 2−∆∆Cq method (21) and standard curves were produced. The Cq values of the samples were normalized to the appropriate endogenous housekeeping gene, GAPDH. Each measurement was performed in triplicate.

Table I

Primer sequences for ALP, OCN, COL-1 and GAPDH.

Table I

Primer sequences for ALP, OCN, COL-1 and GAPDH.

GenePrimer sequence
(5′–3′)
Length
(bp)
ALPF: CTACACGGTCCTCCTATAC19
R: CTCGCTCTCGGTAACATC18
OCNF: CAGAGTCCAGCAAAGGTG18
R: CCAGCCATTGATACAGGTA19
COL-1F: GCTGTCTTATGGCTATGATGAGAA24
R: GACCACGAGGACCAGAGG18
GAPDHF: AGAAGGCTGGGGCTCATTTG20
R: AGGGGCCATCCACAGTCTTC20

[i] F, forward; R, reverse; ALP, alkaline phosphatase; OCN, osteocalcin; COL-1, collagen type I.

Western blot analysis

The cells were lysed using radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Haimen, China) and stored at −80°C. The cell lysates were separated on 10% (ALP and COL-1) and 15% (OCN) SDS-polyacrylamide electrophoresis gels and transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA) using a semi-dry transfer cell (Tannon Science & Technology Co., Ltd., Shanghai, China). The membranes were blocked for 1 h in 5% dry milk, rinsed and incubated with rabbit polyclonal anti-ALP antibody (cat. no. ab95462), rabbit monoclonal anti-OCN antibody (cat. no. ab133612), rabbit monoclonal anti-COL 1 antibody (cat. no. ab138492; all obtained from Abcam, Cambridge, MA, USA) at 1:1,000 dilutions in Tris-buffered saline (TBS) overnight at 4°C. The primary antibodies were then removed by washing the membranes three times in TBS. The primary antibodies were labeled by incubation with 0.1 mg/ml horseradish peroxidase-labeled goat anti-rabbit secondary antibodies (1:2,000; cat. no. KGAA35; Nanjing KeyGen Biotech Co., Ltd., Nanjing, China) at room temperature for 1 h. Following three washes in TBS, the antibody-bound proteins were detected using an enhanced chemiluminescence system (EMD Millipore).

Statistical analysis

All data in the present study are presented as the mean ± standard deviation from three independent experiments. Data was analyzed using Student's t-test with SAS 8.2 (SAS Institute, Cary, NC, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of H2S on cell proliferation

The cells were treated with different concentrations of H2S for 1–5 days. H2S had no significant effect on cell proliferation when the hPDLCs were treated for 3 days. However, H2S reduced the proliferation of the hPDLCs in a concentration-dependent manner following 4 and 5 days of incubation (Fig. 1).

Figure 1

Effects of H2S on cell proliferation. hPDLCs were treated with H2S (0.1 and 0.5 mM), OD values were measured using a Cell-Counting Kit 8 assay. The viability of the hPDLCs was significantly reduced following treatment of the cells with 0.1 mM H2S for 5 days, and 0.5 mM H2S for 4 and 5 days. Data are presented as the mean ± standard deviation. *P<0.05, vs. control. hPDLCs, human periodontal ligament cells; OD, optical density; H2S, hydrogen sulfide.

Effect of H2S on cell apoptosis

No effects of H2S on cell apoptosis were detected using flow cytometry when the cells were treated up to 4 days. However, H2S significantly induced apoptosis at the concentration of 0.5 mM following 5 days of treatment (Fig. 2A–E).

Figure 2

Effects of H2S on hPDLC apoptosis. Cells were treated with H2S (0.01–0.5 mM) for 5 days and flow cytometry was used to detect cell apoptosis. Representative flow cytometry results are shown for the (A) control group and the (B) 0.01, (C) 0.05, (D) 0.1 and (E) 0.5 mM H2S groups. Q2 and Q4 represent early and late apoptosis, respectively. (F) Apoptotic cells are expressed as a percentage of the total cell number. A significant increase in apoptosis was observed in the 0.5 mM H2S group. * P<0.05, vs. control. hPDLCs, human periodontal ligament cells; H2S, hydrogen sulfide; FITC, fluorescein isothiocyanate; PI, propidium iodide.

Effect of H2S on mRNA expression levels of ALP, OCN and COL-1

Data on the mRNA expression levels were obtained using RT-qPCR analysis, and the results showed that H2S significantly upregulated the mRNA expression levels of ALP, OCN and COL-1 in the hPDLCs at the concentration of 0.5 mM (Fig. 3A–C). Treatment with 0.1 and 0.5 mM H2S increased the mRNA expression levels of ALP and COL-1 induced by 1 h tension force stimulation (Fig. 3A and C). Treatment with 0.05–0.5 mM H2S upregulated the mRNA expression levels of ALP and COL-1 following tension force application for 3 and 6 h (Fig. 3A and C). The mRNA expression levels of OCN induced by tension force stimulation for 1, 3 and 6 h significantly increased following pretreatment with 0.05, 0.1 and 0.5 mM H2S (Fig. 3B).

Figure 3

mRNA expression levels of ALP, OCN and COL-1 following H2S treatment. Treatment with 0.5 mM H2S significantly upregulated the mRNA expression of (A) ALP, (B) OCN and (C) COL-1 in the cells. Treatment with 0.1 and 0.5 mM H2S enhanced mRNA expression of ALP and COL-1 following 1 h mechanical tension stimulation. (B) Pretreatment with H2S (0.05–0.5 mM) significantly upregulated the mRNA expression of OCN induced by tension force (1, 3 and 6 h). Treatment with 0.05–0.5 mM H2S significantly upregulated the mRNA expression of ALP and COL-1 following 3 and 6 h tension force. Data are expressed as the mean ± standard deviation (*P<0.05). H2S, hydrogen sulfide; ALP, alkaline phosphatase; OCN, osteocalcin; COL-1, collagen type I.

Effect of H2S on protein expression levels of ALP, OCN and COL-1

To investigate the role of H2S in hPDLCs, the protein expression levels of ALP, OCN and COL-1 were determined using western blot analysis following H2S pretreatment with or without subsequent tension force application (Fig. 4A–D). The results showed that treatment with 0.05–0.5 mM H2S significantly upregulated the protein expression levels of ALP, OCN and COL-1 (Fig. 4E–G). Treatment with 0.01–0.5 mM H2S significantly upregulated the protein expression levels of ALP and OCN in the cells subjected to 1 and 3 h of tension force application, and the protein expression levels of ALP and OCN induced by 6h tension force application significantly increased in the cells pre-exposed to H2S 0.05–0.5 mM; Fig. 4E and F). Treatment with 0.01–0.5 mM H2S significantly upregulated the protein expression of COL-1 in the cells induced by tension force application for 1 h, and treatment with 0.05–0.5 mM H2S significantly upregulated the protein expression of COL-1 in the cells subjected to tension force for 3 and 6 h. However, protein expression levels of OCN and COL-1 induced by 3 h of tension force was more marked, compared with those subjected to 1 and 6 h tension force application following pretreatment with 0.5 mM H2S (Fig. 4F and G).

Figure 4

Protein expression of ALP, OCN and COL-1 in hPDLCs following H2S pretreatment. The hPDLCs were treated with H2S (0–0.5 mM) and subjected to tension force application for (A) 0, (B) 1, (C) 3 or (D) 6 h. The protein expression levels of (E) ALP, (F) OCN and (G) COL-1 in the cells were examined using western blot analysis. Prior to application of tension force, the protein expression of ALP and COL-1 was significantly increased at concentrations of 0.05–0.5 mM. The protein expression of OCN was significantly increased at 0.05 and 0.5mM. Following tension force application, 0.01–0.5 mM H2S significantly upregulated the protein expression levels of ALP and OCN in response to 1 and 3 h tension force, and 0.05–0.5 mM H2S H2S significantly increased the protein expression levels of ALP and OCN induced by 6 h tension force. Pretreatment with 0.01–0.5 mM H2S significantly upregulated the protein expression of COL-1 following tension force stimulation for 1 h. Treatment with 0.05–0.5 mM H2S significantly increased the protein expression of COL-1 in response to 3 and 6 h tension force. Protein expression levels of OCN and COL-1 were higher in response to 3 h tension, compared with 1 and 6 h tension following incubation with 0.5 mM H2S. Data are expressed as the mean ± standard deviation. (*P<0.01 and **P<0.01). H2S, hydrogen sulfide; ALP, alkaline phosphatase; OCN, osteocalcin; COL-1, collagen type I.

Discussion

H2S has been recognized as a gasotransmitter, which has multiple physiological and pathophysiological functions in various mammalian systems (22,23). It has been reported that H2S has potential anti-inflammatory, anti-apoptotic, anticancer and neuroprotective effects (24,25). Previous studies have shown that the exogenous donor of NaHS significantly protects PC12 cells against formaldehyde-induced cytotoxicity and apoptosis through attenuating the accumulation of reactive oxygen species (ROS), upregulating levels of B cell lymphoma-2 (Bcl-2) and downregulating the expression of Bcl-2-associated X protein (26,27). In the present study, cytotoxicity was observed in response to H2S at a high concentration (Fig. 2). A high concentration of H2S may increase ROS formation and mitochondrial depolarization (28), decreasing the concentration of oxygen and leading to hypoxia and cell death. By contrast, low concentrations of H2S were protective and relatively safe to hPDLCs, suggesting <0.5 mM H2S is useful in hPDLCs.

hPDLCs produce ECM components, including collagen, which build up the periodontal ligament to secure attachment of the root cementum to the surrounding alveolar bone and is important in the restoration of mineralized tissue (29–31). In the present study, hPDLCs were isolated and characterized for their mesenchymal origin, with confirmation of their fibroblast-like morphology, as in our previous report (17). hPDLCs are capable of producing ALP, OCN and COL-1, suggesting osteoblast- and fibroblast-like features, which is consistent with previous studies (32,33). hPDLCs can differentiate into either osteoblasts or cementoblasts in response to mechanical force (34–38). In the present study, in order to investigate the effect of H2S on hPDLCs during orthodontic tooth movement, an appropriate tension force was applied to the hPDLCs following H2S treatment. As mentioned previously, our previous study demonstrated that H2S had a regulatory role within the periodontal remodeling process by promoting osteogenic differentiation via upregulating the expression ratio of OPG/RANKL in the hPDLCs. This promoting effect of H2S on OPG/RANKL was enhanced by tension force application (17). In the present study, it was observed that H2S upregulated the expression levels of ALP, OCN and COL-1 in a concentration-dependent manner, and pre-treatment with H2S enhanced the expression levels of ALP, OCN and COL-1 induced by tension force application.

ALP is a marker for the calcification and osteoblastic differentiation of PDLCs (39,40). OCN is a vitamin K-dependent Ca2+-binding protein of the bone matrix, which is synthesized by osteoblast-like cells and is considered to be a marker for bone formation (7,8). The collagen molecules in the periodontal ligament are known to respond to mechanical stimuli (41,42). COL-1 is one of the major fibrous elements of the periodontal ligament. It forms solid fibers anchored to the cementum and alveolar bone, and protects the periodontal ligament from tensile stress and masticatory loading (34,35). Therefore, the present study hypothesized that H2S regulates hPDLC differentiation, tissue mineralization and collagen synthesis through modulation of the mRNA and protein levels of ALP, OCN and COL-1.

The data obtained in the present study showed that the H2S-induced mRNA and protein expression levels of ALP, OCN and COL-1 were upregulated following tension force application (Fig. 4E). The mechanism underlying this H2S-induced expression of ALP, OCN and COL-1 in response to tension-force was not determined in the present study. It has been demonstrated that light mechanical strain induces biological changes in hPDLCs, including the release of various types of adhesion molecules and osteogenic factors, including ALP, OCN and COL-1 (2–4). Studies have shown that static mechanical deformation of PDLCs activates c-Jun and c-Fos, and increases the binding of activator protein-1 to the promoter of ALP, which is a major effector of osteoblastic differentiation (43). The gene expression of ALP in hPDLCs as a response to tension stimulation is associated with the intensity of the mechanical force and the culture conditions used (44–47). These findings indicate a potential synergetic effect between H2S and tension force application.

In conclusion, the present study demonstrated that exposure of hPDLCs to a high concentration and prolonged duration with H2S reduced the viability of the hPDLCs. It was observed that H2S significantly upregulated the expression levels of ALP, OCN and COL-1 in the hPDLCs, and pretreatment of the cells with H2S enhanced the expression levels of the proteins induced by tension force stimulation. These results suggested that H2S may be important in remodeling and functional regulation of periodontal tissue. Further investigations are required to elucidate the underlying cellular mechanism.

Acknowledgments

This study was supported by the National Science Foundation of China (grant no. 81371177).

References

1 

McCulloch CA, Lekic P and McKee MD: Role of physical forces in regulating the form and function of the periodontal ligament. Periodontol. 24:56–72. 2000. View Article : Google Scholar

2 

Matsuda N, Morita N, Matsuda K and Watanabe M: Proliferation and differentiation of human osteoblastic cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochem Biophys Res Commun. 249:350–354. 1998. View Article : Google Scholar : PubMed/NCBI

3 

Shimizu N, Ozawa Y, Yamaguchi M, Goseki T, Ohzeki K and Abiko Y: Induction of COX-2 expression by mechanical tension force in human periodontal ligament cells. J Periodontol. 69:670–677. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Myokai F, Oyama M, Nishimura F, Ohira T, Yamamoto T, Arai H, Takashiba S and Murayama Y: Unique genes induced by mechanical stress in periodontal ligament cells. J Periodontal Res. 38:255–261. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Liu M, Dai J, Lin Y, Yang L, Dong H, Li Y, Ding Y and Duan Y: Effect of the cyclic stretch on the expression of osteogenesis genes in human periodontal ligament cells. Gene. 491:187–193. 2012. View Article : Google Scholar

6 

De Bernard B: Glycoproteins in the local mechanism of calcification. Clin Orthop Relat Res. 233–244. 1982.PubMed/NCBI

7 

Hauschka PV: Osteocalcin: The vitamin K-dependent Ca2+-binding protein of bone matrix. Haemostasis. 16:258–272. 1986.PubMed/NCBI

8 

Neugebauer BM, Moore MA, Broess M, Gerstenfeld LC and Hauschka PV: Characterization of structural sequences in the chicken osteocalcin gene: Expression of osteocalcin by maturing osteoblasts and by hypertrophic chondrocytes in vitro. J Bone Miner Res. 10:157–163. 1995. View Article : Google Scholar : PubMed/NCBI

9 

Huang YH, Ohsaki Y and Kurisu K: Distribution of type I and type III collagen in the developing periodontal ligament of mice. Matrix. 11:25–35. 1991. View Article : Google Scholar : PubMed/NCBI

10 

Mariotti A: The extracellular matrix of the periodontium: Dynamic and interactive tissues. Periodontol 2000. 3:39–63. 1993. View Article : Google Scholar : PubMed/NCBI

11 

Beauchamp RO Jr, Bus JS, Popp JA, Boreiko CJ and Andjelkovich DA: A critical-review of the literature on hydrogen-sulfide toxicity. Crit Rev Toxicol. 13:25–97. 1984. View Article : Google Scholar

12 

Zanardo RC, Brancaleone V, Distrutti E, Fiorucci S, Cirino G and Wallace JL: Hydrogen sulfide is an endogenous modulator of leukocyte-mediated inflammation. FASEB J. 20:2118–2120. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Ma HB, Huang S, Yin XR, Zhang Y and Di ZL: Apoptotic pathway induced by diallyl trisulfide in pancreatic cancer cells. World J Gastroenterol. 20:193–203. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Lee ZW, Teo XY, Tay EY, Tan CH, Hagen T, Moore PK and Deng LW: Utilizing hydrogen sulfide as a novel anti-cancer agent by targeting cancer glycolysis and pH imbalance. Br J Pharmacol. 171:4322–4336. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Tay AS, Hu LF, Lu M, Wong PT and Bian JS: Hydrogen sulfide protects neurons against hypoxic injury via stimulation of ATP-sensitive potassium channel/protein kinase C/extracellular signal-regulated kinase/heat shock protein 90 pathway. J Neuroscience. 167:277–286. 2010. View Article : Google Scholar

16 

Baskar R and Bian J: Hydrogen sulfide gas has cell growth regulatory role. Eur J Pharmacol. 656:5–9. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Liao C and Hua Y: Effect of hydrogen sulphide on the expression of osteoprotegerin and receptor activator of NF-kB ligand in human periodontal ligament cells induced by tension-force stimulation. Arch Oral Biol. 58:1784–1790. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Wu Y, Liu F, Zhang X and Shu L: Insulin modulates cytokines expression in human periodontal ligament cells. Arch Oral Biol. 59:1301–1306. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Hughes MN, Centelles MN and Moore KP: Making and working with hydrogen sulfide: The chemistry and generation of hydrogen sulfide in vitro and its measurement in vivo: A review. Free Radical Bio Med. 47:1346–1353. 2009. View Article : Google Scholar

20 

Dong-Xu L, Hong-Ning W, Chun-Ling W, Hong L, Ping S and Xiao Y: Modulus of elasticity of human periodontal ligament by optical measurement and numerical simulation. Angle Orthod. 81:229–236. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Ito M, Suga T, Akiyoshi K, Nukuzuma S, Kon-no M, Umegaki Y, Kohdera U and Ihara T: Detection of measles virus RNA on SYBR green real-time reverse transcription-polymerase chain reaction. Pediatr Int. 52:611–615. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Kimura H, Nagai Y, Umemura K and Kimura Y: Physiological roles of hydrogen sulfide: Synaptic modulation, neuroprotection, and smooth muscle relaxation. Antioxid Redox Signal. 7:795–803. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Piper HM, Meuter K and Schäfer C: Cellular mechanisms of ischemia-reperfusion injury. Ann Thorac Surg. 75:S644–S648. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Abe K and Kimura H: The possible role of hydrogen sulfide as an endogenous neuromodulator. J Neurosci. 16:1066–1071. 1996.PubMed/NCBI

25 

Wei HJ, Li X and Tang XQ: Therapeutic benefits of H2S in Alzheimer's disease. J Clin Neurosci. 21:1665–1669. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Tang XQ, Yang CT, Chen J, Yin WL, Tian SW, Hu B, Feng JQ and Li YJ: Effect of hydrogen sulphide on beta-amyloid-induced damage in PC12 cells. Clin Exp Pharmacol Physiol. 35:180–186. 2008.

27 

Tang XQ, Ren YK, Zhou CF, Yang CT, Gu HF, He JQ, Chen RQ, Zhuang YY, Fang HR and Wang CY: Hydrogen sulfide prevents formaldehyde-induced neurotoxicity to PC12 cells by attenuation of mitochondrial dysfunction and pro-apoptotic potential. Neurochem Int. 61:16–24. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Eghbal MA, Pennefather PS and O'Brien PJ: H2S cytotoxicity mechanism involves reactive oxygen species formation and mitochondrial depolarization. Toxicology. 203:69–76. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Nyman S, Gottlow J, Karring T and Lindhe J: The regenerative potential of the periodontal ligament. An experimental study in the monkey. J Clin Periodontol. 9:257–265. 1982. View Article : Google Scholar : PubMed/NCBI

30 

Nyman S, Lindhe J, Karring T and Rylander H: New attachment following surgical treatment of human periodontal disease. J Clin Periodontol. 9:290–296. 1982. View Article : Google Scholar : PubMed/NCBI

31 

Nyman S, Gottlow J, Lindhe J, Karring T and Wennstrom J: New attachment formation by guided tissue regeneration. J Periodont Res. 22:252–254. 1987. View Article : Google Scholar : PubMed/NCBI

32 

Somerman MJ, Archer SY, Imm GR and Foster RA: A comparative study of human periodontal ligament cells and gingival fibroblasts in vitro. J Dent Res. 67:66–70. 1988. View Article : Google Scholar : PubMed/NCBI

33 

Liang L, Yu JF, Wang Y, Wang G and Ding Y: Effect of estrogen receptor beta on the osteoblastic differentiation function of human periodontal ligament cells. Arch Oral Biol. 53:553–557. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Kawarizadeh A, Bourauel C, Götz W and Jäger A: Early responses of periodontal ligament cells to mechanical stimulus in vivo. J Dent Res. 84:902–906. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Roberts WE, Mozsary PG and Klingler E: Nuclear size as a cell-kinetic marker for osteoblast differentiation. Am J Anat. 165:373–384. 1982. View Article : Google Scholar : PubMed/NCBI

36 

Wada N, Maeda H, Tanabe K, Tsuda E, Yano K, Nakamuta H and Akamine A: Periodontal ligament cells secrete the factor that inhibits osteoclastic differentiation and function: The factor is osteoprotegerin/osteoclastogenesis inhibitory factor. J Periodontal Res. 36:56–63. 2001. View Article : Google Scholar : PubMed/NCBI

37 

Kobawashi M, Takiguchi T, Suzuki R, Yamaguchi A, Deguchi K, Shionome M, Miyazawa Y, Nishihara T, Nagumo M and Hasegawa K: Recombinant human bone morphogenic protein-2 stimulates osteoblastic differentiation in cells isolated from human periodontal ligament. J Dent Res. 78:1624–1633. 1999. View Article : Google Scholar

38 

Verna C, Zaffe D and Siciliani G: Histomorphometric study of bone reactions during orthodontic tooth movement in rats. Bone. 24:371–379. 1999. View Article : Google Scholar : PubMed/NCBI

39 

Groeneveld MC, Everts V and Beertsen W: Alkaline phosphatase activity in the periodontal ligament and gingiva of the rat molar: Its relation to cementum formation. J Dent Res. 74:1374–1381. 1995. View Article : Google Scholar : PubMed/NCBI

40 

Okamoto T, Yatsuyzuka N, Tanaka Y, Kan M, Yamanaka T, Sakamoto A, Takata T, Akagawa Y, Sato GH, Sato JD and Takada K: Growth and differentiation of periodontal ligament-derived cells in serum-free defined culture. In Vitro Cell Dev Biol Anim. 33:302–309. 1997. View Article : Google Scholar : PubMed/NCBI

41 

Von den Hoff JW: Effects of mechanical tension on matrix degradation by human periodontal ligament cells cultured in collagen gels. J Periodont Res. 38:449–457. 2003. View Article : Google Scholar : PubMed/NCBI

42 

Wescott DC, Pinkerton MN, Gaffey BJ, Beggs KT, Milne TJ and Meikle MC: Osteogenic gene expression by human periodontal ligament cells under cyclic tension. J Dent Res. 86:1212–1216. 2007. View Article : Google Scholar : PubMed/NCBI

43 

Peverali FA, Basdra EK and Papavassiliou AG: Stretch-mediated activation of selective MAPK subtypes and potentiation of AP-1 binding in human osteoblastic cells. Mol Med. 7:68–78. 2001.PubMed/NCBI

44 

Chiba M and Mitani H: Cytoskeletal changes and the system of regulation of alkaline phosphatase activity in human periodontal ligament cells induced by mechanical stress. Cell Biochem Funct. 22:249–256. 2004. View Article : Google Scholar : PubMed/NCBI

45 

Jacobs C, Grimm S, Ziebart T, Walter C and Wehrbein H: Osteogenic differentiation of periodontal fibroblasts is dependent on the strength of mechanical strain. Arch Oral Biol. 58:896–904. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Yamaguchi N, Chiba M and Mitani H: The induction of c-fos mRNA expression by mechanical stress in human periodontal ligament cells. Arch Oral Biol. 47:465–471. 2002. View Article : Google Scholar : PubMed/NCBI

47 

Molina T, Kabsch K, Alonso A, Kohl A, Komposch G and Tomakidi P: Topographic changes of focal adhesion components and modulation of p125FAK activation in stretched human periodontal ligament fibroblasts. J Dent Res. 80:1984–1989. 2001. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qin J and Hua Y: Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation. Mol Med Rep 14: 3871-3877, 2016.
APA
Qin, J., & Hua, Y. (2016). Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation. Molecular Medicine Reports, 14, 3871-3877. https://doi.org/10.3892/mmr.2016.5680
MLA
Qin, J., Hua, Y."Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation". Molecular Medicine Reports 14.4 (2016): 3871-3877.
Chicago
Qin, J., Hua, Y."Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation". Molecular Medicine Reports 14, no. 4 (2016): 3871-3877. https://doi.org/10.3892/mmr.2016.5680
Copy and paste a formatted citation
x
Spandidos Publications style
Qin J and Hua Y: Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation. Mol Med Rep 14: 3871-3877, 2016.
APA
Qin, J., & Hua, Y. (2016). Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation. Molecular Medicine Reports, 14, 3871-3877. https://doi.org/10.3892/mmr.2016.5680
MLA
Qin, J., Hua, Y."Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation". Molecular Medicine Reports 14.4 (2016): 3871-3877.
Chicago
Qin, J., Hua, Y."Effects of hydrogen sulfide on the expression of alkaline phosphatase, osteocalcin and collagen type I in human periodontal ligament cells induced by tension force stimulation". Molecular Medicine Reports 14, no. 4 (2016): 3871-3877. https://doi.org/10.3892/mmr.2016.5680
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team