Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2017 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2017 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Developmental expression of Toll‑like receptors in the guinea pig lung

  • Authors:
    • Lingjie Ma
    • Jiali Yang
    • Li Yang
    • Juan Shi
    • Jing Xue
    • Yong Li
    • Xiaoming Liu
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of The Ministry of Education for The Conservation and Utilization of Special Biological Resources of Western China, Ningxia University, Yinchuan, Ningxia 750021, P.R. China, Ningxia Key Laboratory of Clinical and Pathogenic Microbiology, General Hospital of Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China, The Center of Experimental Animals, Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China
    Copyright: © Ma et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1243-1251
    |
    Published online on: January 17, 2017
       https://doi.org/10.3892/mmr.2017.6129
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

Introduction

The guinea pig (Cavia porcellus) is a rodent species in the Caviidae family (1,2). Guinea pigs are a valuable animal model for the study of developmental biology and the pathogenesis of multiple diseases due to similarities between their biological characteristics and those of humans. These similarities appear in hormonal and immunologic responses, pulmonary physiology, exogenous vitamin C requirements and delayed-type hypersensitivity to infections such as tuberculosis (3). Similarities in the sensitivity of the respiratory system and susceptibility to infectious agents results in the broad use of this species as a model of respiratory diseases (4). With respect to the pathogenesis and the immune response to these diseases, guinea pigs are more representative of a human than models using other rodent species.

The lung is an organ directly exposed to the environment, resulting in continuous contact with a diverse array of environmental insults. To respond to the internal and/or external environment, resident myeloid cells and stromal cells of the lung express a full complement of Toll-like receptors (TLRs), which are a class of signaling pattern-recognition receptors (PRRs) that contribute to innate and adaptive immunity by recognizing pathogen-associated molecular patterns (PAMPs) and endogenous danger-associated molecular patterns (DAMPs) (5,6). In addition, TLRs are implicated in the pathogenesis of non-infectious pulmonary diseases, including pulmonary fibrosis, chronic obstructive pulmonary disease (COPD) and acute lung injury (ALI) (7). TLRs were originally identified in Drosophila melanogaster, and revealed to be transmembrane receptor proteins that are highly conserved between D. melanogaster and humans (8,9). Although a large body of studies have demonstrated the association of TLRs with various pulmonary disorders in adult animal models and adult patients (7), several studies on fetal animals, including fetal murine and preterm lamb lung tissue specimens, have suggested that steady-state TLR mRNA expression levels increase with gestational development (10,11). Distinct characteristics and expression patterns of TLRs have also been reported between mammalian species, tissues and developmental stages (12–17). Therefore, in order to improve understanding of the mechanisms involved in cell specificity and regulation of TLR signaling transduction pathways, there is a need to investigate the nature of TLRs and ligands in different species.

Given the importance of TLRs in the development and homeostasis of tissues, the present study examined the differentiation of guinea pig lung epithelial cells during embryonic development and maturation following birth, and profiled the expression of TLRs (TLR-1, TLR-1, TLR-3, TLR-4, TLR-6, TLR-7, TLR-8, TLR-9 and TLR-10), as well as adaptors of the TLR pathway: Myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF-6).

Materials and methods

Animals and tissue processing

All experimental procedures were carried out according to ethical guidelines established by Ningxia University and were approved by the Ethnic Committee for Scientific Research of General Hospital of Ningxia Medical University (NXMU-H-2014-250; Yinchuan, China). A total of 51 three months old outbred Hartley-Duncan guinea pigs of both sexes (45 females and 6 males; 300±50 g) were obtained from the Animal Facility of Ningxia Medical University (Yinchuan, China). Total of 51 animals (45 females and 6 males) were used. Individuals were housed in the animal facility under clean, non-specific pathogen free conditions with a constant temperature of 24–26°C and humidity of 30–50% (12/12 h light/dark cycle), provided a proper balance of pellets, hay and fresh vegetables and free access to water, according to the Housing and Husbandry Guidelines for Laboratory Animals of Ningxia Medical University. The appearance of a vaginal plug in the morning following breeding was designated the first day of gestation (dGA). Animals were terminally euthanized by intraperitoneal injection of sodium pentobarbital (150 mg/kg) in the facility. Embryos were harvested from pregnant animals for lung isolation at 45, 52 and 59 dGA (embryos implanted in uterus with normal development were confirmed as alive, and those only showing implantation sites but without an embryo or a normally developed embryo were defined as dead), and lungs were harvested directly from pups 0, 7, 14 and 28 days following parturition (dPN). Lungs were also harvested from mature animals (6 weeks old). The trachea and lungs were removed and fixed in 10% neutral buffered formalin, then processed for embedding in a Sakura Tissue Tek Paraffin Tissue Processor (Model VIP E150; Sakura Finetek USA, Inc., Torrance, CA, USA).

Immunohistochemistry (IHC)

Immunohistochemical staining was performed on 6 µm thick paraffin sections. Paraffin sections were dewaxed in xylene and incubated in methanol containing 0.3% H2O2 for 30 min to inactivate endogenous peroxidase. Sections were subsequently rehydrated with graded ethanol according to histological standards. The sections were boiled in in citrate buffer (pH 6.0) at 95°C for 20 min for antigen retrieval followed by slow cooling for 2 h at room temperature. Sections were then blocked using a blocking buffer (5% horse serum in PBS; Vector Laboratories, Inc., Burlingame, CA, USA) at room temperature for 2 h prior to incubation with a primary antibody (diluted in blocking buffer; Table I) in a humid chamber at 4°C overnight. The primary antibodies used in the present study are listed in Table I. Following washing three times for 5 min in PBS, a mixture of biotinylated horse anti-rabbit IgG or anti-mouse IgG (cat. no. PK-6100; 1:200; Vector Laboratories, Inc.) secondary antibodies (Table I for detail) was applied at room temperature for 2 h. The antigen was detected with an elite ABC kit (Vector Laboratories, Inc.) and developed with a DAB peroxidase substrate kit (Vector Laboratories, Inc.). The stained sections were counterstained with hematoxylin for 10 sec (Gill's formula; Vector Laboratories, Inc.). Sections were subsequently rinsed in running tap water for 5 min, dehydrated with gradually increased concentration of ethanol (30–100% v/v), cleared sections by submerging slides in xylene for 1 min during mounting sections with Permount (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Hematoxylin and eosin (H&E) staining was performed using H&E staining kit from Thermo Fisher Scientific, Inc.. Periodic Acid Schiff's staining was conducted using Schiff's reagents from Sigma-Aldrich; Merck Millipore. Staining was visualized under a light microscope (TCS SP8; Leica, Wetzlar, Germany) at magnifications of ×200, ×400 and ×630, and images were captured using a Leica DFC300 F camera (Leica Microsystems, Inc., Buffalo Grove, IL, USA). For all antibodies tested, mouse positive and negative tissues were utilized as positive and negative controls, respectively.

Table I.

Primary antibodies used for immunohistochemical staining and western blotting.

Table I.

Primary antibodies used for immunohistochemical staining and western blotting.

AntibodyHostDilutionSupplierCatalog numberIHC or IB
Keratin 14Rabbit1:500Thermo SciRB-9020Both
Tubulin IVMouse1:2,000BioGenexMU178-UCBoth
pro-SPCRabbit1:5,000MilliporeAB3786Both
CCSPRabbit1:5,000USBiologicalC5828–03Both
TLR-3Rabbit1:1,000MilliporeNG1593494IB
TLR-6Rabbit1:1,000AbcamAB37072IB
TLR-9Rabbit1:1,000MilliporeAB10011IB
MyD88Rabbit1:1,000AbcamAB2068IB
TRAF-6Rabbit1:1,000Millipore04–451IB
GAPDHGoat1:1,000Santa CruzSc-20357IB

[i] Thermo Sci, Thermo Fisher Scientific, Inc., Waltham, MA, USA; BioGenex, BioGenex, Fremont, CA, USA; Millipore, Merck Millipore, Darmstadt, Germany; Abcam, Abcam, Cambridge, UK; Santa Cruz, Santa Cruz Biotechnology, Inc., Dallas, TX, USA.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from each tissue sample using TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. RNA quality was assayed by calculation of the RNA integrity number (RIN) (18). High quality RNA (RIN value >7.5) was used to synthesize first strand cDNA using M-MLV reverse transcriptase (Takara Bio, Inc., Otsu, Japan). qPCR was performed in the Roche LightCycler 2.0 (Roche Diagnostics, Basel, Switzerland) using a SYBR-Green I kit (Takara Bio, Inc.). The thermal cycling conditions were as follows: 95°C for 30 sec, 40 cycles of 95°C for 5 sec, 60°C for 20 sec and 72°C for 20 sec, followed by 40°C for 20 min. The primer sets used for β-actin control, TLRs, MyD88 and TRAF-6 are listed in Table II. To assess primer efficiency, standard curves for each primer pair were generated using serially diluted transcribed cDNA samples. PCR efficiency was calculated from the slope of the standard curves. β-actin internal controls were always included to normalize each reaction with respect to RNA integrity, sample loading and inter-PCR variations. The relative expression ratio was calculated from the real-time PCR efficiencies and the crossing point deviation of experimental samples vs. controls (19). The resulting threshold cycle (Cq) values were normalized to the endogenous control, β-actin (ΔCq=Cq value of target gene-Cq value of β-actin). Dissociation analysis of amplification products was performed at the end of each PCR to confirm the specificity of the amplicon. The fold change in TLR gene expression during lung development was calculated by the 2-ΔΔCq method (20).

Table II.

Sequences and parameters of reverse transcription-quantitative polymerase chain reaction.

Table II.

Sequences and parameters of reverse transcription-quantitative polymerase chain reaction.

GenesSequence (5′-3′)Anneal temperatureProduct sizeEnsembl ID
TLR1F: GTCCCAAGTTAGCCCATTTTTA60.0°C240 bp ENSCPOT00000005143
R: CTTTCAGCCCAAGAGCAAGTAT
TLR2F: AGGAAAAGTTGGAGCGGTTT60.0°C225 bp ENSCPOG00000025374
R: GGCAAAGGCAAAGAAAGTGA
TLR3F: GCAACAACAACATAGCCAACA60.0°C133 bp ENSCPOT00000004982
R: AGAAAATGAACAGGACCACCA
TLR4F: GTTATCGTTGTGGTGTCTCAGC60.0°C198 bp ENSCPOT00000015306
R: TTCCCATTCCAGGTAAGTGTTC
TLR6F: TTTGTCAGGGCTCAACATTCT60.0°C147 bp ENSCPOT00000005143
R: AAACTCACCACAGGGTAGCAG
TLR7F: ACTCCTTGGGGATAGATGGTTT60.0°C154 bp ENSCPOT00000015254
R: AATAGTGAGGGTGAGGTTGGTG
TLR8F: AGATGTGATTTGTGCCAGTCC60.0°C233 bp ENSCPOT00000004812
R: GGGATGTGGAAAGAGACCTGT
TLR9F: GGGAAGCAGTGACCAGAAC60.0°C121 bpXM003476720
R: TCCAAGGTGAATGGGATGTT
TLR10F: GAGGAGATGGGCTTCGACTAC60.0°C169 bp ENSCPOT00000015432
R: CTCAGTTCCAACAGCACGTC
MyD88F: GAGGAGATGGGCTTCGACTAC60.0°C164 bp ENSCPOT00000027931
R: CTCAGTTCCAACAGCACGTC
TRAF6F: ATCACTTGGCACGACACCTAC60.0°C138 bp ENSCPOT00000004556
R: GGGACAGAGAGGCAGAATCAT
β-actinF: GGACTTTGAGCAGGAGATGACT60.0°C127 bp ENSCPOT00000011124
R: CTGGAAAATGGCTTCAGGAC

[i] F, forward; R, reverse; TLR, toll-like receptor; MyD88, myeloid differentiation factor 88; TRAF-6, tumor necrosis factor receptor associated factor 6.

Western blot analysis

Tissue extracts were prepared by homogenizing the cells in a lysis buffer (50 mM Tris-HCl, 5 mM EDTA, 150 mM NaCl, 0.5% NP-40; pH 7.5) for 60 min on ice. Lysates were subsequently centrifuged at 10,000 × g for 10 min at 4°C, and the supernatants were collected as whole-cell extracts. The soluble protein concentration was measured with the Bio-Rad Protein Assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using bovine serum albumin (BSA; Thermo Fisher Scientific, Inc.) as a standard. The cell extracts (50 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and transferred to a polyvinylidene difluoride membrane (Merck Millipore). The membrane was blocked with 4% fat free dry milk in PBS containing 0.2% Tween-20 at room temperature for 2 h and incubated with primary antibodies (Table I) at 4°C overnight, followed by appropriate peroxidase-labeled secondary antibodies (cat. no. 108894; 1:2,000; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) at room temperature for 1 h. The blots were then developed using an enhanced chemiluminescence reagent (GE Healthcare, Chalfont, UK).

Statistical analysis

All data collected in the present study were obtained from at least three independent experiments for each condition. SPSS 18.0 analysis software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Statistical evaluation of the data was performed by one-way ANOVA and Student's t-tests to compare differences between groups. Tukey's honestly significant difference test was employed for post hoc testing for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference and P<0.01 was considered to indicate a highly statistically significant difference. Data were expressed as the mean ± standard deviation.

Results

Development of the guinea pig lung during embryogenesis

The guinea pig gestation period spans 59–73 days, with an average of 66±2 days recorded in the present study. Lobe formation in the lung was displayed at 45 dGA, with all 7 lobes (4 lobes in the right, 3 lobes in the left) formed at 59 dGA, as determined by whole mount anatomic lung morphological examination (Fig. 1). The lung continued to grow and mature, increasing in weight and size, with body growth (Fig. 1 and Table III). Histological analysis by H&E staining revealed that primary alveolar sacs had formed by 45 dGA, and bronchiolar structure was first observed in the distal lung of 52 dGA embryos (Fig. 2). Well-structured alveolar epithelia and bronchiolar epithelia were observed at 52 dGA and onward (Fig. 2). Epithelial cells in the trachea of 45 dGA embryos were poorly differentiated, despite the formation of a primary epithelial structure at this stage (Fig. 3). Abundant epithelial cells were observed on the surface of 52 dGA tracheas, but pseudostratified epithelial layers with ciliated cells were only observed in 59 dGA tracheas and onward (Fig. 3).

Figure 1.

Representative anatomic images guinea pig lungs. (A-F) Gestation and postnatal age of the lungs are indicated in the respective images. Bar=1.0 cm. dGA, days of gestation; dPN, days following parturition.

Figure 2.

Hematoxylin and eosin staining of distal guinea pig lungs at different developmental stages. Gestation and postnatal ages are indicated in the respective images. Bar=50 µm. dGA, days of gestation; dPN, days following parturition.

Figure 3.

Hematoxylin and eosin staining of guinea pig trachea at different developmental stages. Gestation and postnatal age are indicated in the respective images. Bar=50 µm. dGA, days of gestation; dPN, days following parturition.

Table III.

Gross parameters of the guinea pig lung at different developmental stages.

Table III.

Gross parameters of the guinea pig lung at different developmental stages.

AgesBody length (cm)Body weight (g)Lung length (cm)Lung weight (g)Trachea length (cm)
45 dGA   4.27±0.05     4.88±0.101.33±0.030.13±0.01   0.7±0.00
52 dGA   7.70±0.09   37.63±3.683.08±0.130.78±0.091.58±0.13
59 dGA10.55±0.12   79.97±2.833.83±0.131.90±0.061.85±0.07
0 dPN11.38±0.26   96.32±5.013.70±0.121.47±0.061.82±0.05
7 dPN13.03±0.25110.22±3.473.75±0.181.28±0.052.08±0.11
14 dPN15.23±0.87177.58±21.154.28±0.191.72±0.212.23±0.17
28 dPN17.73±0.65239.47±19.074.77±0.082.16±0.222.57±0.03

[i] dGA, days of gestation; dPN, days following parturition.

Expression of epithelial cell type-specific markers in the developing guinea pig lung

The expression of epithelial cell markers (21) in developing guinea pig lungs was examined using IHC analysis. At 45 dGA, keratin 14 (K14) was expressed in the basal layer of the tracheal epithelia (Fig. 4Aa) and pro-surfactant protein C (SPC) of alveolar type II cells was expressed in the lung (Fig. 4Ba), but there was no expression of β-tubulin IV (T4) of ciliary axonemes in the tracheal ciliated cells (Fig. 4C) or secretoglobin family1A member 1 (CCSP) of cube cells in the distal airway (Fig. 4D) at this gestation age (21). However, these 4 cell-specific markers were expressed in the lung of 52 dGA embryos and onward, particularly the CCSP was mainly expressed in epithelial cells of small airways in distal lung (Fig. 4), indicating that differentiation of varied epithelial cell types occurs during lung development in the guinea pig.

Figure 4.

Immunohistochemical staining of major epithelial cell markers at different developmental stages in the guinea pig lung. Epithelial markers and developmental stages are indicated on the images. (A) K14 staining of tracheal epithelium; (B) SPC staining of lung tissue; (C) T4 staining of tracheal epithelium and (D) CCSP staining of lung tissue at developmental stages of (a) 45 dGA, (b) 52 dGA, (c) 59 dGA, (d) 0 dPN, (e) 7 dPN, (f) 14 dPN, (g) 28 dPN and (h) adult. Bar=50 µm. dGA, days of gestation; dPN, days following parturition; K14, keratin 14; T4, β-tubulin IV; CCSP, secretoglobin family1A member 1; SPC, pro-surfactant protein C.

Developmental expression of TLRs in the lung of guinea pig

In order to evaluate changes of mRNA and protein expression levels of TLR signaling components during organogenesis and maturation of the lung in guinea pigs, the relative abundance of TLRs (−1, −2, −3, −4, −6, −7, −8, −9 and −10), MyD88 and TRAF-6 were investigated by RT-qPCR and western blotting, respectively, in distal lung tissues at 45, 52 and 59 dGA, 0, 7, 14 and 28 dPN, and in adult animals. RT-qPCR analysis demonstrated that the mRNA expression levels of all tested TLR signaling components was dynamic, with a similar expression pattern, in which transcripts were more abundant in the 45 dGA and 52 dGA lungs compared with later stages (Fig. 5A-D). Notably, TLR-2, −3, −6, −7, −8, −9 and −10 mRNA expression levels were higher in 45 dGA lungs compared with 52 dGA lungs (Fig. 5A and C), while TLR-1, −4, MyD88 and TRAF-6 mRNA expression levels were higher in 52 dGA lungs compared with 45 dGA lungs (Fig. 5A, B and D). In addition, increased TLR-7 mRNA expression levels were observed in 7 dPN lungs as compared with TLR-8, 9 and 10 at this stage (P=0.000; Fig. 5C). The results of western blotting demonstrated similar expression patterns to the RT-qPCR analysis for TLR-3, −6, −9, MyD88 and TRAF-6 proteins, with differential expression in guinea pig lungs during different developmental stages (Fig. 6). These data imply that TLR expression in guinea pig lungs is developmentally regulated.

Figure 5.

Differential expression of TLR mRNA in the guinea pig lung. The relative expression levels of TLR mRNAs in lung tissues at the indicated gestation and postnatal ages were determined by reverse transcription-quantitative polymerase chain reaction assays. (A) Fold-changes of TLR-1, −2, −3 and −6 mRNA expression levels. (B) Fold-changes of TLR-4 mRNA expression levels. (C) Fold-changes of TLR-7, −8, −9 and −10 mRNA expression levels. (D) fold-changes of MyD88 and TRAF-6 mRNA expression levels. Data are expressed as the mean ± standard deviation of fold-changes over the internal control (β-actin) from 6 animals for each time point. **P<0.01: TLR-1 vs. TLR-2, −3 and −6 at 56 dGA in A; 52 dGA vs. other developmental stages for TLR-4 in B; TLR-7 vs. TLR-8, −9 and −10 at 45 dGA and 7dPN in C; 52 dGA vs. other developmental stages for MyD88 and TRAF-6 in D. dGA, days of gestation; dPN, days following parturition, MyD88, myeloid differentiation factor 88; TRAF-6, tumor necrosis factor receptor associated factor 6.

Figure 6.

Expression of TLR proteins determined by western blotting. TLR-3, TLR-6, TLR-9, MyD88 and TRAF6 protein levels were determined in guinea pig lung tissues at the indicated developmental stages. TLR, toll-like receptor; MyD88, myeloid differentiation factor 88; TRAF-6, tumor necrosis factor receptor associated factor 6; dGA, days of gestation; dPN, days following parturition.

Discussion

In the present study, the morphogenesis and maturation of the guinea pig lung and the expression of TLR ligands and TLR signaling adaptors MyD88 and TRAF-6 were investigated from 45 dGA to maturation. Lung development was observed at as early as 45 dGA, along with expression of the basal cell marker K14 and alveolar type II cell marker SPC, but the cube cell marker CCSP and ciliated cell marker T4 were only observed in the lungs from 52 dGA onwards. Notably, the expression of all 9 examined TLRs and the TLR signaling adaptors MyD88 and TRAF-6 were detected at the transcriptional level in all lung tissues harvested from 45, 52 and 59 dGA, 0, 7, 14 and 28 dPN, and in adult animals. Transcript levels of all TLR signaling components formed similar dynamic expression patterns with gestation age and maturation time following parturition, with TLRs significantly more abundant in the lungs of 45 and 52 dGA embryos compared with later stages. These data imply that TLR expression in guinea pig lungs may be developmentally regulated.

TLRs are a family of mammalian proteins first observed in D. melanogaster (5). To date, 11 TLRs have been identified in humans (5). Different TLR ligands have been demonstrated to be involved in in the regulation of both innate and adaptive immune responses, in part through binding to different specific ligands. TLR-2 forms heterodimers with TLR-1 and TLR-6 upon binding to different lipopeptide and lipoprotein structures (22); TLR-2 and TLR-4 recognize lipids including lipopolysaccharide (LPS); TLR-3 and TLR-7-9 are activated by nucleic acids derived from viruses or bacteria, and TLR-5 primarily recognizes the protein flagellin from flagellated bacteria (23). In particular, TLR-9 recognizes various types of unmethylated cytosine-guanine repeat dideoxynucleotides (24). TLR-10, an orphan receptor with an unidentified ligand, is the most recent human TLR to be identified, and has been demonstrated to form heterodimers with TLR-1 and TLR-2 (22,25). TLR-10 mRNA expression was detected in guinea pig lungs in the present study.

In addition to immunoregulation, TLRs are involved in development and homeostasis, sensing endogenously derived materials during the processes of organogenesis and tissue generation. For example, hyaluronan (HA) is a breakdown product of extracellular matrix components, and the recognition of different forms of HA is essential for the maintenance of homeostasis and epithelial integrity during tissue regeneration following an injury and the restoration of normal tissue architecture (26–28). Several lines of evidence have demonstrated the developmental involvement of TLRs in mammalian and non-mammalian species during embryogenesis. For example, Kannaki et al (29) demonstrated differential expression patterns of TLR mRNAs during chicken embryological development, suggesting the potential involvement of TLRs in the regulation of chicken embryo development. This is supported by the initial discovery of Toll in D. melanogaster, the first member of the TLR family, as it was initially characterized as a developmental protein prior to the establishment of its immunological involvement (8,15). This is further supported by the discovery of the developmental involvement of TLR-7 and TLR-9 in the vertebrate brain (16).

The immunological and developmental involvements of TLRs in embryonic organogenesis have also been reported in mammalian lungs and other epithelial tissues (17,30). For example, in a study evaluating the developmental expression of TLR-2 and TLR-4 in preterm baboon lungs, Awasthi et al (30) demonstrated that the expression of these TLRs was significantly lower at 125 and 140 dGA compared with adult baboons, only reaching comparable levels at 175 dGA. This indicates that that TLR expression in baboon lungs is developmentally regulated. This developmental expression pattern was consistent with previous findings in fetal murine lung tissues (10) and in preterm lamb lung tissues (11), with TLR expression increasing with the length of gestation. This expression pattern may be different to that observed in the mature lung of adult animals and humans, where the expression of TLRs is dependent on immune cells including macrophages, dendritic cells and lung epithelial cells (7,31). In addition, developmentally regulated expression of TLRs was observed in fetal and neonatal human and mouse colonic epithelium (17). The results of the present study were consistent with these previous findings, with the expression of TLRs also being developmentally regulated in the guinea pig lung. Altered TLR signaling may lead to compromised structural development in the lung, as previously demonstrated in mice (32). An injection of LPS into the amniotic fluid of 15 dGA mice led to increases in the luminal volume density and decreases in distal branching of the lungs at 17 and 18 dGA, induced by activation of functional TLR-4 (32). Notably, in the present study, TLR mRNA expression levels were highest in guinea pig lungs at 45 and 52 dGA, and dramatically decreased as lung organogenesis and maturation progressed. Adult levels were reached by 59 dGA. The implications of such a dramatic change in TLR expression in the guinea pig lung warrants further investigation.

To conclude, morphogenesis and developmental expression of TLR signaling components in the guinea pig lung were examined in the present study. The dynamic expression of TLRs during lung development and maturation in the guinea pig was demonstrated, further confirming the developmental involvement of TLRs in lung morphogenesis in this animal model. These data lay a foundation upon which further understanding of the immunoregulatory mechanisms in the guinea pig lung may be built.

Acknowledgements

The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 31260615 and 31472191).

References

1 

D'Erchia AM, Gissi C, Pesole G, Saccone C and Arnason U: The guinea-pig is not a rodent. Nature. 381:597–600. 1996. View Article : Google Scholar : PubMed/NCBI

2 

Graur D, Hide WA and Li WH: Is the guinea-pig a rodent? Nature. 351:649–652. 1991. View Article : Google Scholar : PubMed/NCBI

3 

Padilla-Carlin DJ, McMurray DN and Hickey AJ: The guinea pig as a model of infectious diseases. Comp Med. 58:324–340. 2008.PubMed/NCBI

4 

Kashino SS, Napolitano DR, Skobe Z and Campos-Neto A: Guinea pig model of Mycobacterium tuberculosis latent/dormant infection. Microbes Infect. 10:1469–1476. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Takeda K and Akira S: TLR signaling pathways. Semin Immunol. 16:3–9. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Jimenez-Dalmaroni MJ, Gerswhin ME and Adamopoulos IE: The critical role of toll-like receptors-From microbial recognition to autoimmunity: A comprehensive review. Autoimmun Rev. 15:1–8. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Kovach MA and Standiford TJ: Toll like receptors in diseases of the lung. Int Immunopharmacol. 11:1399–1406. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Hashimoto C, Hudson KL and Anderson KV: The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell. 52:269–279. 1988. View Article : Google Scholar : PubMed/NCBI

9 

De Nardo D: Toll-like receptors: Activation, signalling and transcriptional modulation. Cytokine. 74:181–189. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Harju K, Glumoff V and Hallman M: Ontogeny of Toll-like receptors Tlr2 and Tlr4 in mice. Pediatr Res. 49:81–83. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Meyerholz DK, Kawashima K, Gallup JM, Grubor B and Ackermann MR: Expression of select immune genes (surfactant proteins A and D, sheep beta defensin 1, and toll-like receptor 4) by respiratory epithelia is developmentally regulated in the preterm neonatal lamb. Dev Comp Immunol. 30:1060–1069. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Mestas J and Hughes CC: Of mice and not men: Differences between mouse and human immunology. J Immunol. 172:2731–2738. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Schneberger D, Caldwell S, Suri SS and Singh B: Expression of toll-like receptor 9 in horse lungs. Anat Rec (Hoboken). 292:1068–1077. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Singh Suri S, Janardhan KS, Parbhakar O, Caldwell S, Appleyard G and Singh B: Expression of toll-like receptor 4 and 2 in horse lungs. Vet Res. 37:541–551. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Kambris Z, Hoffmann JA, Imler JL and Capovilla M: Tissue and stage-specific expression of the Tolls in Drosophila embryos. Gene Expr Patterns. 2:311–317. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Kaul D, Habbel P, Derkow K, Krüger C, Franzoni E, Wulczyn FG, Bereswill S, Nitsch R, Schott E, Veh R, et al: Expression of Toll-like receptors in the developing brain. PLoS One. 7:e377672012. View Article : Google Scholar : PubMed/NCBI

17 

Meng D, Zhu W, Shi HN, Lu L, Wijendran V, Xu W and Walker WA: Toll-like receptor-4 in human and mouse colonic epithelium is developmentally regulated: A possible role in necrotizing enterocolitis. Pediatr Res. 77:416–424. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, Gassmann M, Lightfoot S, Menzel W, Granzow M and Ragg T: The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol. 7:32006. View Article : Google Scholar : PubMed/NCBI

19 

Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e452001. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Li Y, Wang J, He HY, Ma LJ, Zeng J, Deng GC, Liu X, Engelhardt JF and Wang Y: Immunohistochemical demonstration of airway epithelial cell markers of guinea pig. Tissue Cell. 43:283–290. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Ospelt C and Gay S: TLRs and chronic inflammation. Int J Biochem Cell Biol. 42:495–505. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Takeda K and Akira S: Toll receptors and pathogen resistance. Cell Microbiol. 5:143–153. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Bauer S: Toll-like receptor 9 processing: The key event in Toll-like receptor 9 activation? Immunol Lett. 149:85–87. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Hasan U, Chaffois C, Gaillard C, Saulnier V, Merck E, Tancredi S, Guiet C, Brière F, Vlach J, Lebecque S, et al: Human TLR10 is a functional receptor, expressed by B cells and plasmacytoid dendritic cells, which activates gene transcription through MyD88. J Immunol. 174:2942–2950. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Jiang D, Liang J, Fan J, Yu S, Chen S, Luo Y, Prestwich GD, Mascarenhas MM, Garg HG, Quinn DA, et al: Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nature Med. 11:1173–1179. 2005. View Article : Google Scholar : PubMed/NCBI

27 

O'Neill LA: TLRs play good cop, bad cop in the lung. Nature Med. 11:1161–1162. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Sabroe I, Parker LC, Dower SK and Whyte MK: The role of TLR activation in inflammation. J Pathol. 214:126–135. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Kannaki TR, Reddy MR, Verma PC and Shanmugam M: Differential Toll-like receptor (TLR) mRNA expression patterns during chicken embryological development. Animal Biotechnol. 26:130–135. 2015. View Article : Google Scholar

30 

Awasthi S, Cropper J and Brown KM: Developmental expression of Toll-like receptors-2 and −4 in preterm baboon lung. Dev Comp Immunol. 32:1088–1098. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Armstrong L, Medford AR, Uppington KM, Robertson J, Witherden IR, Tetley TD and Millar AB: Expression of functional toll-like receptor-2 and −4 on alveolar epithelial cells. Am J Respir Cell Mol Biol. 31:241–245. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Prince LS, Dieperink HI, Okoh VO, Fierro-Perez GA and Lallone RL: Toll-like receptor signaling inhibits structural development of the distal fetal mouse lung. Dev Dyn. 233:553–561. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma L, Yang J, Yang L, Shi J, Xue J, Li Y and Liu X: Developmental expression of Toll‑like receptors in the guinea pig lung. Mol Med Rep 15: 1243-1251, 2017.
APA
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., & Liu, X. (2017). Developmental expression of Toll‑like receptors in the guinea pig lung. Molecular Medicine Reports, 15, 1243-1251. https://doi.org/10.3892/mmr.2017.6129
MLA
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., Liu, X."Developmental expression of Toll‑like receptors in the guinea pig lung". Molecular Medicine Reports 15.3 (2017): 1243-1251.
Chicago
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., Liu, X."Developmental expression of Toll‑like receptors in the guinea pig lung". Molecular Medicine Reports 15, no. 3 (2017): 1243-1251. https://doi.org/10.3892/mmr.2017.6129
Copy and paste a formatted citation
x
Spandidos Publications style
Ma L, Yang J, Yang L, Shi J, Xue J, Li Y and Liu X: Developmental expression of Toll‑like receptors in the guinea pig lung. Mol Med Rep 15: 1243-1251, 2017.
APA
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., & Liu, X. (2017). Developmental expression of Toll‑like receptors in the guinea pig lung. Molecular Medicine Reports, 15, 1243-1251. https://doi.org/10.3892/mmr.2017.6129
MLA
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., Liu, X."Developmental expression of Toll‑like receptors in the guinea pig lung". Molecular Medicine Reports 15.3 (2017): 1243-1251.
Chicago
Ma, L., Yang, J., Yang, L., Shi, J., Xue, J., Li, Y., Liu, X."Developmental expression of Toll‑like receptors in the guinea pig lung". Molecular Medicine Reports 15, no. 3 (2017): 1243-1251. https://doi.org/10.3892/mmr.2017.6129
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team