Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2017 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2017 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice

  • Authors:
    • Ling‑Jian Kong
    • Hao Li
    • Ya‑Ju Du
    • Feng‑Hua Pei
    • Ying Hu
    • Liao‑Liao Zhao
    • Jing Chen
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150086, P.R. China
    Copyright: © Kong et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2604-2610
    |
    Published online on: March 15, 2017
       https://doi.org/10.3892/mmr.2017.6325
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Among the various consequence arising from lung injury, hepatic fibrosis is the most severe. Decreasing the effects of hepatic fibrosis remains one of the primary therapeutic challenges in hepatology. Dysfunction of hepatic sinusoidal endothelial cells is considered to be one of the initial events that occur in liver injury. Vascular endothelial growth factor signaling is involved in the progression of genotype changes. The aim of the present study was to determine the effect of the tyrosine kinase inhibitor, vatalanib, on hepatic fibrosis and hepatic sinusoidal capillarization in a carbon tetrachloride (CCl4)‑induced mouse model of liver fibrosis. Liver fibrosis was induced in BALB/c mice using CCl4 by intraperitoneal injection for 6 weeks. The four experimental groups included a control, and three experimental groups involving administration of CCl4, vatalanib and a combination of the two. Histopathological staining and measuring live hydroxyproline content evaluated the extent of liver fibrosis. The expression of α‑smooth muscle actin (SMA) and cluster of differentiation (CD) 34 was detected by immunohistochemistry. Collagen type I, α‑SMA, transforming growth factor (TGF)‑β1 and vascular endothelial growth factor receptor (VEGFR) expression levels were measured by reverse transcription-quantitative polymerase chain reaction (RT‑qPCR). The average number of fenestrae per hepatic sinusoid was determined using transmission electron microscopy. Liver fibrosis scores and hydroxyproline content were decreased in both vatalanib groups. In addition, both doses of vatalanib decreased mRNA expression levels of hepatic α-SMA, TGF-β1, collagen‑1, VEGFR1, and VEGFR2. Levels of α‑SMA and CD34 protein were decreased in the vatalanib group compared with the CCl4 group. There were significant differences in the number of fenestrae per sinusoid between the groups. The present study identified that administration of vatalanib was associated with decreased liver fibrosis and hepatic sinusoidal capillarization in CCl4-induced mouse models, and is a potential compound for counteracting liver fibrosis.

Introduction

Hepatic fibrosis is a primary consequence of liver injury that results from chronic liver diseases, including chronic viral hepatitis, alcohol and metabolic liver disease (1,2). The ultimate aim is to treat the cause of the liver disease, which may lead to the reversal of fibrosis (3,4). With emerging novel technology and refined methodologies, knowledge concerning the mechanisms underlying liver fibrosis and its pathogenesis are continuously expanding (5). However, the development of anti-fibrotic compounds represents a major therapeutic challenge (6).

Vascular endothelial growth factor (VEGF) is an important mediator of angiogenesis (7). In addition, VEGF and its receptors serve critical roles in chronic inflammation and liver fibrosis (8,9). Angiogenesis is involved in chronic inflammatory liver disease. The fact that these diseases respond poorly to conventional anti-inflammatory therapy suggests that angiogenesis may be an effective therapeutic target in reversing persistent, stable inflammation in chronic liver diseases (10). Intra-hepatic angiogenesis and sinusoidal remodeling occur in many chronic liver diseases (11). Anti-angiogenesis treatment may be a therapeutic approach in liver fibrosis and portal hypertension (11). It has been previously reported that anti-angiogenesis drugs, including sorafenib, sunitinib, and Endostar, which are used in the treatment of carcinoma, inhibit hepatocellular carcinoma and liver fibrosis (12–15).

Vatalanib, also known as PTK/ZK, is an orally active, small molecule tyrosine kinase inhibitor that is effective against all VEGF receptors (16,17). It has been demonstrated that the combination of vatalanib and intravenous doxorubicin administration has encouraging activity in treating advanced hepatocellular carcinoma (HCC) patients (18). In China, the majority of HCC patients have co-existing hepatitis B and liver cirrhosis (19). A previous study indicated that vatalanib had anti-fibrotic effects in experimental liver fibrosis in vivo (20). However, the underlying mechanism by which this occurs remains unclear. The aim of the current study was to determine the anti-fibrogenic effects of vatalanib in terms of pathological alterations of the liver and hepatic sinusoidal endothelial cell (SEC) phenotypes in CCl4-induced fibrotic mice.

Materials and methods

Mouse model of CCl4-induced liver fibrosis

Vatalanib was purchased from LC Laboratories (Woburn, MA, USA; cat. no. V-8303), and dissolved in 100 mg/ml distilled water. A total of 32 male BALB/c mice weighing 18–20 g were obtained from Beijing Vital River Laboratory Animal Technology (Beijing, China). The Animal Care and Use Committee of Harbin Medical University approved all protocols and procedures (Harbin, China). Animals were housed in an air-conditioned room at 23–25°C with a 12-h dark/light cycle for one week prior to the initiation of experiments. All animals received appropriate care during the study with unlimited access to food and water.

Liver fibrosis was induced in mice by intraperitoneal injection of CCl4 (40% CCl4 in olive oil, 0.2 ml/100 g body weight, twice weekly) for 6 weeks as previously reported (21). A total of four groups were studied: Group 1, normal control mice; group 2, CCl4 alone; group 3, CCl4 + vatalanib (50 mg/kg/d by gavage for 6 weeks, vatalanib was administered simultaneously with a CCl4 injection for 6 weeks); and group 4, CCl4 + vatalanib (50 mg/kg/d by gavage for 4 weeks, CCl4 alone was administered to mice for 2 weeks, following which vatalanib was administered to mice simultaneously with CCl4 injection for another 4 weeks). In the previous study, vatalanib (50 and 100 mg/kg/d) was well tolerated by the mice, and had no significant effects on body weight (22). Therefore, 50 mg/kg/d was used in the present study. Previous studies identified that CCl4-induced hepatic fibrosis is present after 2 weeks (20). Group 1 received olive oil intraperitoneally at the same dose and conditions as the CCl4-treated mice.

Mice were euthanized (via 2% pentobarbital i.p. at 0.3 ml/ 100 g body weight) and liver samples were immediately snap-frozen in liquid nitrogen and stored at −80°C until further use. An additional section was embedded in paraffin and sliced into 4–5 µm sections.

Histological examination

Sections were stained with hematoxylin and eosin and Sirius Red (Solarbio Life Sciences, Beijing, China) for histopathological analysis and liver fibrosis evaluation. Each sample was independently assessed and scored by two pathologists, blinded to the study protocol, according to a fibrosis score system (16). Liver fibrosis was divided into seven stages: 0, no fibrosis; 1, short fibrous tissue in central venule (C); 2, fibrous between central venule and central venule (C-C) septa appearance; 3, C-C fibrous septa incompletely developed; 4, C-C septa completely connected (pseudo-lobule); 5, C-P (portal tract) bridging fibrosis, nodular appearance ≤50%; and 6, nodular appearance >50%.

Hepatic hydroxyproline analyses

Hepatic hydroxyproline was measured using a hydroxyproline detection kit (Jiancheng Institute of Biotechnology, Nanjing, China) according to the manufacturer's protocol. The hydroxyproline content is expressed as mg/g wet liver.

Transmission electron microscopy (TEM)

Samples were processed for TEM as described previously (23). Fresh specimens were fixed in 3% glutaraldehyde (Beijing Brilliance Biochemical Company, Beijing, China), washed with PBS, and fixed in 1% osmic acid for 60 min. The samples were dehydrated through an alcohol series, embedded in EPON 812 epoxy resin (Hede Biotechnology Co., Ltd., Beijing, China), and then cut into 50 nm sections with an ultrathin microtome. Following staining with uranyl acetate and lead citrate for 30 min, the sections were examined using a transmission electron microscope (cat. no. H-7650; Hitachi, Ltd., Tokyo, Japan). A total of 10 hepatic sinusoids with a diameter of 2–3 µm were randomly selected from each group and subgroup, and the mean number of fenestrae per hepatic sinusoid was determined. Each sample was independently assessed and scored by two pathologists, both blinded to the study protocol.

Biochemical analyses

Blood was collected from the inferior vena cava. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL) and albumin were assayed using an automatic biochemical analyzer (cat. no. 7600; Hitachi, Tokyo, Japan).

Immunohistochemistry staining for α-SMA and CD34

CD34 is a marker of newly-formed blood vessels. The vascular density in portal and peri-portal areas was assessed by determining the number of CD34-labeled vessel sections (24). Liver tissue samples were fixed in 10% formalin for 1 week at room temperature, sliced into 4–6 mm pieces, dehydrated in ethanol and embedded in paraffin wax. α-SMA and CD34 were detected in paraffin-embedded liver sections (4–5 µm thick) using the following specific primary antibodies: α-SMA (cat. no. A2547; Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) and CD34 (cat no. ab81289; Abcam, Cambridge, MA, USA) and an avidin-biotin complex immunoperoxidase method (15). Following antigen retrieval by immersion in EDTA (1 mmol/l, pH 8.0) and boiling for 15 min, sections were pre-blocked with normal goat serum for 10 min, and incubated for 2 h at room temperature with specific antibodies (α-SMA, dilution 1:200; CD34, dilution, 1:200). PBS was used in place of the primary antibodies for the negative controls. Following rinsing, the biotinylated secondary antibody (goat anti-rabbit IgG, cat no. ZDR-5307, goat anti-mouse IgG, cat. no. ZDR-5306, OriGene Technologies, Inc., Beijing, China), avidin-biotin complex and horseradish peroxidase (Strept ABComplex; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) were applied. Finally, the sections were washed with PBS, developed with diaminobenzidine tetrahydrochloride substrate (Strept ABComplex; Dako; Agilent Technologies, Inc.) for 3 min, and counterstained with hematoxylin.

Computer-assisted semi-quantitative analysis was used to evaluate the areas of positive α-SMA and CD34 staining using Image-ProPlus software (version 4.5; Media Cybernetics, Inc., Rockville, MD, USA). The data for the α-SMA and CD34 staining are expressed as the mean percentage of the positively stained area relative to the total tissue section area (17).

Measurement of mRNA levels of collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 by RT-qPCR

Total RNA was extracted from liver tissues and HSC-T6 cells using a TRIzol® Reagent kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. The quality of total RNA was verified by ultraviolet absorbance spectrophotometry at 260 and 280 nm. cDNA was reversed transcribed using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The thermocycling parameters were as follows: 25°C for 10 min, 37°C for 150 min, 85°C for 5 sec, and 4°C for 5 min for one cycle, before chilling on ice. cDNA was stored at −20°C until further required. Collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 mRNA levels were quantified using the primers presented in Tables I and II. GAPDH, a housekeeping gene, was used as an internal control primer for target genes. All primers were obtained from Invitrogen; Thermo Fisher Scientific, Inc. The expression of mRNA was measured by SYBR Green Real-Time PCR using an ABI 7500 instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). PCR was performed in 20 µl buffer that contained 2 µg cDNA, 1 µl each primer and 10 µl SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). Comparative quantitation threshold (Cq) calculations were all relative to the control group. The expression of mRNA relative to the control was derived using the equation 2−∆∆Cq (25).

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction analysis.

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction analysis.

GeneDirectionPrimer sequence (5′-3′)Accession number
GAPDH (mouse)F GCACAGTCAAGGCCGAGAATXM_001476707.3
R GCCTTCTCCATGGTGGTGAA
Col I a1 (mouse)F TTCACCTACAGCACGCTTGTGNM_007742.3
R GATGACTGTCTTGCCCCAAGTT
α-SMA (mouse)F TCAGCGCCTCCAGTTCCTNM_007392.2
R AAAAAAAACCACGAGTAACAAATCAA
TGF-β1 (mouse)F CCCGAACCCCCATTGCTGTCCNM_011577.1
R AGGCGTATCAGTGGGGGTCAG
VEGFR1 (mouse)F CCACCTCTCTATCCGCTGGNM_010228.3
R ACCAATGTGCTAACCGTCTTATT
VEGFR2 (mouse)F CAAACCTCAATGTGTCTCTTTGCNM_010612.2
R AGAGTAAAGCCTATCTCGCTGT

[i] Col I a1, type I collagen; α-SMA, α-smooth muscle actin; TGF-β1, transforming growth factor-β1; VEGFR, vascular endothelial growth factor receptor; F, forward; R, reverse; CCl4, carbon tetrachloride.

Table II.

Effects of vatalanib on CCl4-induced liver fibrosis.

Table II.

Effects of vatalanib on CCl4-induced liver fibrosis.

Liver fibrosis score

Group0123456Mean ± standard deviation
1 (n=7)70000000
2 (n=8)00002514.88±0.64
3 (n=8)0043100   2.6±0.74a
4 (n=8)0033110   3.0±1.07a

{ label (or @symbol) needed for fn[@id='tfn2-mmr-15-05-2604'] } CCl4, carbon tetrachloride. Group 1, normal control; group 2, CCl4 model; group 3, CCl4 + vatalanib (6 weeks, 50 mg/kg); and group 4, CCl4 + vatalanib (4 weeks, 50 mg/kg).

a P<0.01 vs. CCl4 group.

Statistical analysis

The results are expressed as the mean ± standard deviation. Statistical analysis was performed by analysis of one way analysis of variance and unpaired Student's t-test as appropriate. Non-parametric data were analyzed by the Mann-Whitney U-test. P<0.05 was considered to indicate a statistically significant difference. Statistical analyses were performed using SPSS (version 17.0; SPSS Inc., Chicago, IL, USA). Data are presented as the mean ± standard deviation.

Results

Vatalanib inhibits liver fibrosis in CCl4-induced mice

There were no collagen fibers along the central vein in control group 1 (Fig. 1A). In group 2, collagenous fibers extended from the central vein and the portal area to the hepatic lobules with pseudo-lobule formation (Fig. 1B). With administration of vatalanib (50 mg/kg/d, for 4 or 6 weeks) in groups 3 (Fig. 1C) and 4 (Fig. 1D), collagenous fibers were decreased compared with group 2. The fibrosis scores following vatalanib administration in groups 3 and 4 were significantly reduced when compared with those in group 2 (P<0.05; Table II). In addition, vatalanib reduced hydroxyproline concentrations in liver tissue, reflecting decreased total hepatic collagen content (P<0.01; Table III).

Figure 1.

Vatalanib attenuates the extent of liver fibrosis in CCl4-stimulated mice. Representative photomicrographs of Sirius Red staining in groups (A) 1, control; (B) 2, CCl4 model; (C) 3, CCl4 + vatalanib (6 weeks, 50 mg/kg) and (D) 4, CCl4 + vatalanib (4 weeks, 50 mg/kg). Magnification, ×100. CCl4, carbon tetrachloride.

Table III.

Effects of vatalanib on biochemical markers in CCl4-treated mice.

Table III.

Effects of vatalanib on biochemical markers in CCl4-treated mice.

Group 1 (n=7)Group 2 (n=8)Group 3 (n=8)Group 4 (n=8)
Hydroxyproline (mg/g liver)0.1±0.0492.0±4.6 54.2±5.4a 49.8±6.9a
ALT (IU/ml)38.4±5.9149.5±19.4 98.8±14.6a 109.2±10.4a
AST (IU/ml)41.0±8.3235.5±16.8 149.0±14.8a 153.9±19.0a
TBIL (mg/dl)1.0±0.11.9±0.21.8±0.31.8±0.2
Albumin (g/l)34.8±1.526.2±1.928.6±1.629.2±1.8

{ label (or @symbol) needed for fn[@id='tfn4-mmr-15-05-2604'] } ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBIL, total bilirubin; CCl4, carbon tetrachloride. Group 1, normal control; group 2, CCl4 model; group 3, CCl4 + vatalanib (6 weeks, 50 mg/kg); and group 4, CCl4 + vatalanib (4 weeks, 50 mg/kg). Data are expressed as the mean ± standard deviation.

a P<0.01 (vatalanib group vs. CCl4 group).

Vatalanib reduces liver inflammation

Serum ALT and AST levels were significantly decreased following vatalanib treatment (P<0.01), whereas no significant alterations in serum TBIL and albumin levels were observed (P>0.05; Table III).

Vatalanib inhibits α-SMA and CD34 protein levels

Levels of α-SMA, a typical marker of activated HSCs, were assessed by immunohistochemistry to evaluate the effect of vatalanib on HSC activation during hepatic fibrosis. There was no positive staining in control group 1 (Fig. 2A). CCl4 alone led to considerable increases in the amount of α-SMA positive cells, which were distributed throughout the fibrotic septa (Fig. 2B). Computer-assisted semi-quantitative analysis revealed that vatalanib-treated groups (groups 3 and 4) presented significantly decreased α-SMA-positive areas compared with group 2 (P<0.05; Fig. 2C-E). These results demonstrated that vatalanib decreased the number of activated HSCs.

Figure 2.

Vatalanib suppresses α-SMA and CD34 expression in CCl4-induced fibrotic mouse livers. Representative photomicrographs of immunohistochemistry staining of α-SMA expression in the following groups: (A) 1, normal control; (B) 2, CCl4 model; (C) 3, CCl4 + vatalanib (6 weeks, 50 mg/kg) and (D) 4, CCl4 + vatalanib (4 weeks, 50 mg/kg). (E) Semi-quantitative analysis of the immunohistochemical staining. (F-J) Representative photomicrographs of immunohistochemical staining of CD34 expression in groups (F) 1, (G) 2, (H) 3 and (I) 4. (J) Semi-quantitative analysis of the immunohistochemical staining. Magnification, ×100. α-SMA, α-smooth muscle actin; CCl4, carbon tetrachloride; CD34, cluster of differentiation 34. Data are presented as the mean ± standard deviation. *P<0.05 vatalanib vs. CCl4 group. **P<0.05 CCl4 vs. normal group.

There was little positive CD34 staining in the control group 1 (Fig. 2F). Following six weeks of CCl4 induction, this led to significant increases in the number of CD34 positive cells, while groups 3 and 4 presented significantly decreased CD34 positive areas compared with group 2 (P<0.05; Fig. 2G-J).

Ultrastructural changes in fibrotic mice after vatalanib treatment

There were significantly increased fenestrae per SEC in group 1 (Fig. 3A) compared with group 2 (Fig. 3B; P<0.01; Table IV). In group 2, the microvilli of hepatocytes in the perisinusoidal space and the intra-lobular bile ducts (cholangioles) disappeared (Fig. 3C), and the junctions between hepatocytes were destroyed (Fig. 3D). In group 3, the number of fenestrae was significantly increased compared with group 2 (P<0.01; Fig. 3E; Table IV), and cholangioles appeared morphologically healthy (Fig. 3F). Group 4 additionally had an increased number of fenestrae compared with group 2 (Fig. 3G; Table IV), and presented with cell junctions similar to normal control mice (Fig. 3H). There were no significant differences in the numbers of fenestrae between groups 3 and 4 (P>0.05). The extent of hepatocyte necrosis and inflammation was less so in groups 3 and 4 compared with group 2.

Figure 3.

CCl4-stimulates SEC capillarization, cholangiole extension and decreased hepatocyte microvilli. Vatalanib attenuated SEC capillarization and decreased the damage in cholangioles, microvilli and cell junctions between hepatocytes. Representative images representing different fields of views of the four groups. Group 1 exhibiting (A) normal SECs, fenestrae and (B) cell junctions between hepatocytes. Group 2 was in a fibrotic state and exhibited (C) disappearance of SEC fenestrae and the appearance of a basement membrane, and (D) disappearance of cell junctions with cholangiole extension, and karyopyknosis in hepatocytes. Group 3, treated with vatalanib (6 weeks, 50 mg/kg) presented with (E) fenestrae of SECs similar to those of normal control mice and (F) cell junctions between hepatocytes similar to normal control mice. Group 4 treated with vatalanib (4 weeks, 50 mg/kg) demonstrated (G) fenestrae of SECs similar to normal control mice and (H) cell junctions between hepatocytes similar to normal control mice. Magnification, ×12,000. CCl4, carbon tetrachloride; SEC, sinusoidal endothelial cell.

Table IV.

Quantitation of hepatic sinusoidal endothelial cell fenestrae.

Table IV.

Quantitation of hepatic sinusoidal endothelial cell fenestrae.

GroupNumber of fenestrae
1 (n=7)7.43±0.98
2 (n=8)2.38±0.91
3 (n=8) 4.75±0.71a
4 (n=8) 3.88±0.64a

a P<0.01 vs. group 2.

Vatalanib was associated with decreased collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 mRNA levels

mRNA expression levels of collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 were increased in group 2 compared with group 1 (P<0.01; Fig. 4). mRNA levels were reduced in groups 3 and 4 compared with group 2 (P<0.01).

Figure 4.

Vatalanib inhibits mRNA expression levels of collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 in fibrotic mice. mRNA expression of collagen I, α-SMA, TGF-β1, VEGFR1 and VEGFR2 were determined by reverse transcription-quantitative polymerase chain reaction in the livers treated with or without vatalanib. Data were normalized to the internal control (GAPDH) and are expressed as the mean ± standard deviation. *P<0.01 vs. CCl4 group. α-SMA, α-smooth muscle actin; TGF-β1, transforming growth factor-β1; VEGFR, vascular endothelial growth factor receptor; CCl4, carbon tetrachloride.

Discussion

Intrahepatic hypoxia may occur during the liver inflammatory and fibrotic processes that characterize several chronic liver diseases (26). As a consequence, intrahepatic vascular angiogenesis and sinusoidal remodeling may occur in these chronic liver diseases (8,26). In previous years, numerous studies have examined the expression of various anti-angiogenic molecules in chronic liver disease (26). Among these molecules, VEGF and its receptors are of the most important, and have been fully studied in terms of their roles in liver inflammation and fibrosis (26,27). Anti-VEGF treatment may represent a potential therapeutic approach in liver fibrosis and portal hypertension (10,28).

Vatalanib has been previously identified to specifically block VEGF-induced phosphorylation of VEGFR-1, −2 and −3 and inhibit endothelial cell proliferation, differentiation and tumor angiogenesis (29). It is considered safe for patients in previous cancer studies (30,31). The most common grade 3 and 4 non-hematological toxicities are mucositis and alopecia (17,18,32).

In addition, Liu et al (20) investigated the role of vatalanib in CCl4-induced mice. They identified that vatalanib decreases liver fibrosis in a CCl4-induced liver fibrosis model. This result is consistent with current findings. However, they examined the effect of vatalanib in liver fibrosis and HSCs, not SECs. The present study examined the effects of vatalanib on the number of hepatic SEC fenestrae, and levels of VEGFR in liver tissues. The results suggested that vatalanib may exert its effects via the VEGF signaling pathway. The present results reinforced the concept that angiogenesis has a major role in liver fibrogenesis (8,10,33,34).

The underlying molecular mechanism by which vatalanib decreases liver injury remains unknown. It has been demonstrated that, in primary HSCs, vatalanib decreases the levels of α-SMA, collagen, tissue inhibitor of metalloproteinase-1, and reduces cell proliferation, migration and actin filament formation. This effect was associated with inhibition of VEGF, PDGF and TGF-β1 signaling and their downstream target, protein kinase B (35). In the current study, vatalanib was identified to inhibit TGF-β1, VEGFR1 and VEGFR2.

Dysfunction of SECs is likely to be one of the initial events in liver injury (36). Defenestration and capillarization of the sinusoidal endothelium may be major contributors to hepatic failure in hepatic cirrhosis (36). Two studies from 2010 suggested that intrahepatic angiogenesis and sinusoidal remodeling may be involved in sinusoidal resistance, fibrosis and portal hypertension (11,37). In the present study, vatalanib altered the SEC phenotype, leading to decreased sinusoidal capillarization. Microvilli disappearance, inflammation, hepatocyte necrosis and bile duct alterations were decreased in all vatalanib-treated groups. These results indicated that anti-angiogenic agents may inhibit SECs, and that they may be involved in sinusoidal capillarization and hepatocyte damage. SECs may be potential target cells in the inhibition of this process. Furthermore, it is understood that paracrine signaling between SECs and HSCs regulates fibrogenesis, angiogenesis and portal hypertension in chronic liver disease (8,9,14,38). In the present study, the underlying mechanism of vatalanib on SECs was not addressed. Therefore, the nature of the interactions between SECs and HSCs in chronic liver disease following vatalanib treatment requires further investigation.

In conclusion, vatalanib treatment was associated with decreased hepatic sinusoidal capillarization, hepatocyte damage and liver fibrosis in CCl4-induced fibrotic mice. Vatalanib may represent a potential therapeutic agent for counteracting hepatic fibrosis.

Acknowledgements

The present study was supported by the Natural Science Foundation of Heilongjiang Province of China (grant no. H2015099).

Glossary

Abbreviations

Abbreviations:

TGF-β

transforming growth factor-β

HSC

hepatic stellate cell

α-SMA

α-smooth muscle actin

VEGF

vascular endothelial growth factor

VEGFR

vascular endothelial growth factor receptor

ALT

alanine aminotransferase

AST

aspartate aminotransferase

TBIL

total bilirubin

TEM

transmission electron microscopy

References

1 

Friedman SL: Cellular networks in hepatic fibrosis. Digestion. 59:368–371. 1998. View Article : Google Scholar : PubMed/NCBI

2 

Friedman SL: Hepatic fibrosis-overview. Toxicology. 254:120–129. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Ghiassi-Nejad Z and Friedman SL: Advances in antifibrotic therapy. Expert Rev Gastroenterol Hepatol. 2:803–816. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Jiao J, Friedman SL and Aloman C: Hepatic fibrosis. Curr Opin Gastroenterol. 25:223–229. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Friedman SL: Liver fibrosis: From mechanisms to treatment. Gastroenterol Clin Biol. 31:812–814. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Friedman SL and Bansal MB: Reversal of hepatic fibrosis-fact or fantasy? Hepatology. 43:(2 Suppl 1). S82–S88. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Ferrara N and Davis-Smyth T: The biology of vascular endothelial growth factor. Endocr Rev. 18:4–25. 1997. View Article : Google Scholar : PubMed/NCBI

8 

Coulon S, Heindryckx F, Geerts A, Van Steenkiste C, Colle I and Van Vlierberghe H: Angiogenesis in chronic liver disease and its complications. Liver Int. 31:146–162. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Fernández M, Semela D, Bruix J, Colle I, Pinzani M and Bosch J: Angiogenesis in liver disease. J Hepatol. 50:604–620. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Lai WK and Adams DH: Angiogenesis and chronic inflammation; The potential for novel therapeutic approaches in chronic liver disease. J Hepatol. 42:7–11. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Thabut D and Shah V: Intrahepatic angiogenesis and sinusoidal remodeling in chronic liver disease: New targets for the treatment of portal hypertension? J Hepatol. 53:976–980. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Mejias M, Garcia-Pras E, Tiani C, Miquel R, Bosch J and Fernandez M: Beneficial effects of sorafenib on splanchnic, intrahepatic and portocollateral circulations in portal hypertensive and cirrhotic rats. Hepatology. 49:1245–1256. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Majumder S, Piguet AC, Dufour JF and Chatterjee S: Study of the cellular mechanism of Sunitinib mediated inactivation of activated hepatic stellate cells and its implications in angiogenesis. Eur J Pharmacol. 705:86–95. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Thabut D, Routray C, Lomberk G, Shergill U, Glaser K, Huebert R, Patel L, Masyuk T, Blechacz B, Vercnocke A, et al: Complementary vascular and matrix regulatory pathways underlie the beneficial mechanism of action of sorafenib in liver fibrosis. Hepatology. 54:573–585. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Chen J, Liu DG, Yang G, Kong LJ, Du YJ, Wang HY, Li FD, Pei FH, Song JT, Fan YJ, et al: Endostar, a novel human recombinant endostatin, attenuates liver fibrosis in CCl4-induced mice. Exp Biol Med (Maywood). 239:998–1006. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Jones SF, Spigel DR, Yardley DA, Thompson DF and Burris HA III: A phase I trial of vatalanib (PTK/ZK) in combination with bevacizumab in patients with refractory and/or advanced malignancies. Clin Adv Hematol Oncol. 9:845–852. 2011.PubMed/NCBI

17 

Thomas AL, Morgan B, Drevs J, Unger C, Wiedenmann B, Vanhoefer U, Laurent D, Dugan M and Steward WP: Vascular endothelial growth factor receptor tyrosine kinase inhibitors: PTK787/ZK 222584. Semin Oncol. 30:(3 Suppl 6). S32–S38. 2003. View Article : Google Scholar

18 

Yau T, Chan P, Pang R, Ng K, Fan ST and Poon RT: Phase 1–2 trial of PTK787/ZK222584 combined with intravenous doxorubicin for treatment of patients with advanced hepatocellular carcinoma: Implication for antiangiogenic approach to hepatocellular carcinoma. Cancer. 116:5022–5029. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Yang Y, Jin L, He YL, Wang K, Ma XH, Wang J, Yan Z, Feng YL, Li YQ, Chen TY, et al: Hepatitis B virus infection in clustering of infection in families with unfavorable prognoses in northwest China. J Med Virol. 85:1893–1899. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Liu Y, Lui EL, Friedman SL, Li L, Ye T, Chen Y, Poon RT, Wo J, Kok TW and Fan ST: PTK787/ZK22258 attenuates stellate cell activation and hepatic fibrosis in vivo by inhibiting VEGF signaling. Lab Invest. 89:209–221. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Wang H, Zhang Y, Wang T, You H and Jia J: N-methyl-4-isoleucine cyclosporine attenuates CCl-induced liver fibrosis in rats by interacting with cyclophilin B and D. J Gastroenterol Hepatol. 26:558–567. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Liu Y, Poon RT, Li Q, Kok TW, Lau C and Fan ST: Both antiangiogenesis- and angiogenesis-independent effects are responsible for hepatocellular carcinoma growth arrest by tyrosine kinase inhibitor PTK787/ZK222584. Cancer Res. 65:3691–3699. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Xu H, Shi BM, Lu XF, Liang F, Jin X, Wu TH and Xu J: Vascular endothelial growth factor attenuates hepatic sinusoidal capillarization in thioacetamide-induced cirrhotic rats. World J Gastroenterol. 14:2349–2357. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Elpek GÖ, Unal B and Bozova S: H-ras oncogene expression and angiogenesis in experimental liver cirrhosis. Gastroenterol Res Pract. 2013:8689162013. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Medina J, Arroyo AG, Sánchez-Madrid F and Moreno-Otero R: Angiogenesis in chronic inflammatory liver disease. Hepatology. 39:1185–1195. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Calderone V, Gallego J, Fernandez-Miranda G, Garcia-Pras E, Maillo C, Berzigotti A, Mejias M, Bava FA, Angulo-Urarte A, Graupera M, et al: Sequential functions of CPEB1 and CPEB4 regulate pathologic expression of vascular endothelial growth factor and angiogenesis in chronic liver disease. Gastroenterology. 150:982–997.e30. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Fernandez M, Vizzutti F, Garcia-Pagan JC, Rodes J and Bosch J: Anti-VEGF receptor-2 monoclonal antibody prevents portal-systemic collateral vessel formation in portal hypertensive mice. Gastroenterology. 126:886–894. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Schomber T, Zumsteg A, Strittmatter K, Crnic I, Antoniadis H, Littlewood-Evans A, Wood J and Christofori G: Differential effects of the vascular endothelial growth factor receptor inhibitor PTK787/ZK222584 on tumor angiogenesis and tumor lymphangiogenesis. Mol Cancer Ther. 8:55–63. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Kircher SM, Nimeiri HS and Benson AB III: Targeting angiogenesis in colorectal cancer: Tyrosine kinase inhibitors. Cancer J. 22:182–189. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Dragovich T, Laheru D, Dayyani F, Bolejack V, Smith L, Seng J, Burris H, Rosen P, Hidalgo M, Ritch P, et al: Phase II trial of vatalanib in patients with advanced or metastatic pancreatic adenocarcinoma after first-line gemcitabine therapy (PCRT O4-001). Cancer Chemother Pharmacol. 74:379–387. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Langenberg MH, Witteveen PO, Lankheet NA, Roodhart JM, Rosing H, van den Heuvel IJ, Beijnen JH and Voest EE: Phase 1 study of combination treatment with PTK 787/ZK 222584 and cetuximab for patients with advanced solid tumors: Safety, pharmacokinetics, pharmacodynamics analysis. Neoplasia. 12:206–213. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Vanheule E, Geerts AM, Van Huysse J, Schelfhout D, Praet M, Van Vlierberghe H, De Vos M and Colle I: An intravital microscopic study of the hepatic microcirculation in cirrhotic mice models: Relationship between fibrosis and angiogenesis. Int J Exp Pathol. 89:419–432. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Ferrara N and Kerbel RS: Angiogenesis as a therapeutic target. Nature. 438:967–974. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Liu Y, Wen XM, Lui EL, Friedman SL, Cui W, Ho NP, Li L, Ye T, Fan ST and Zhang H: Therapeutic targeting of the PDGF and TGF-beta-signaling pathways in hepatic stellate cells by PTK787/ZK22258. Lab Invest. 89:1152–1160. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Braet F and Wisse E: Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: A review. Comp Hepatol. 1:12002. View Article : Google Scholar : PubMed/NCBI

37 

Huebert RC, Jagavelu K, Liebl AF, Huang BQ, Splinter PL, LaRusso NF, Urrutia RA and Shah VH: Immortalized liver endothelial cells: A cell culture model for studies of motility and angiogenesis. Lab Invest. 90:1770–1781. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Friedman SL: Preface. Hepatic fibrosis: Pathogenesis, diagnosis and emerging therapies. Clin Liver Dis. 12:xiii–xiv. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kong LJ, Li H, Du YJ, Pei FH, Hu Y, Zhao LL and Chen J: Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice. Mol Med Rep 15: 2604-2610, 2017.
APA
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., & Chen, J. (2017). Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice. Molecular Medicine Reports, 15, 2604-2610. https://doi.org/10.3892/mmr.2017.6325
MLA
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., Chen, J."Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice". Molecular Medicine Reports 15.5 (2017): 2604-2610.
Chicago
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., Chen, J."Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice". Molecular Medicine Reports 15, no. 5 (2017): 2604-2610. https://doi.org/10.3892/mmr.2017.6325
Copy and paste a formatted citation
x
Spandidos Publications style
Kong LJ, Li H, Du YJ, Pei FH, Hu Y, Zhao LL and Chen J: Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice. Mol Med Rep 15: 2604-2610, 2017.
APA
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., & Chen, J. (2017). Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice. Molecular Medicine Reports, 15, 2604-2610. https://doi.org/10.3892/mmr.2017.6325
MLA
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., Chen, J."Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice". Molecular Medicine Reports 15.5 (2017): 2604-2610.
Chicago
Kong, L., Li, H., Du, Y., Pei, F., Hu, Y., Zhao, L., Chen, J."Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice". Molecular Medicine Reports 15, no. 5 (2017): 2604-2610. https://doi.org/10.3892/mmr.2017.6325
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team