Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3

  • Authors:
    • Zuowen Liang
    • Hongliang Wang
    • Baofeng Guo
    • Fubiao Li
    • Jinsha Liu
    • Zhewen Liu
    • Libo Xu
    • Wenjing Yun
    • Xuejian Zhao
    • Ling Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Andrology, First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China, Department of Plastic Surgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130031, P.R. China, Department of Pathophysiology, College of Basic Medicine, Jilin University, Changchun, Jilin 130021, P.R. China
  • Pages: 459-465
    |
    Published online on: May 16, 2017
       https://doi.org/10.3892/mmr.2017.6583
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study investigated the effect of signal transducer and activator of transcription 3 (Stat3) interference on RM1 prostate cancer cell viability in vitro, using plasmid‑based Stat3 specific short hairpin RNA (sh‑Stat3) delivered by hydroxyapatite nanoparticles (HAP). HAP carrying sh‑Stat3 plasmids were transfected into tumor cells. MTT assays were used to measure RM1 cell viability 24 and 48 h following transfection, and the apoptosis rate and cell cycle phase distribution were determined by flow cytometry. Stat3 mRNA expression levels were measured by reverse transcription‑quantitative polymerase chain reaction and Stat3, Cyclin D1, B cell lymphoma 2 apoptosis regulator (Bcl‑2), vascular endothelial growth factor (VEGF), Bcl‑2 associated X apoptosis regulator (Bax) and cleaved‑caspase‑3 protein expression levels were detected using western blot analysis. The results demonstrated that HAP‑delivered sh‑Stat3 significantly decreased RM1 cell viability through the promotion of cell cycle arrest and apoptosis. Stat3 mRNA and protein expression levels were significantly downregulated in RM1 cells. Bcl‑2, VEGF and Cyclin D1 were also significantly downregulated, but cleaved‑caspase‑3 and Bax mRNA and protein expression levels were significantly upregulated. HAP‑delivered sh‑Stat3 decreased RM1 cell viability in vitro, and HAP assisted plasmid‑based delivery of shRNA into tumor cells. The present results suggest that HAP may be a useful method for successful shRNA delivery into tumors.

Introduction

Hydroxyapatite (HA; Ca10(PO4)6(OH)2) is a major component of hard tissues such as tooth and bone (1) and has been used as a biomaterial in multiple applications, including tissue engineering and bone repair (2). HA has been used effectively as a carrier for bioactive molecules, including proteins and DNA, as its biocompatible and porous properties allow it to deliver proteins and genes into cells (3). Previous research has focused on the application of HA as a treatment for bone-associated diseases (4), but research regarding the use of HA as a drug delivery system (DDS) in other tissues remains scarce. One disadvantage associated with the use of HA for DDS is low dispersal in water, making the formulation of a drug-loaded HA treatment of particular importance for development of HA as a DDS. The rise of nanotechnology has provided novel tools and methods for the study of gene carriers. Among these, calcium phosphate nanoparticles have emerged as a vector for nonviral gene delivery (5,6). Hydroxyapatite nanoparticles (HAP) containing pEGFP-N1 plasmids have been reported to transport DNA into gastric cancer cells without any considerable cytotoxicity (7). Tan et al (8) demonstrated that HAP with protamine enhances the efficiency of gene transfection. Sun et al (9) used HAP to deliver the neurotrophin-3 (NT-3) gene into the cochlear neurons of guinea pigs both in vitro and in vivo, and further demonstrated that polyethylenimine-induced surface alteration of HAP permitted specific genetic materials to pass through intact round window membranes in chinchillas with low toxicity and high transfection efficiency (10). Yan-Zhong et al (11) used arginine-modified nanohydroxyapatite to modify the surface charge of HAP and demonstrated an enhanced adsorption capacity in human epithelial cells. CaCl2-modified HAP has also been previously demonstrated to mediate the transfection of small interfering (si-)signal transducer and activator of transcription 3 (Stat3) plasmids into murine prostate cancer cells in vivo, resulting in significant inhibition of cancer growth (12). These previous studies demonstrate that HAP may be a safe and effective gene vector with potential clinical applications.

RNA interference (RNAi) is a method of post-transcriptional gene silencing. Short hairpin RNA (shRNA) has previously been recognized as a promising novel antitumor strategy (13), but the efficient delivery of shRNA remains a challenge for shRNA-based therapies. Nanomedicine is an emerging field that combines medicine with nanotechnology, and nanoparticles have been used as diagnostic probes in targeted therapies. Hydroxyapatite has been used as a novel biomaterial to treat oral cavities and enhance bone repair, and as a medicine carrier possesses good tissue compatibility both in vivo and in vitro (14,15). Compared with viral vectors, which pose the danger of immunogenicity and pathogenicity, HAP has high osteoconductivity and favorable biocompatibility, and/or osteoinductivity without proinflammatory or immunogenic side effects (16–18). HAP inhibits tumor cell growth directly (19), and is a useful gene delivery system due to its efficiency, safety and economy (12).

DNA vector-based Stat3-specific RNAi (sh-Stat3) silences Stat3 and inhibits prostate tumor development (13). However, this antitumor activity depends on the efficiency of delivery. The present study examined the effect of hydroxyapatite-transported sh-Stat3 on the growth of murine prostate cancer cells. A previous study demonstrated that sh-Stat3 significantly suppresses Stat3 expression and inhibits prostate cancer cell growth (12). In the present study, HAP was used to deliver DNA-vector-based sh-Stat3 to treat prostate cancer in vitro, and the in vitro antitumor effects and mechanisms were examined to provide a theoretical basis for future clinical use.

Materials and methods

Materials

The mouse prostate cancer cell line RM1 was purchased from the Shanghai Institute of Cellular Research (Shanghai, China). The cells were cultured in Iscove's modified Dulbecco's medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 IU/ml penicillin and 100 µg/ml streptomycin in a humid atmosphere (37°C, 5% CO2, 95% air). Plasmids containing sh-Stat3 (sequence GCAGCAGCTGAACAACATG, corresponding to nucleotides 2,144 to 2,162; Genbank accession no. NM_003150) were constructed in situ. According to previous research, the sh-Stat3 most effective at inhibiting cancer growth is located at the SH2 domain of the mouse and human Stat3 genes (20). A negative control scrambled shRNA sequence (sh-scramble; Ambion; Thermo Fisher Scientific, Inc.) lacking homology to mouse or human gene sequences was used to determine the frequency of nonspecific effects. HAP nanoparticles were purchased from Nanjing Emperor Nano Material Co., Ltd. (Nanjing, China).

Cell culture, transfection and measurement of cell growth

Cell cultures, HAP and transfection plasmids were prepared as previously described (12). For transfection, RM1 cells in the logarithmic growth phase were seeded in 12-well plates (1×105 cells/well). When the cells reached 50% confluence, they were transfected with sh-Stat3 (HAP/sh-Stat3 group) or sh-scramble (HAP/sh-scramble group) plasmids, delivered with HAP, for 48–72 h prior to analysis of mRNA and protein levels, cell apoptosis and viability. As controls, untransfected cells (mock) and cells treated with HAP alone (HAP group) were also used.

Cell viability following plasmid treatment was measured by MTT assay. RM1 cells were seeded in 96-well plates and incubated at 37°C for 24 and 48 h in the presence of sh-Stat3 or sh-scramble plasmids. Then, 10 ml of MTT (Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) at a concentration of 5 mg/ml in phosphate buffered saline (PBS) was added to each well, and incubated for 4 h at 37°C. Following removal of the culture medium, the formazan crystals were solubilized in 100 µl dimethyl sulfoxide (Sigma-Aldrich; Merck Millipore) and shaken for 15 min. Absorption was measured at 570 nm on a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Each assay was performed nine times.

Apoptosis and cell cycle assessment

RM1 cells (1×106 cells per well) were treated with shRNA-Stat3 and scramble shRNA plasmids for up to 48 h, collected, and resuspended in 100 µl PBS, and incubated at room temperature for 5–15 min in the dark with 5 µl Annexin V-fluorescein isothiocyanate (eBioscience; Thermo Fisher Scientific, Inc.), then with 5 µl propidium iodide (PI; Beckman Coulter, Fullerton, CA, USA) for 30 min at room temperature in the dark. Flow cytometry was performed to measure apoptosis rates, using an Epics-XL-MCL flow cytometer (Beckman Coulter, Inc.). Data was analyzed using FlowJo v10 software (Tree Star, Inc., Ashland, OR, USA).

Cell cycle distribution was analyzed by measuring the DNA fragments stained with PI. RM1 cells (1×106) grown in 6-well plates were harvested and centrifuged 48 h following transfection. Cells were counted and washed twice with pre-cooled PBS. Then, cells were fixed and permeabilized overnight by adding 1 ml of 70% (v/v) pre-cooled ethanol to each tube at 4°C. Following centrifugation at 3,000 × g for 5 min, the fixatives were decanted and 1×106 cells were resuspended in 0.5 ml staining solution, containing 50 µg/ml PI and 100 µg/ml DNase-free RNase (Sigma-Aldrich; Merck Millipore) and incubated for 30 min at room temperature in the dark. Finally, cells were analyzed by flow cytometry using a FACScan™ system (BD Biosciences, San Jose, CA, USA) and data analysed using CellQuest™ software (version 3.3; BD Biosciences).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

The mRNA expression level of Stat3 and Stat3 downstream genes was determined using semi quantitative RT-PCR. Cells treated with sh-Stat3 or sh-scramble were collected following 48 h incubation, and total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Reverse transcription was performed with 2 µg of total RNA using a commercially available RT-PCR kit (cat. no. A4051; Promega Corporation, Madison, WI, USA) according to the manufacturer's instructions, following DNAse I (cat. no. D5025-15KU; Sigma-Aldrich; Merck Millipore) treatment. The primers used for PCR are displayed in Table I. Each reaction (20 µl samples) was carried out under the following cycling conditions: Initialization for 10 min at 95°C and then 40 cycles of amplification, with 15 sec at 95°C for denaturation and 1 min at 60°C for annealing and elongation. A standard curve was plotted for each primer probe, established by using a serial dilution of pooled cDNA from cells. All standards and samples were conducted in triplicate, normalised to β-actin, and relative fold changes in mRNA expression were calculated using the formula 2-ΔΔCq (21).

Table I.

Primer sets used for semi quantitative reverse transcription polymerase chain reaction analysis.

Table I.

Primer sets used for semi quantitative reverse transcription polymerase chain reaction analysis.

Target geneSequence (5′-3′)Accession number
β-actinForward: CTGAGAGGGAAATCGTGCGT
Reverse: AACCGCTCGTTGCCAATAGTNM_007393
Stat3Forward: ACCAGCAATATAGCCGATTCC
Reverse: CCATTGGCTTCTCAAGATACCNM_011486
Bcl-2Forward: TCGCAGAGATGTCCAGTCA
Reverse: CACCGAACTCAAAGAAGGCNM_009741
BaxForward: AGGGTTTCATCCAGGATCGAGC
Reverse: AGGCGGTGAGGACTCCAGCCNM_007527
Caspase3Forward: TGGACTGTGGCATTGAGAC
Reverse: AGGAATAGTAACCAGGTGCTGNM_009810
VEGFForward: ATCTTCAAGCCGTCCTGTG
Reverse: TGGTGATGTTGCTCTCTGACNM_009505
Cyclin D1Forward: TCATTTCCAACCCACCCT
Reverse: GGCTTCAATCTGTTCCTGGNM_007631

[i] Stat3, signal transducer and activator of transcription 3; Bcl-2, B cell lymphoma 2 apoptosis regulator; Bax, Bcl-2 associated X apoptosis regulator; VEGF, vascular endothelial growth factor.

Western blot analysis

Cell lysis, protein quantification and western blot assays were performed as previously described (22). Primary antibodies (1:1,000 dilution) targeting Stat3 (cat. no. sc-482), phospho (p-)Tyr705-Stat3 (cat. no. sc-7993), Cyclin D1 (cat. no. sc-450), vascular endothelial growth factor (VEGF; cat. no. sc-152) and β-actin (cat. no. sc-32251) were obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Primary antibodies targeting B cell lymphoma 2 apoptosis regulator (Bcl-2; cat. no. 2876s), Bcl-2 associated X apoptosis regulator (Bax; cat. no. 2772s) and cleaved (c-)caspase3 (cat. no. 9661L) were obtained from Cell Signalling Technology, Inc. (Danvers, MA, USA). Protein bands were visualized using SuperSignal West Pico chemiluminescent substrate (Pierce; Thermo Fisher Scientific, Inc.), and membranes were subjected to X-ray autoradiography. Band intensities were determined with the Quantity One software (v4.2.1; Bio-Rad Laboratories, Inc.). All experiments were performed in triplicate.

Statistical analysis

Quantitative data were expressed as the mean ± standard error of the mean. Statistical analysis was performed with SPSS version 13.0 (SPSS Inc., Chicago, IL, USA), and one-way analysis of variance followed by Tukey's test was used to compare the differences between groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Stat3 expression

To calculate the ability of HAP-delivered plasmids to silence Stat3 expression, RT-qPCR and western blot assays were used to analyze Stat3 mRNA and protein expression levels, respectively, in RM1 cells. The results demonstrated that Stat3 mRNA expression was significantly decreased in HAP/sh-Stat3-transfected RM1 cells compared with cells transfected with HAP/sh-scramble (P<0.01; Table II). Stat3 and p-Stat3 protein levels were also significantly decreased in HAP/sh-Stat3-transfected RM1 cells compared with RM1 cells transfected with HAP/sh-scramble (P<0.01; Fig. 1).

Figure 1.

Western blot analysis of Stat3 and p-Stat3 protein in RM1 cells transfected with sh-Stat3, with quantification relative to β-actin. *P<0.01 vs. scramble control. Stat3, signal transducer and activator of transcription 3; p-, phosphorylated; sh-Stat3, Stat-3 specific short hairpin RNA; HAP, hydroxyapatite nanoparticles; sh-scramble, scramble short hairpin RNA.

Table II.

Reverse transcription-quantitative polymerase chain reaction analysis of Stat3, Bcl-2, Bax, Caspase3, VEGF and Cyclin D1 mRNA expression levels, relative to the Mock group.

Table II.

Reverse transcription-quantitative polymerase chain reaction analysis of Stat3, Bcl-2, Bax, Caspase3, VEGF and Cyclin D1 mRNA expression levels, relative to the Mock group.

Transcripts

Group (n=3)Stat3Bcl-2BaxCaspase3VEGFCyclin D1
Mock111111
HAP0.84±0.070.77±0.061.03±0.191.49±0.170.96±0.01 0.41±0.01a
HAP/sh-scramble0.58±0.07   0.14±0.02a1.70±0.24   3.16±0.23a0.81±0.02 0.34±0.01a
HAP/sh-Stat3   0.25±0.02b   0.14±0.01   4.2±0.38b   9.05±0.74b   0.11±0.009b 0.06±0.005b

a P<0.01 vs. Mock group

b P<0.01 vs. HAP/sh-scramble. Stat3, signal transducer and activator of transcription 3; Bcl-2, B cell lymphoma 2 apoptosis regulator; Bax, Bcl-2 associated X apoptosis regulator; VEGF, vascular endothelial growth factor; HAP, hydroxyapatite nanoparticles; sh-scramble, scramble short hairpin RNA, sh-Stat3, Stat3 specific short hairpin RNA.

HAP-delivered sh-Stat3 treatment decreases cell viability in RM1 cells

Cell viability in the HAP/sh-Stat3 group was significantly inhibited compared with the HAP/sh-scramble and Mock groups at 24 h (P<0.01 and P<0.01, respectively; Fig. 2) and at 48 h (P<0.01 and P<0.01, respectively; Fig. 2). However, HAP, HAP/sh-scramble and HAP/sh-Stat3 transfection all reduced cell viability at 48 h compared with the Mock group; with growth inhibition rates of 12.41±0.74, 13.98±3.12 and 44.40±1.13%, respectively (Fig. 2).

Figure 2.

RM1 cell viability in response to transfection with HAP-delivered sh-Stat3, evaluated with MTT assay. Data are presented as the inhibition ratio to 24 h Mock control. *P<0.01 vs. Mock, #P<0.01 vs. HAP and HAP/sh-scramble. HAP, hydroxyapatite nanoparticles; sh-Stat3, signal transducer and activator of transcription 3-specific short hairpin RNA; sh-scramble, scramble short hairpin RNA.

HAP-delivered sh-Stat3 treatment results in G1 arrest and increased apoptosis in RM1 cells

Treatment with HAP-delivered sh-Stat3 induced significantly increased levels of apoptosis in RM1 cells compared with HAP-sh-scramble cells, HAP-only cells and Mock control cells (P<0.01, P<0.01 and P<0.01, respectively; Fig. 3 and Table III). To determine whether this was associated with specific modifications in the cell cycle, cell cycle analysis was performed in RM1 cells transfected with sh-Stat3 or sh-scramble. HAP/sh-Stat3-treated cells were significantly accumulated in the G1 phase compared with Mock treated cells (P<0.01; Table III), indicating that sh-Stat3 treatment promotes G1 arrest. Overall, these findings demonstrate that Stat3 treatment decreases the viability and survival rate of RM1 prostate cancer cells.

Figure 3.

Effect of HAP-delivered sh-Stat3 treatment on apoptosis in RM1 cells. The bottom right quadrant primarily displays early apoptotic cells (Annexin+/PI−); the top right quadrant, late apopototic cells (Annexin+/PI+); the top left quadrant, necrotic cells (Annexin−/PI+); and the bottom left quadrant, live cells (Annexin−/PI−). HAP, hydroxyapatite nanoparticles; sh-Stat3, signal transducer and activator of transcription 3-specific short hairpin RNA; PI, propidium iodide; FITC, fluorescein isothiocyanate; sh-scramble, scramble short hairpin RNA.

Table III.

Effect of HAP-delivered sh-Stat3 plasmids on apoptosis and the cell cycle in RM1 cells.

Table III.

Effect of HAP-delivered sh-Stat3 plasmids on apoptosis and the cell cycle in RM1 cells.

Group (n=3)Apoptotic cells (sum of Q2+Q4 quadrants in Fig. 3) %G0-G1, %S, %
Mock6.4±0.9844.5±3.1455.5±3.14
HAP 15.2±0.74a44.4±2.5951.6±3.33
HAP/sh-scramble 17.3±0.97a46.9±3.9550.1±2.58
HAP/sh-Stat3 39.2±0.74b   66.7±3.99a   24.8±3.62a

a P<0.01 vs. mock group

b P<0.01 vs. HAP/sh-scramble. Data are presented as the mean ± standard deviation. HAP, hydroxyapatite nanoparticles; sh-scramble, scramble short hairpin RNA; sh-Stat3, signal transducer and activator of transcription 3 specific short hairpin RNA.

Expression levels of Stat3-associated genes

Previous studies have indicated that Stat3 induces the expression of multiple genes, including the anti-apoptotic protein Bcl-2 and Cyclin D1, which promotes cell division (22). To determine the effect of sh-Stat3 treatment on the expression of Stat3-associated genes, RT-qPCR and western blot assays were performed. The results demonstrated that in HAP/sh-Stat3 treated cells compared with Mock treated cells, Bcl-2, VEGF and Cyclin D1 mRNA expression levels were significantly decreased (P<0.01, P<0.01 and P<0.01, respectively; Table II) and protein expression levels also significantly decreased compared with HAP/sh-scramble treated cells (P<0.01, P<0.01 and P<0.01, respectively; Fig. 4). However, caspase3 and Bax levels were significantly increased in HAP/sh-Stat3 treated cells compared with controls (mRNA expression levels, P<0.01 and P<0.01, respectively; Table II; protein expression levels, P<0.01 and P<0.01, respectively; Fig. 4). These results indicate that treatment with HAP-delivered sh-Stat3 interferes with the transcriptional activity of Stat3 and alters the expression of its downstream genes.

Figure 4.

Western blot analysis of Bcl-2, Bax, Caspase3, VEGF and Cyclin D1 protein expression in RM1 cells transfected with HAP-delivered sh-Stat3S. *P<0.01 vs. scramble control with quantification relative to β-actin. Bcl-2, B cell lymphoma 2 apoptosis regulator; Bax, Bcl-2 associated X apoptosis regulator; VEGF, vascular endothelial growth factor; HAP, hydroxyapatite nanoparticles; sh-Stat3, signal transducer and activator of transcription 3-specific short hairpin RNA; sh-scramble, scramble short hairpin RNA.

Discussion

Prostate cancer is the second most frequently diagnosed cancer and the sixth leading cause of cancer-associated mortality in men worldwide (23,24). Despite advances in surgical techniques and radiotherapy, prostate cancer continues to pose a medical challenge, with gaining an in-depth understanding of its molecular pathogenesis and the development of novel therapeutic options being of significant importance to global health. As prostate cancer represents an accumulation of genetic mutations in cells and resultant altered function, a potential novel treatment for this cancer is gene therapy (25).

Stat3 is a transcription factor encoded by the STAT3 gene in humans. It is a member of the STAT protein family, which mediates multiple cellular functions including immunity, proliferation, apoptosis and differentiation. Elevated Stat3 activity has been previously observed in primary tumor tissues and prostate cancer cell lines, and is correlated with tumorigenesis (26). Notably, abnormal Stat3 activation is associated with prostate cancer progression (27). Constitutive activation of Stat3 signalling represents one of the key molecular events in the multistep process of carcinogenesis, and inhibition of Stat3 activation is a potential therapeutic strategy for anti-tumor therapy (28).

In a previous study, DNA vector-based Stat3-specific RNAi was demonstrated to decrease Stat3 signalling (13). However, the efficacy of shRNA-mediated interference relies on efficient delivery of shRNA oligonucleotides and the major weaknesses that limit most delivery systems' wide application are the potential for oncogenesis or mutagenesis, host immune responses, and high cost (29). Nonviral shRNA delivery does not elicit an immune response, demonstrates improved drug target validation and permits multiple administrations of shRNA, an essential attribute for the therapeutic application of shRNA. Sun et al (9) used HAP as a novel vector for inner ear gene therapy, and previous results have demonstrated that Ca2+ modified HAP mediates sh-Stat3 plasmid transfection into mouse prostate cancer cells in vivo and in vitro, causing significant inhibition of cancer growth (12). This supported previous reports which demonstrated HAP transfection efficiency reaches ~50–80% of liposome-mediated transfection (30). The present study revealed that HAP alone exerted antitumor effects: HAP carrying sh-scramble inhibited cancer cell proliferation compared with control, although this inhibition was much stronger when HAP was combined with sh-Stat3. The mechanisms may be related to the intrinsic properties of nanoparticles, and need further research. This result was consistent with the study of Zhu et al (30), in which treatment with HAP alone inhibited hepatocellular carcinoma cell proliferation in vitro. Therefore, the antitumor effect of HAP may be further improved while combined with sh-Stat3.

In the present study, the involvement of Stat3 in promoting prostate cancer cells proliferation in vitro was confirmed. Stat3 mRNA and protein expression levels were down-regulated in RM1 cells following sh-Stat3 treatment, implying that HAP transports sh-Stat3 into cancer cells, resulting in the inhibition of Stat3 expression levels. These findings demonstrate that the HAP that carried sh-Stat3 exerts a potent antitumor effect in vitro through decreasing cell viability and the promotion of apoptosis. The data displayed in Table II suggest that inhibition of cancer cell viability was due to a combination of cell cycle arrest and activation of apoptosis. Furthermore, the expression of pro-apoptotic factors including caspase3 and Bax were significantly upregulated in the sh-Stat3 group, while anti-apoptotic factors such as Cyclin D1 and Bcl-2 were significantly downregulated. Previous studies have revealed that Stat3 upregulates several anti-apoptotic proteins' expression, including Bcl-2 and B cell lymphoma-extra large (Bcl-xL) (31), which are key components of mitochondrial apoptotic pathways. Therefore, sh-Stat3 transfection-induced apoptosis of cancer cells may partially result from the activation of mitochondrial apoptosis pathways (32). Additionally, western blot assays revealed that VEGF expression levels in cancer cells were significantly decreased following sh-Stat3 transfection. Reduced VEGF levels resulting from Stat3 knockdown were expected because VEGF expression has been previously demonstrated to be upregulated by Stat3 (33).

The present study confirmed that HAP is a useful vector for plasmid-based shRNA delivery into cancer cells in vitro, with the proliferation of RM1 cancer cells inhibited by the HAP-delivered sh-Stat3. These findings suggest the potential of HAP as an effective gene delivery vehicle for shRNA-based cancer therapy. However, further modification of HAP is required to enhance transfection efficacy and expedite clinical applications. In conclusion, nanoparticle-mediated sh-Stat3 delivery has potential clinical applications for the treatment of prostate cancers.

Acknowledgements

The present study was funded by the National Natural Science Foundation of China (grant nos. 81201188 and 81472344).

References

1 

Do TN, Lee WH, Loo CY, Zavgorodniy AV and Rohanizadeh R: Hydroxyapatite nanoparticles as vectors for gene delivery. Ther Deliv. 3:623–632. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Bose S and Tarafder S: Calcium phosphate ceramic systems in growth factor and drug delivery for bone tissue engineering: A review. Acta Biomater. 8:1401–1421. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Olton D, Li J, Wilson ME, Rogers T, Close J, Huang L, Kumta PN and Sfeir C: Nanostructured calcium phosphates (NanoCaPs) for non-viral gene delivery: Influence of the synthesis parameters on transfection efficiency. Biomaterials. 28:1267–1279. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Ginebra MP, Canal C, Espanol M, Pastorino D and Montufar EB: Calcium phosphate cements as drug delivery materials. Adv Drug Deliv Rev. 64:1090–1110. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Loo SC, Moore T, Banik B and Alexis F: Biomedical applications of hydroxyapatite nanoparticles. Curr Pharm Biotechnol. 11:333–342. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Chen L, McCrate JM, Lee JC and Li H: The role of surface charge on the uptake and biocompatibility of hydroxyapatite nanoparticles with osteoblast cells. Nanotechnology. 22:1057082011. View Article : Google Scholar : PubMed/NCBI

7 

Zakaria SM, Zein Sharif SH, Othman MR, Yang F and Jansen JA: Nanophase hydroxyapatite as a biomaterial in advanced hard tissue engineering: A review. Tissue Eng Part B Rev. 19:431–441. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Tan K, Cheang P, Ho IA, Lam PY and Hui KM: Nanosized bioceramic particles could function as efficient gene delivery vehicles with target specificity for the spleen. Gene Ther. 14:828–835. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Sun H, Jiang M and Zhu SH: In vitro and in vivo studies on hydroxyapatite nanoparticles as a novel vector for inner ear gene therapy. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 43:51–57. 2008.(In Chinese). PubMed/NCBI

10 

Wu X, Ding D, Jiang H, Xing X, Huang S, Liu H, Chen Z and Sun H: Transfection using hydroxyapatite nanoparticles in the inner ear via an intact round window membrane in chinchilla. J Nanopart Res. 14:7082012. View Article : Google Scholar

11 

Yan-Zhong Z, Yan-Yan H, Jun Z, Shai-Hong Z, Zhi-You L and Ke-Chao Z: Characteristics of functionalized nano-hydroxyapatite and internalization by human epithelial cell. Nanoscale Res Lett. 6:6002011. View Article : Google Scholar : PubMed/NCBI

12 

Liang ZW, Guo BF, Li Y, Li XJ, Li X, Zhao LJ, Gao LF, Yu H, Zhao XJ, Zhang L and Yang BX: Plasmid-based Stat3 siRNA delivered by hydroxyapatite nanoparticles suppresses mouse prostate tumour growth in vivo. Asian J Androl. 13:481–486. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Gao L, Zhang L, Hu J, Li F, Shao Y, Zhao D, Kalvakolanu DV, Kopecko DJ, Zhao X and Xu DQ: Down-regulation of signal transducer and activator of transcription 3 expression using vector-based small interfering RNAs suppresses growth of human prostate tumor in vivo. Clin Cancer Res. 11:6333–6341. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Yamada M, Ueno T, Tsukimura N, Ikeda T, Nakagawa K, Hori N, Suzuki T and Ogawa T: Bone integration capability of nanopolymorphic crystalline hydroxyapatite coated on titanium implants. Int J Nanomedicine. 7:859–873. 2012.PubMed/NCBI

15 

Fernandez JM, Molinuevo MS, Cortizo MS and Cortizo AM: Development of an osteoconductive PCL-PDIPF-hydroxyapatite composite scaffold for bone tissue engineering. J Tissue Eng Regen Med. 5:e126–e135. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Ye F, Guo H, Zhang H and He X: Polymeric micelle-templated synthesis of hydroxyapatite hollow nanoparticles for a drug delivery system. Acta Biomater. 6:2212–2218. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Liu H, Xi P, Xie G, Chen F, Li Z, Bai D and Zeng Z: Biocompatible hydroxyapatite nanoparticles as a redox luminescence switch. J Biol Inorg Chem. 16:1135–1140. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Barghi L, Asgari D, Barar J, Nakhlband A and Valizadeh H: Synthesis, characterization and in vitro anti-tumoral evaluation of Erlotinib-PCEC nanoparticles. Asian Pac J Cancer Prev. 15:10281–10287. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Xu J, Xu P, Li Z, Huang J and Yang Z: Oxidative stress and apoptosis induced by hydroxyapatite nanoparticles in C6 cells. J Biomed Mater Res A. 100:738–745. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Zhang L, Gao L, Li Y, Lin G, Shao Y, Ji K, Yu H, Hu J, Kalvakolanu DV, Kopecko DJ, et al: Effects of plasmid-based Stat3-specific short hairpin RNA and GRIM-19 on PC-3M tumor cell growth. Clin Cancer Res. 14:559–568. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Barton BE, Karras JG, Murphy TF, Barton A and Huang HF: Signal transducer and activator of transcription 3 (STAT3) activation in prostate cancer: Direct STAT3 inhibition induces apoptosis in prostate cancer lines. Mol Cancer Ther. 3:11–20. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Da Silveira RA, Hermes CL, Almeida TC, Bochi GV, De Bona KS, Moretto MB and Moresco RN: Ischemia-modified albumin and inflammatory biomarkers in patients with prostate cancer. Clin Lab. 60:1703–1708. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Dumache R, Puiu M, Motoc M, Vernic C and Dumitrascu V: Prostate cancer molecular detection in plasma samples by glutathione S-transferase P1 (GSTP1) methylation analysis. Clin Lab. 60:847–852. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Aneknan P, Kukongviriyapan V, Prawan A, Kongpetch S, Sripa B and Senggunprai L: Luteolin arrests cell cycling, induces apoptosis and inhibits the JAK/STAT3 pathway in human cholangiocarcinoma cells. Asian Pac J Cancer Prev. 15:5071–5076. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Siveen KS, Sikka S, Surana R, Dai X, Zhang J, Kumar AP, Tan BK, Sethi G and Bishayee A: Targeting the STAT3 signaling pathway in cancer: Role of synthetic and natural inhibitors. Biochim Biophys Acta. 1845:136–154. 2014.PubMed/NCBI

28 

Han Z, Wang X, Ma L, Chen L, Xiao M, Huang L, Cao Y, Bai J, Ma D, Zhou J and Hong Z: Inhibition of STAT3 signaling targets both tumor-initiating and differentiated cell populations in prostate cancer. Oncotarget. 5:8416–8428. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Kim WJ and Kim SW: Efficient siRNA delivery with non-viral polymeric vehicles. Pharm Res. 26:657–666. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Zhu SH, Huang BY, Zhou KC, Huang SP, Liu F, Li YM, Xue ZG and Long ZG: Hydroxyapatite nanoparticles as a novel gene carrier. J Nanopart Res. 6:307–311. 2004. View Article : Google Scholar

31 

Lim SL, Park SY, Kang S, Park D, Kim SH, Um JY, Jang HJ, Lee JH, Jeong CH, Jang JH, et al: Morusin induces cell death through inactivating STAT3 signaling in prostate cancer cells. Am J Cancer Res. 5:289–299. 2014.PubMed/NCBI

32 

Zhou Y, Tian L, Zhang YC, Guo BF and Zhou QW: Apoptotic effects of psiRNA-STAT3 on 4T1 breast cancer cells in vitro. Asian Pac J Cancer Prev. 15:6977–6982. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Chen Z and Han ZC: STAT3: A critical transcription activator in angiogenesis. Med Res Rev. 28:185–200. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liang Z, Wang H, Guo B, Li F, Liu J, Liu Z, Xu L, Yun W, Zhao X, Zhang L, Zhang L, et al: Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3. Mol Med Rep 16: 459-465, 2017.
APA
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z. ... Zhang, L. (2017). Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3. Molecular Medicine Reports, 16, 459-465. https://doi.org/10.3892/mmr.2017.6583
MLA
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z., Xu, L., Yun, W., Zhao, X., Zhang, L."Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3". Molecular Medicine Reports 16.1 (2017): 459-465.
Chicago
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z., Xu, L., Yun, W., Zhao, X., Zhang, L."Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3". Molecular Medicine Reports 16, no. 1 (2017): 459-465. https://doi.org/10.3892/mmr.2017.6583
Copy and paste a formatted citation
x
Spandidos Publications style
Liang Z, Wang H, Guo B, Li F, Liu J, Liu Z, Xu L, Yun W, Zhao X, Zhang L, Zhang L, et al: Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3. Mol Med Rep 16: 459-465, 2017.
APA
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z. ... Zhang, L. (2017). Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3. Molecular Medicine Reports, 16, 459-465. https://doi.org/10.3892/mmr.2017.6583
MLA
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z., Xu, L., Yun, W., Zhao, X., Zhang, L."Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3". Molecular Medicine Reports 16.1 (2017): 459-465.
Chicago
Liang, Z., Wang, H., Guo, B., Li, F., Liu, J., Liu, Z., Xu, L., Yun, W., Zhao, X., Zhang, L."Inhibition of prostate cancer RM1 cell growth in vitro by hydroxyapatite nanoparticle‑delivered short hairpin RNAs against Stat3". Molecular Medicine Reports 16, no. 1 (2017): 459-465. https://doi.org/10.3892/mmr.2017.6583
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team