Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma

  • Authors:
    • Tao Li
    • Ying Lin
    • Hongbin Gao
    • Chuan Chen
    • Yi Zhu
    • Bingqian Liu
    • Yu Lian
    • Yonghao Li
    • Wenli Zhou
    • Hongye Jiang
    • Haichun Li
    • Qingxiu Wu
    • Xiaoling Liang
    • Chenjin Jin
    • Xinhua Huang
    • Lin Lu
  • View Affiliations / Copyright

    Affiliations: State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat‑sen University, Guangzhou, Guangdong 510060, P.R. China, Department of Toxicology, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, Department of Obstetrics and Gynecology, The First Affiliated Hospital, Sun Yat‑sen University, Guangzhou, Guangdong 510000, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2505-2510
    |
    Published online on: June 29, 2017
       https://doi.org/10.3892/mmr.2017.6887
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Congenital macular coloboma is characterized by defined punched out atrophic lesions of the macula. The present study aimed to investigate the genetic alterations of one Chinese sporadic patient with bilateral large macular coloboma. Complete ophthalmic examinations, including best‑corrected visual acuity, slit‑lamp examination, fundus examination, fundus photograph and fundus fluorescein angiography imaging, Pentacam, and optical coherence tomography were performed on the patient. Genomic DNA was extracted from leukocytes in a peripheral blood sample collected from the patient, the patient's unaffected family members and from 200 unrelated control subjects from the same population. Next‑generation sequencing of the known genes involved in ocular disease was performed. The functional effects of the mutation were analyzed using Polymorphism Phenotyping (PolyPhen) and Sorting Intolerant From Tolerant (SIFT). One heterozygous bestrophin 1 (BEST1) mutation c.1037C>A (p.Pro346His, p.P346H) in exon 9 and one heterozygous regulating synaptic membrane exocytosis 1 (RIMS1) mutation c.3481A>G (p.Arg1161Gly, p.R1161G) in exon 23 were identified in the patient being investigated, but not in the unaffected family members or unrelated control subjects. Polyphen and SIFT predicted that the amino acid substitution p.P346H in the BEST1 protein is damaging. In addition, Polyphen predicted that the amino acid substitution p.R1161G in the RIM1 protein is damaging. The results of the current study have increased the mutation spectrums of BEST1 and RIMS1, and are valuable for improving the current genetic counseling process and developing novel therapeutic interventions for patients with macular coloboma.

Introduction

Congenital coloboma is a very rare birth defect with a prevalence of 0.5–0.7/10,000 live births (1). Congenital macular coloboma is characterized by well-circumscribed, punched out atrophic lesions in the macula (2–4). Macular coloboma should be differentiate from other diseases, such as Best vitelliform macular dystrophy (BVMD), advanced cone-rod dystrophy (CORD), congenital toxoplasmosis macular scar, Leber's congenital amaurosis, and central areolar choroidal dystrophy (5,6). It is usually sporadic, although autosomal dominant or other inheritance patterns may be followed. It is thought to be caused by the failure of normal closure of the optic fissure between 5 and 7 weeks of development (1). Macular coloboma can be classified into three types, namely pigmented macular coloboma, non-pigmented macular coloboma, and macular coloboma associated with abnormal vessels (7).

The genetic changes responsible for the pathogenesis of congenital macular coloboma are not well studied. Identification of genetic mutations in congenital macular coloboma is the first step to unravel the pathogenesis of this disease and will be helpful for genetic counseling. In this study, we aimed to characterize the clinical presentation of a 28-year-old female presented with bilateral large macular coloboma, and to identify the underlying genetic changes in this patient.

Patients and methods

Study participants

One patient presented with bilateral large atrophy at the macula in both eyes underwent complete ophthalmic examinations in Zhongshan Ophthalmic Center. Visual acuity was examined using the ETDRS chart (Precision Vision, La Salle, IL, USA). Anterior segment photograph was obtained using a BX 900 Slit Lamp (Haag-Streit, Bern, Switzerland). Anterior segment measurements were taken by Pentacam HR version 70700 (Oculus, Wetzlar, Germany). Fundus photograph were carried out using a Heidelberg Retina Angiograph (Heidelberg Engineering, Inc., Heidelberg, Germany). OCT was carried out by Cirrus HD-OCT (Carl Zeiss Meditec, Inc., Dublin, CA, USA). Physical examinations were performed to exclude systemic diseases. Venous blood samples from this patient, her unaffected family members, and 200 unrelated control subjects from the same population were collected.

Target capture and next-generation sequencing

A capture panel of inherited retinal-disease genes was previously designed and assessed by our group. The capture panel comprised 708,919 bp that covered all exons together with the flanking exon and intron boundaries (±15 bp) of 175 genes, including 138 genes causing common inherited nonsyndromic eye diseases and 54 genes causing syndromic eye diseases that have been previously reported and have been accepted by researcheres in this field.

Genomic DNA from peripheral blood leucocytes was extracted using the QIAamp DNABlood Midi Kit (Qiagen, Hilden, Germany). Then the genomic DNA was fragmented by Covaris LE220 (Covaris, Inc., Woburn, MA, USA) to generate paired-end library (200–250 bp). The library was enriched by array hybridization as previously described (8), followed by elution and post-capture amplification. The products were then subjected to Agilent 2100 Bioanalyzer and ABI StepOne for estimating the magnitude of enrichment. After quality control, captured library sequencing was carried out on Illumina HiSeq2500 Analyzers (Illumina, San Diego, CA, USA) for 90 cycles per read to generate paired-end reads. Image analysis, error estimation, and base calling were performed using Illumina Pipeline software (version 1.3.4) to generate raw data.

Data analysis and interpretation of genetic variants

To detect the potential variants in the family, we performed bioinformatics processing and data analysis after receiving the primary sequencing data. We used previously published filtering criteria to generate ‘clean reads’ for further analysis (8). The ‘clean reads’ (with a length of 90 bp) derived from targeted sequencing and filtering were then aligned to the human genome reference (hg19) using the BWA (Burrows Wheeler Aligner) Multi-Vision software package (9). After alignment, the output files were used to perform sequencing coverage and depth analysis of the target region, single-nucleotidevariants (SNVs) and INDEL calling. We used SOAPsnp software (9) and Samtools (10) to detect SNVs and indels. All SNVs and indels were filtered and estimated via multiple databases, including NCBI dbSNP, HapMap, 1,000 human genome dataset and a database of 200 Chinese healthy adults.

To predict the effect of missense variants, SIFT and PolyPhen were used to predict the possible impact of an amino acid substitution on the protein structure and function using straightforward physical and comparative considerations. Variants were predicted to be pathogenic only when at least one of the two programs predicted deleterious effect of the amino acid substitution on the protein structure and function. The Human Gene Mutation Database (HGMD) was used to screen mutations reported in published studies.

We also used PolyPhen to check whether the mutations affected highly conserved amino acid residues.

Mutation validation

The two novel pathogenic mutations were validated using conventional polymerase chain reaction (PCR) -based sequencing methods (11–13). Exon 9 of the BEST1 gene and the Exon 23 of RIMS1 were amplified by PCR with respective primers (Table I). Briefly, PCR was conducted in 50 µl reactions. The cycling profile included one cycle at 94°C for 5 min, followed by 40 cycles at 94°C for 45 sec, 59–60°C for 45 sec, 72°C for 45 sec, and one cycle at 72°C for 10 min. The PCR products were sequenced from both directions with an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA, USA). The sequencing results were analyzed using Seqman (version 2.3; Technelysium Pty, Ltd., Brisbane, QLD, Australia), and compared with the reference sequences in the database at the National Center for Biotechnology Information.

Table I.

Primers used for the amplification of the BEST1 and RIMS1 in this study.

Table I.

Primers used for the amplification of the BEST1 and RIMS1 in this study.

GeneExonForward (5′-3′)Reverse (5′-3′)Product size (bp)Annealingt emperature (°C)
BEST1  9 CAGGGAAACTGAGGTCCAGA AGGCTGTCCTTCGAGTAGCA53960
RIMS123 GGCGGATTCCAAACATCTTCC AGGTGCTTTACCAGAGTTGGC48760

All experimental protocols were carried out according to the guidelines approved by the Ethics Committee of Zhongshan Ophthalmic Center, and in accordance with the Declaration of Helsinki. Informed consent was obtained from all subjects. The data generated or analyzed in the current study are included herein.

Results

Clinical data

The patient studied in this report was from the southern area of China. Patient is a 28-year-old female without known familial history of ocular disease. Her best-corrected visual acuity was 1.3 LogMAR in the right eye, and figure count/40 cm (FC/40 cm) in the left eye. Anterior segment photograph showed some opacities in the lens of both eyes (Fig. 1). Fundus examination revealed bilateral large atrophy in the macula of each eye with well-circumscribed borders (Fig. 2). OCT showed that the foveal region of both eyes were abnormally thin. A large cave in the macular area and retinal schisis were observed in the left eye (Fig. 3).

Figure 1.

Anterior segment photograph showed some opacities in the lens of both eyes.

Figure 2.

Fundus examination revealed bilateral large atrophy in the macula of each eye with well-circumscribed borders.

Figure 3.

OCT showed that the foveal region of both eyes were abnormally thin. A large cave in the macular area and retinal schisis were observed in the left eye.

Mutation screening

A heterozygous BEST1 mutation c.1037C>A (p.Pro346His, p.P346H) in exon 9 and a heterozygous RIMS1 mutation c.3481A>G (p.Arg1161Gly, p.R1161G) in exon 23 were identified in the affected case, but not in any of the normal controls (Fig. 4). The first mutation we identified has previously been reported in Japanese patients (14). Since we were unable to obtain information of the patient's parents, we could not determine the inheritance pattern of the mutations. Polyphen and SIFT predicted that the amino acid substitution p.P346H in protein bestrophin 1 is damaging (Fig. 5), and Polyphen predicted that the amino acid substitution p.R1161G in protein RIM1 is damaging (Fig. 6). Multiple sequenced alignment indicated that the residue at position 346 of bestrophin-1 and the residue at position 1161 of RIM1 are highly conserved across species.

Figure 4.

A heterozygous BEST1 mutation c.1037C>A (p.Pro346His) in exon 9 and a heterozygous RIMS1 mutation c.3481A>G (p.Arg1161Gly) in exon 23 were identified in the affected case, but not in the unaffected family members or unrelated control subjects.

Figure 5.

Polyphen and SIFT predicted that the amino acid substitution p.P346H in protein bestrophin 1 is damaging. Multiple sequenced alignment (Basic Local Alignment Search Tool) indicated that the residue at position 346 of bestrophin-1 is highly conserved across species.

Figure 6.

Polyphen predicted that the amino acid substitution p.R1161G in protein RIM1 is damaging. The residue at position 1161 of RIM1 is highly conserved across species.

Discussion

Macular coloboma may result from intrauterine inflammation (15), and can be associated with systemic developmental abnormalities. Notably, it may be difficult to distinguish macular coloboma with macular atrophy if medical history is not provided. The underlying biological mechanism for development of macular coloboma is unclear. Interestingly, we found that this patient had two different mutations simultaneously, reminding us that some serious congenital defects can be caused by multiple mutations on multiple genes, making gene therapy more challenging.

BVMD is one of the most frequent form of autosomal dominant macular dystrophy (16). It is associated with mutations in the BEST1 gene (17) and results from dysfunction of the retinal pigment epithelium (RPE) (18). Bestrophin-1 is the product of the gene BEST1. This protein is mainly expressed in the basolateral plasma membrane of the RPE (19). This protein contains several domains with a high degree of evolutionary conservation. The function of Bestrophin-1 remains unclear, and some studies proposed that it acts as a Cl- channel activated by intracellular Ca2+ and/or as a channel regulator (20,21). A previous study conducted by Katagiri et al (14). identified a novel mutation p.P346H on BEST1 in a 38-year-old patient who was in the vitelliruptive stage, which was less serious than the patient in our study. It is likely that in BVMD, the clinical manifestations of transheterozygous mutations may be more serious than a single mutation.

CORD is one of the common forms of inherited retinal degeneration with a prevalence of 1/40 000 (22,23). CORD is characterized by the impairment of cone photoreceptors with or without dysfunction of rod photoreceptors (24,25). Clinical manifestations in CORD include photophobia, reduced visual acuity, color vision defects, and central scotomata (26). At present, a total of 30 genes have been found associated with CORD, including 10 genes related to autosomal dominant CORD (AIPL1, CRX, GUCA1A, GUCY2D, PITPNM3, PROM1, PRPH2, RIMS1, SEMA4A, UNC119) (27,28). RIM1, the protein product of RIMS1, localizes to the presynaptic active zones in brain and retinal tissue, and plays an important role in regulating synaptic vesicle release and presynaptic plasticity (29). RIM1 is a large multi-domain protein that interacts with multiple molecules at different regions (30).

In this case, we consider the patient had BVMD and CORD simultaneously. Mutations on BEST1 and RIM1 affected the RPE and photoreceptors, respectively. Therefore, the atrophy of the retina was very serious with only a little retina tissue remained. For these patients, transplantation of the retina stem cells or retina cell membrane may be more feasible for treatment.

In summary, our study identified two mutations of BEST1 and RIMS1 in one Chinese patient with bilateral macular coloboma. These findings expand the mutation spectrums of BEST1 and RIMS1, and will be valuable for genetic counseling and development of therapeutic interventions for patients with macular coloboma.

Acknowledgements

The authors are grateful to all of the patients, their families, and the control volunteers for participating in this study. This study was supported by the National Natural Science Foundation of China (grant nos. 81500709, 81570862, 81371019 and 81670872), the Medical Scientific Research Foundation of Guangdong Province (grant no. A2016460), and the Fundamental Research Funds for the Universities (grant no. 13ykpy43).

References

1 

Hornby SJ, Adolph S, Gilbert CE, Dandona L and Foster A: Visual acuity in children with coloboma: Clinical features and a new phenotypic classification system. Ophthalmology. 107:511–520. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Varghese M, Kavalakatt JA, Pandey S and Kolath JJ: Macular coloboma. Oman J Ophthalmol. 9:67–68. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Primo SA: Macular coloboma. J Am Optom Assoc. 61:373–377. 1990.PubMed/NCBI

4 

Sharma S, Naqvi A and Cruess AF: Bilateral macular colobomas. Can J Ophthalmol. 31:27–28. 1996.PubMed/NCBI

5 

Ishaq M, Mukhtar A and Khan S: Macular coloboma in a child with usher syndrome. J Ayub Med Coll Abbottabad. 27:470–472. 2015.PubMed/NCBI

6 

Izumikawa Y: Macular coloboma-brachydactyly. Ryoikibetsu Shokogun Shirizu (34 Pt 2). 126–127. 2001.(In Japanese).

7 

Jimenez-Sierra JM, Ogden TE and Van Boemel GB: Inherited retinal diseasesA diagnostic guide. The C. V. Mosby Company; St. Louis: 1989

8 

Wei X, Ju X, Yi X, Zhu Q, Qu N, Liu T, Chen Y, Jiang H, Yang G, Zhen R, et al: Identification of sequence variants in genetic disease-causing genes using targeted next-generation sequencing. PLoS One. 6:e295002011. View Article : Google Scholar : PubMed/NCBI

9 

Li R, Li Y, Fang X, Yang H and Wang J, Kristiansen K and Wang J: SNP detection for massively parallel whole-genome resequencing. Genome Res. 19:1124–1132. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, et al: 1000 Genome Project Data Processing Subgroup: The sequence alignment/map format and SAMtools. Bioinformatics. 25:2078–2079. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Lin Y, Liu X, Yu S, Luo L, Liang X, Wang Z, Chen C, Zhu Y, Ye S, Yan H and Liu Y: PAX6 analysis of two sporadic patients from southern China with classic aniridia. Mol Vis. 18:2190–2194. 2012.PubMed/NCBI

12 

Lin Y, Liang X, Ai S, Chen C, Liu X, Luo L, Ye S, Li B, Liu Y and Yang H: FGFR2 molecular analysis and related clinical findings in one Chinese family with Crouzon syndrome. Mol Vis. 18:449–454. 2012.PubMed/NCBI

13 

Lin Y, Ai S, Chen C, Liu X, Luo L, Ye S, Liang X, Zhu Y, Yang H and Liu Y: Ala344Pro mutation in the FGFR2 gene and related clinical findings in one Chinese family with Crouzon syndrome. Mol Vis. 18:1278–1282. 2012.PubMed/NCBI

14 

Katagiri S, Hayashi T, Ohkuma Y, Sekiryu T, Takeuchi T, Gekka T, Kondo M, Iwata T and Tsuneoka H: Mutation analysis of BEST1 in Japanese patients with Best's vitelliform macular dystrophy. Br J Ophthalmol. 99:1577–1582. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Yamaguchi K and Tamai M: Congenital macular coloboma in Down syndrome. Ann Ophthalmol. 22:222–223. 1990.PubMed/NCBI

16 

Low S, Davidson AE, Holder GE, Hogg CR, Bhattacharya SS, Black GC, Foster PJ and Webster AR: Autosomal dominant best disease with an unusual electrooculographic light rise and risk of angle-closure glaucoma: A clinical and molecular genetic study. Mol Vis. 17:2272–2282. 2011.PubMed/NCBI

17 

Tian R, Yang G, Wang J and Chen Y: Screening for BEST1 gene mutations in Chinese patients with bestrophinopathy. Mol Vis. 20:1594–1604. 2014.PubMed/NCBI

18 

Wong RL, Hou P, Choy KW, Chiang SW, Tam PO, Li H, Chan WM, Lam DS, Pang CP and Lai TY: Novel and homozygous BEST1 mutations in Chinese patients with Best vitelliform macular dystrophy. Retina. 30:820–827. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Lin Y, Gao H and Liu Y, Liang X, Liu X, Wang Z, Zhang W, Chen J, Lin Z, Huang X and Liu Y: Two novel mutations in the bestrophin-1 gene and associated clinical observations in patients with best vitelliform macular dystrophy. Mol Med Rep. 12:2584–2588. 2015.PubMed/NCBI

20 

Lin CF and Sarraf D: Best disease presenting as a giant serous pigment epithelial detachment. Retin Cases Brief Rep. 8:247–250. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Apushkin MA, Fishman GA, Taylor CM and Stone EM: Novel de novo mutation in a patient with best macular dystrophy. Arch Ophthalmol. 124:887–889. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Hamel CP: Cone rod dystrophies. Orphanet J Rare Dis. 2:72007. View Article : Google Scholar : PubMed/NCBI

23 

Brodie S: Cone-rod dystrophy in Danon disease. Graefes Arch Clin Exp Ophthalmol. 250:6332012. View Article : Google Scholar : PubMed/NCBI

24 

Burstedt MS, Ristoff E, Larsson A and Wachtmeister L: Rod-cone dystrophy with maculopathy in genetic glutathione synthetase deficiency: A morphologic and electrophysiologic study. Ophthalmology. 116:324–331. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Khan AO and Abu-Safieh L: Rod-Cone dystrophy with initially preserved visual acuity despite early macular involvement suggests recessive CERKL mutations. Ophthalmic Genet. 36:369–372. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Kuehlewein L and Sadda SR: Rod-Cone dystrophy associated with williams syndrome. Retin Cases Brief Rep. 9:298–301. 2015.PubMed/NCBI

27 

Pras E, Abu A, Rotenstreich Y, Avni I, Reish O, Morad Y, Reznik-Wolf H and Pras E: Cone-rod dystrophy and a frameshift mutation in the PROM1 gene. Mol Vis. 15:1709–1716. 2009.PubMed/NCBI

28 

Huang L, Xiao X, Li S, Jia X, Wang P, Sun W, Xu Y, Xin W, Guo X and Zhang Q: Molecular genetics of cone-rod dystrophy in Chinese patients: New data from 61 probands and mutation overview of 163 probands. Exp Eye Res. 146:252–258. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Weiss N, Sandoval A, Kyonaka S, Felix R, Mori Y and De Waard M: Rim1 modulates direct G-protein regulation of Ca(v)2.2 channels. Pflugers Arch. 461:447–459. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Schoch S, Mittelstaedt T, Kaeser PS, Padgett D, Feldmann N, Chevaleyre V, Castillo PE, Hammer RE, Han W, Schmitz F, et al: Redundant functions of RIM1alpha and RIM2alpha in Ca(2+)-triggered neurotransmitter release. EMBO J. 25:5852–5863. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li T, Lin Y, Gao H, Chen C, Zhu Y, Liu B, Lian Y, Li Y, Zhou W, Jiang H, Jiang H, et al: Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma. Mol Med Rep 16: 2505-2510, 2017.
APA
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B. ... Lu, L. (2017). Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma. Molecular Medicine Reports, 16, 2505-2510. https://doi.org/10.3892/mmr.2017.6887
MLA
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B., Lian, Y., Li, Y., Zhou, W., Jiang, H., Li, H., Wu, Q., Liang, X., Jin, C., Huang, X., Lu, L."Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma". Molecular Medicine Reports 16.3 (2017): 2505-2510.
Chicago
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B., Lian, Y., Li, Y., Zhou, W., Jiang, H., Li, H., Wu, Q., Liang, X., Jin, C., Huang, X., Lu, L."Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma". Molecular Medicine Reports 16, no. 3 (2017): 2505-2510. https://doi.org/10.3892/mmr.2017.6887
Copy and paste a formatted citation
x
Spandidos Publications style
Li T, Lin Y, Gao H, Chen C, Zhu Y, Liu B, Lian Y, Li Y, Zhou W, Jiang H, Jiang H, et al: Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma. Mol Med Rep 16: 2505-2510, 2017.
APA
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B. ... Lu, L. (2017). Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma. Molecular Medicine Reports, 16, 2505-2510. https://doi.org/10.3892/mmr.2017.6887
MLA
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B., Lian, Y., Li, Y., Zhou, W., Jiang, H., Li, H., Wu, Q., Liang, X., Jin, C., Huang, X., Lu, L."Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma". Molecular Medicine Reports 16.3 (2017): 2505-2510.
Chicago
Li, T., Lin, Y., Gao, H., Chen, C., Zhu, Y., Liu, B., Lian, Y., Li, Y., Zhou, W., Jiang, H., Li, H., Wu, Q., Liang, X., Jin, C., Huang, X., Lu, L."Two heterozygous mutations identified in one Chinese patient with bilateral macular coloboma". Molecular Medicine Reports 16, no. 3 (2017): 2505-2510. https://doi.org/10.3892/mmr.2017.6887
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team