This article is mentioned in:

Introduction

Flavonoids are an important class of secondary metabolites present in soybean. They have important physiological functions, such as antifungal and antioxidation. They can inhibit the growth of microorganisms and promote the growth of the soybean (1). Soybean glycosides are one of the components of isoflavones and are important physiologically active substances (2). A study has reported that chalcone reductase (CHR) is required for the synthesis of precursors of soybean glycosides; CHR synthesizes isoliquiritigenin, a precursor to daidzein (3). For the synthesis of daidzein, cinnamic amide is first formed from phenylalanine under the action of phenylalanine lyase and then catalyzed by 4-hydroxycinnamamidase to coumaric acid. Coumaric acid coenzyme A ligase (4CL) effects the conversion to the coumarin coenzyme A. Coumarin coenzyme A is a common precursor of daidzein and genistein synthesis. In the synthesis pathway of daidzein, CHR and chalcone synthase combine to catalyze the synthesis of allyl coenzyme A. Glycyrrhizin is catalyzed by chalcone isomerase to produce licorice and licorice is catalyzed by isoflavone synthase (IFS) to synthesize daidzein.

Soybean glycosides have certain biological effects that genistein does not. Soybean glycosides have various beneficial effects, including preventing breast cancer (4), improving immunity (5), preventing skin burns caused by ultraviolet radiation (6) and the treatment of women with postpartum depression (7). They have an important role in protecting against soybean Phytophthora root rot (8,9).

There are multiple forms of CHR gene in the soybean genome (10). A previous study report identified five CHR genes (11). Besides the CHR1 gene, the function of the others has not been fully characterized (12,13). Graham et al (14) verified 4 CHR gene fragments using RNAi technology, and demonstrated that not all of the CHR proteins were involved in the synthesis of soybean glycosides. In 2009, Liu (15) isolated a new CHR gene in soybean. Based on the previous research, the type and quantity of CHR genes present in soybean is inconclusive. Therefore, CHR gene cloning and identification are also the important for understanding the regulation of glycoside synthesis in soybean.

In the current study, a CHR3 gene expression vector was constructed, and transformed into soybean varieties to overexpress CHR3. Subsequently, the effects of CHR3 on the synthesis of soybean glycosides were analyzed, the function and efficiency of different CHR genes were identified and the mechanism of CHR action in the synthesis of soybean glycosides was determined, which lays a theoretical foundation for breeding soybean resistant to Phytophthora root rot by using genetic engineering technology to control the synthesis and metabolism of soybean glycosides.

Materials and methods

Materials

Soybean varieties ‘Jinong 17’ and ‘Jilin 30’, E. coli DH5α, Agrobacterium tumefaciens strain EHA105, pMD18-T cloning vector, the recombinant prokaryotic expression vector BL21-pET28a and expression vector pCAMBIA3300 were all provided and maintained by the Plant Biotechnology Center of Jilin Agricultural University (Changchun, China).

Obtaining the objective fragment

The BL21-pET28a-CHR3 recombinant expression plasmid, which was cloned by Zhang et al (16) (GenBank accession no: KF927169), was used as the template, and objective fragment was amplified using specific primers CHR3 sense/CHR3 antisense (Table I) and sequenced by the NCBI (National Institutes of Health, Bethesda, MD, USA).

Table I. Primers of different genes used for cloning and reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers of different genes used for cloning and reverse transcription-quantitative polymerase chain reaction.

Name	Sequence (5′-3′)	Product (bp)
CHR3 sense	CCCGAGCTCTTCAGGACACAAATGCCA	CHR3 (932)
CHR3 antisense	TTTGGATCCCTTAAACGTCTCCATCCC
35S sense	TAGAGGACCTAACAGAAC	35S (500)
35S antisense	CCGTGTTCTCTCCAAATG
Bar sense	TCAAATCTCGGTGACGGGC	Bar (552)
Bar antisense	ATGAGCCCAGAACGACGC
Q-CHR3 sense	GGTGGGTTACCGTCATTTTG
Q-CHR3 antisense	TCATGTCTCAGCCTCACTGG
Q-ACT forward	ATCTTGACTGAGCGTGGTTATTCC
Q-ACT reverse	GCTGGTCCTGGCTGTCTCC

[i] SacI (CHR3 sense) and BamHI (CHR3 antisense) enzyme cleave sites are underlined. CHR3, chalcone reductase 3; Q-, qPCR primer; ACT, β-actin.

The polymerase chain reaction (PCR) amplification system was as follows: 2.5 µl MgCl2, 2.5 µl 10X Taq buffer, 1 µl specific primer, 1 µl template, 0.5 µl dNTP, 0.2 µl Taq polymerase (reagents from Takara Biotechnology Co., Ltd., Dalian, China), sterile water was added up to 25 µl. Amplification conditions were as follows: 94°C predenaturation for 10 min, then 94°C denaturation for 30 sec, 55°C renaturation for 40 sec and 72°C extension for 50 sec for 35 cycles; a final 72°C extension for 10 min was performed and then maintained at 4°C. PCR products were separated by 1% agarose gel electrophoresis, and then ligated into the pMD18-T vector following recovery from the gel (DNA gel extraction kit; Takara Biotechnology Co., Ltd.). The mixture was: 5 µl CHR3, 1 µl solution I and 4 µl pMD18-T at 16°C overnight. Recombinant cloning vector pMD18-T-CHR3 was transformed into competent cells E. coli DH5α, and then monoclonal colonies were selected and sequenced by Comate Bioscience Co., Ltd., (Changchun, China).

Construction of overexpression vector of CHR3 gene

The CHR3 gene fragment was amplified by PCR as described above and its products were separated by 1% agarose gel electrophoresis, and obtaining purified target fragments. Following electrophoresis, the gel was placed under UV light and the target gel cut out with a knife and placed in tubes and the AxyPrep DNA Gel Extraction kit (Corning Life Sciences Limited. Wujiang, China) employed. Fragment and the objective based expression vector pCAMBIA3300 were digested with SacI and BamHI (restriction endonucleases from Takara Biotechnology Co., Ltd.), and the enzyme digestion system was as follows: 2 µl SacI, 1 µl BamHI, 8 µl carrier (fragment), 2 µl 10X BamHI buffer and 7 µl DDH2O; these were incubated at 37°C for 2 h, and inactivated at 80°C. Enzyme digestion products were separated by 1% agarose gel electrophoresis, and then the vector and the target fragment were collected and ligated in the following system: 4.5 µl CHR3 DNA fragment, 2.5 µl pCAMBIA3300 vector, 1 µl T4 ligase, 2 µl T4 buffer and 10 µl DDH2O, incubated at 22°C overnight. The expression vector pCAMBIA3300-CHR3 was produced and anti-herbicide Bar gene used as a screening marker. The recombinant expression vector was identified by PCR and double enzymic digestion.

Genetic transformation of soybean

In this experiment, the pCAMBIA3300-CHR3 DNA was transferred into the receptor soybean cultivar Jinong 17 and Jilin 30 by Agrobacterium infection (17,18), thus obtaining positive plants. At the time of Agrobacterium infection, only the T-DNA region was transferred into the recipient soybean, with the Bar gene as the marker gene, thereby obtaining a positive plant with herbicide resistance.

Progeny analysis of transgenic plants

The pCAMBIA3300 plasmid vector contained constitutive promoters 35S and marker gene Bar. Primers for the resistance gene Bar (552 bp) and promoter 35S (500 bp) sequences (Bar sense/Bar antisense and 35S sense/35S antisense) were designed by Primer software version 5.00 (Premier Biosoft International, Palo Alto, CA, USA; Table I).

A Nuclean Plant Genomic DNA kit (CW Biotech, Beijing, China) was used to extract genomic DNA from young soybean leaves, and the soybean leaves genome of untransformed plants were used as a negative control. The PCR reaction volume for Bar was 25 µl: 2.5 µl MgCl2, 2.5 µl Buffer, 1 µl BarS, 1 µl BarAS, 1 µl genome DNA, 0.8 µl dNTP, 0.2 µl Taq and DDH2O to 25 µl. The PCR reaction conditions were as follows: 94°C predenaturation for 5 min, 94°C denaturation for 40 sec, 60°C renaturation for 40 sec and 72°C extension for 40 sec for 30 cycles; the last extension step was at 72°C for 8 min and then maintained at 4°C. The PCR reaction volume for 35S was 25 µl: 2.5 µl MgCl2, 2.5 µl Buffer, 1 µl 35S, 1 µl 35AS, 1 µl genome DNA, 0.8 µl dNTP, 0.2 µl Taq and DDH2O to 25 µl. The reaction conditions of PCR were: 94°C predenaturation for 5 min, 94°C denaturation for 30 sec, 55°C renaturation for 30 sec and 72°C extension for 30 sec for 40 cycles; a final extension step was performed at 72°C for 8 min, and then maintained at 4°C. PCR products were separated by 1% agarose gel electrophoresis and sequenced after recovery using a AxyPrep DNA Gel Extraction kit (Corning Life Sciences, Wujiang, China).

PCR was performed for the initial detection of the target gene integration and to identify positive plants for Southern blotting to further verify the integration of the target gene at the genome level. This enabled the number of copies of the gene of interest in the genome to be detected.

The genomic DNA of positive T1 generation transgenic plants was extracted using a Nuclean Plant Genomic DNA kit (CW Biotech, Beijing, China) and then digested using BamHI. Southern blotting was conducted with probe labeling, sample preparation, transfer of DNA to membrane, hybridization, washing the membrane and signal development performed according to the manufacturer's protocols. Purified 35S DNA (https://www.ncbi.nlm.nih.gov/nucleotide/1050047859?report=genbank&log$=nuclalign&blast_rank=1&RID=NXN567FN014) was used as the DNA probe and the DIG High Primer DNA Labeling and Detection Starter kit I (Roche Diagnostics, Basel, Switzerland) was used.

Total RNA was extracted from leaves of transgenic plants which were detected by Southern blotting. These plants were tested by RT-qPCR to verify the integration of the target gene at the mRNA level. A Total RNA Extraction kit (Omega Bio-Tek, Inc., Norcross, GA, USA) was used and then reverse transcribed into cDNA using the All-in-One™ First-Strand cDNA Synthesis kit (GeneCopoeia, Inc., Rockville, MD, USA). The reaction volume was 25 µl; 1 µg 250 µM Total RNA, 1 µl 60 µM Random Primer, 1 µl Oligo(dT)18 and DDH2O to 13 µl, heated to 65°C for 10 min and put in an ice bath. Then was added 5 µl 25 mM 5*RT Reaction Buffer, 1 µl 25 U dNTP, 1 µl 200 U RNase Inhibitor, 1 µl M-MLV RTase and DDH2O to 25 µl. This was diluted 5-fold for subsequent use. The RT-qPCR primer sequences for CHR3 (Q-CHR3) are presented in Table I. Soybean β-actin gene (GenBank accession number: NM_001252731.2) was selected as the reference gene and appropriate primers were designed (Q-ACT; Table I). The total cDNA of the soybean leaf tissue was analyzed by 3000P Mx fluorescence Real-time RT-qPCR instrument (Agilent StrataGene Mx3000P) (19,20) according to the protocols of the SYBR Premix Ex Taq™ kit (Takara Biotechnology Co., Ltd.). The PCR amplification system was as follows: 12.5 µl 2X SYBR Premix Ex Taq polymerase, 1 µl Q-CHR3 sense primer, 1 µl Q-CHR3 reverse primer, 2 µl cDNA and sterile water to 25 µl. PCR amplification conditions were as follows: 95°C predenaturation for 3 min, followed by 40 cycles of 95°C denaturation for 10 sec and 60°C reaction for 35 sec. Analysis of relative gene expression data was performed by the 2−ΔΔCq method (21,22).

The content of isoliquiritigenin was measured using high-performance liquid chromatography (HPLC). Soybean leaves were treated at 70°C to dry them, and untransformed soybean leaves were used as the control. Leaves (0.5 g dry weight) were ground to a fine powder in liquid nitrogen and dissolved in methanol (methanol: sample 4:1 v/v), and then exposed to ultrasonic treatment at 40°C for 50 min following soaking overnight in methanol. Ethyl acetate was used to extract the distribution of the isoliquiritigenin in the enzyme hydrolysate, and then the ethyl acetate was extracted. The sample was dissolved in methanol solution, and filtered using a 0.22 µm organic membrane. A 20 µl sample volume was analyzed using HPLC (23,24). A Shimadzu LC-20AT HPLC system (Shimadzu Corporation, Kyoto, Japan) was used. Detection was performed with a fluorescence spectrometer (Beijing Jitian Instrument Co., Ltd., Beijing, China) with excitation at 366 nm and emission at 417 nm. The C18 column (GL Sciences Inc., Tokyo, Japan; 5 µm, 4.6×150 mm) was used at room temperature. The mobile phase was methanol: H2O 80:20 (0–5 min, 30% methanol; 5–20 min, 45% methanol; 20–30 min, 45% methanol; 30–35 min, 30% methanol; and, 35–40 min, 30% methanol). The flow rate was 0.8 ml/min.

Significant differences of CHR3 gene expression between the transgenic plants and the non-transformed plants determined by RT-qPCR were analyzed by one-way analysis of variance followed by LSD post hoc test using SPSS version 19.0 (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Cloning of soybean chalcone reductase gene CHR3 fragment and construction of over expression vector

Cloned BL21-pET28a-CHR3 plasmid was used as the template, and the objective fragment was amplified using specific primers (CHR3 sense/CHR3 antisense). The amplified fragment length was 932 bp. The amplified fragment was cloned into pCAMBIA3300 to obtain an overexpression vector, pCAMBIA3300-CHR3. The target fragment was 932 bp was identified using SacI/BamHI double enzyme digestion. As presented in Fig. 1, results of PCR and double enzyme digestion were consistent with the expected size, demonstrating the success of vector construction.

Figure 1. pCAMBIA3300-CHR3 overexpression vector. M, DL2000 DNA marker; 1, CHR3 polymerase chain reaction product; 2, double enzyme digestion (SacI and BamHI). CHR3, chalcone reductase 3.

Creation and detection of T1 generation transgenic plants

The pCAMBIA3300-CHR3 overexpression vector was transferred into the soybean varieties Jinong 17 and Jilin 30. There were four positive Jinong 17 plants in the T0 generation and two positive Jilin 30 plants in the T0 generation, as detected by PCR. From the T0 generation, 45 Jinong 17 seed grains were harvested and18 Jilin 30 18 grains were harvested. Genomic DNA was extracted from T1 generation plants, and 35S promoter sequences and the Bar gene were detected by PCR using specific primers (Figs. 2 and 3). Recombinant expression plasmid DNA vector pCAMBIA3300-CHR3 was the positive control and the untransformed receptor soybean plants were a negative control.

Figure 2. Detection of (A) 35S and (B) herbicide resistant Bar in T1 generation Jinong 17 plants. M, DL2000 DNA marker; P, positive control (pCAMBIA3300-CHR3 DNA); N, negative control (DDH2O); CK, non-transformed plant; 1–8, transgenic plants.

Figure 3. Detection of (A) 35S and (B) herbicide resistant Bar in T1 generation Jilin 30 plants. M, DL2000 DNA marker; P, positive control; N, negative control; CK, non-transformed plant; 1–6, transgenic plants.

As presented in Figs. 2 and 3, PCR analysis of the T1 generation transgenic plants produced the amplified 35S and Bar bands at the correct estimated size (35S, 500 bp; Bar, 552 bp). Among them, Jinong 17 had 8 positive strains (Fig. 2) and Jilin 30 had 6positive strains (Fig. 3).

Genomic DNA of positive transgenic plants was extracted and digested with BamHI. Southern blotting was performed using the purified 35S DNA as a probe. As presented in Fig. 4, the non-transformed plant did not produce hybridization signals. There was observable hybridization in Jinong 17 (Fig. 4A) and Jilin 30 (Fig. 4B) transgenic plants. The Southern blotting indicated that the functional components were integrated into the soybean genome, but that the integration site was not the same in each plant.

Figure 4. Southern blotting detection of 35S T1 positive plants. M, DNA marker; P, positive control; CK, non-transformed plant; (A) 1–6, Jinong 17 transgenic plants; (B) 1–5, Jilin 30 transgenic plants.

Positive transgenic plants detected using Southern blotting were analyzed by RT-qPCR with SYBR Green I. As presented in Fig. 5, the relative expression CHR3 mRNA in transgenic soybean plants was significantly increased compared with control plants, and the difference ranged from 2 to 20-fold.

Figure 5. Relative expression of CHR3 gene. (A) Relative expression of CHR3 in Jinong 17. 1, non-transformed plant; 2–9, transgenic plants. (B) Relative expression of Jilin 30. 1, non-transformed plant; 2–6, transgenic plants. Data are mean ± standard deviation. *P<0.05 and **P<0.01 vs. non-transformed plant. CHR3, chalcone reductase 3.

The average relative expression of CHR3 in the leaf tissue of transgenic Jinong17 plants 2–9 was 3.2, 4.8, 2.0, 10.2, 8.6, 20.0, 3.3 and 17.2-fold higher than in the non-transformed plant, respectively. The change in expression in transgenic plant 4 compared with the non-transformed plants reached a significance level of P<0.05; others reached P<0.01. The average relative expression of CHR3 in the leaf tissue of transgenic Jilin 30 plants 2–6 was 1.2, 10.5, 4.3, 2.4 and 5.5-fold higher than in the non-transformed plants, respectively. CHR3 expression was increased significantly in transgenic plants 3–6 compared with the non-transformed plant (P<0.01).

The Jinong 17 plant 6 and non-transformed soybean leaf tissue were selected and their isoliquiritigenin content was measured by HPLC. According to the regression equation: Y=2, 52828×106X+0.223424, r=0.999 (X represents the content of isoliquiritigenin; Y represents the peak area). As presented in Fig. 6A, isoliquiritigenin content of transformed plants was 1.256 µg/ml; in Fig. 6B, the isoliquiritigenin content of untransformed plant leaf tissue was 1.157 µg/ml. The isoliquiritigenin content was increased by 8.56% in transformed Jinong 17 plant 6; however, no obvious increase was observed in isoliquiritigenin content in the transgenic Jilin 30 plant compared with non-transformed plants.

Figure 6. HPLC detection of isoliquiritigenin. HPLC analysis of the isoliquiritigenin in the (A) non-transformed soybean and (B) transformed soybean Jinong 17 plant 6. The peak of the arrow refers to the content of isoliquiritigenin. HPLC, high-performance liquid chromatography.

Discussion

Previous studies reported that there are five CHR genotypes in alfalfa (25,26). Young et al (27) identified six CHR genotypes in tribulus alfalfa. Shimada et al (28) cloned the polyketoreductase gene, that is homologous with the chalcone ketoreductase gene in Lotus japonicus, which was overexpressed in morning glory [Ipomoea nil (L.) Roth] suggesting it promotes isoliquiritigenin production. Li et al (12) cloned the CHR1 gene, constructed an overexpression vector and transformed soybean plants. Tissues in the transgenic plants exhibited increased CHR1 gene expression in soybean leaves. In the present study, RT-qPCR analysis demonstrated that the expression of CHR3 was increased by 2–20-fold in transgenic plants compared with non-transformed plants.

pCAMBIA3300-CHR3 was introduced into the soybean genome by Agrobacterium-mediated transformation, which was confirmed using Southern blotting. Zhang et al (16) cloned a CHR3 gene from soybean and transformed into E. coli BL21, which expressed a protein that catalyzed the production of isoliquiritigenin in soybean powder. The expression of CHR3 in the transgenic Jinong 17 plant 6 was increased by 21.1-fold compared with control plants; however, isoliquiritigenin content was only increased by 8.56% in the present study, as detected by HPLC; the reason for this requires further investigation. Isoliquiritigenin is a precursor of daidzein, which in turn can improve the ability of soybean to resist phytophthora root rot.

References