Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration

  • Authors:
    • Yang Li
    • Shigui Deng
    • Ya Ζhao
    • Lijuan Liu
    • Ruizhi Zhao
  • View Affiliations / Copyright

    Affiliations: Key Research Laboratory of Gynecology, Department of Gynecology, Guangdong Provincial Hospital of Chinese Medicine, The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510120, P.R. China, Department of The Public Experiment Platform, Department of Gynecology, Guangdong Provincial Hospital of Chinese Medicine, The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510120, P.R. China, Department of Chinese Medicine Property Team, Department of Gynecology, Guangdong Provincial Hospital of Chinese Medicine, The Second Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510120, P.R. China
  • Pages: 7633-7640
    |
    Published online on: September 20, 2017
       https://doi.org/10.3892/mmr.2017.7559
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Methotrexate (MTX) is a widely used immunosuppressant and anticancer agent with high toxicity. Smilax glabra Rhizoma (SGR) has the effect of detoxification and immunoregulation, and has been used as both food and folk medicine in many countries. Co‑administration of MTX and SGR occurs in several diseases. However, whether they work synergistically or are incompatible remains unknown. In the present study, MTX was administrated to rats alone or combined with SGR. Blood and tissue samples were collected at designated times. The concentrations of MTX were determined by high‑performance liquid chromatography. Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was used to detected the gene expression. SGR decreased the AUC0‑t and Cmax of MTX by 44.5 and 48.2%, but in a tissue‑dependent manner. The total exposure of MTX was significantly decreased in the small intestine, stomach, plasma, and kidney by 61.6, 34.7, 63.3 and 46.1%, respectively, but was increased in the lung and spleen by 82.9 and 21.0%, respectively. RT‑qPCR demonstrated that SGR increased the mean P‑glycoprotein (gp) mRNA expression in the small intestine 2.54 times, but had a marginal effect on the expression of organic anion transporting polypeptide 2, and organic anion transporter (OAT)1 and OAT2. These results suggested that SGR affects the pharmacokinetics of MTX in a tissue‑dependent manner by affecting P‑gp, and the clinical effect of co‑administration depended on the disease site.

Introduction

Methotrexate (MTX), an antifolate and anticancer agent with a narrow therapeutic window, is commonly used for refractory rheumatoid arthritis, psoriasis, breast carcinoma, lung and liver cancer and systemic lupus erythematosus (1,2). However, besides its affirmative effect in the clinic, MTX has many side effects including nausea, vomiting, mucositis, diarrhea, stomatitis, myelosuppression (3,4) and hepatotoxicity (5). All these side effects limit its use, and the toxicity is so severe that >50% patients give up the treatment (6).

Currently, methods such as folic acid supplementation for reducing the dosage and regularly checking the body functions are a clinical way to reduce the side effects of MTX. However, the remedial method of detoxification after MTX poisoning does not tend to be effective. Therefore, ethnomedicines may be of importance, particularly if they have detoxifying effects. For example, one of the most commonly used detoxicants is Smilax glabra Rhizoma (SGR; Tufuling in Chinese).

SGR is a natural dietary supplement widely used in food-making and health care in Southeast Asia, Arabian countries and North America (7,8). Various bioactivities of SGR have been demonstrated in in vitro and in vivo assays, including anti-cancer (9), antiviral (10), anti-inflammatory (11), immunomodulatory (12), detoxification and hepatoprotective effects (13). In the clinic, patients with rheumatoid arthritis, cancer, nephroma and even MTX-induced hepatotoxicity (14–16), receive treatment with a combination of MTX and SGR or SGR-containing herbal mixtures frequently (17,18).

Investigating the drug-drug interaction (DDI) or drug-herb interaction (DHI) using pharmacokinetic methods has become popular. DDI or DHI are usually induced by drug metabolism enzyme or drug transporters. MTX enters cells primarily by carrier-mediated uptake (19,20). Therefore, DDI or DHI induced by MTX may mainly associate with drug transporters. MTX is the substrate of P-glyocoprotein (gp) (21), multidrug-resistance-associated protein (MRP)1, 2 and 3 (22–25), and organic anion transporters (OAT)1, 2 (26,27). Anything which could change the activity of the above transporters may induce DDI or DHI of MTX.

Astilbin is the major active component of SGR, and the content in SGR usually >0.4%. Wang et al (28) reported that astilbin increased the expression of P-gp in rats. In vivo, astilbin are further metabolized into sulfates and glucuronides (29), which all are the substrate of MRP1, MRP2, and MRP3 (30–32). This indicates that DHI may happen with a combination of MTX and SGR, but this interaction requires further study.

Therefore, in the present study, the effect of SGR on the pharmacokinetics and tissue distribution of MTX was studied in rats, and the potential underlying mechanism was investigated.

Materials and methods

Chemicals and reagents

MTX was purchased from Guangzhou Lubex Biological Technology Co., Ltd. (Guangdong, China; batch no. 100138-201104). SGR was purchased from Kangmei Pharmaceutical Co., Ltd., (Guangdong, China) in February 2013 (batch no. 130800051) and was verified by Chen Wen-liang in the Second Affiliated Hospital, Guangzhou University of Chinese Medicine (Guangzhou, China). SPE cartridges were supplied by Dikma Technologies, Inc. (Beijing, China). All other materials were analytical grade or better and used as received.

Preparation of SGR decoction

Ethanol (75%) was added to 450 g crude drug, soaked for 30 min and then heated on a reflux extraction device. After boiling, gentle heating was continued for 1 h, the mixture was filtered, and the filtrate was concentrated by rotary evaporators. The volume was kept to 150 ml and frozen at −20°C for later use. The chromatographic fingerprint of SGR has been analyzed in our previous study (33). The concentration of astilbin in the extract was ~0.48%.

Animal and drug administration

A total of 54 male Sprague-Dawley (SD) rats aged 7–8 weeks, weighing 300±50 g, were supplied by Southern Medical University (Guangzhou, China; certification no. 44002100003362). The rats were housed in cages at 21±3°C and 50% relative humidity on a 12-h light/dark cycle. They were acclimated to this environment for 7 days with standard diet until the night prior to the experiment. The rats were then fasted overnight with free access to water. The studies were approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine (Guangzhou, China), and conducted in strict accordance with the recommendations in the guide for the care and use of Laboratory Animals of the National Institutes of Health (Bethesda, MA, USA).

Pharmacokinetic study

Pharmacokinetic studies were carried out in SD rats. Animals were randomly divided into two groups (n=6 per group). MTX was diluted with deionized water to obtain concentration of 0.6 mg/ml. MTX (6.0 mg/kg) was given orally to rats with and without a concomitant oral dose of SGR (30 g/kg of crude drugs) at 5 min before. Blood samples (0.6 ml) were collected from orbit venous plexus into heparinized 1.5 ml polythene tubes at predetermined time points (10, 20, 40, 60, 120, 240, 360, 480 and 540 min). The samples were immediately centrifuged at 3,500 × g for 15 min at room temperature, and the supernatant was gathered as plasma and stored at −80°C until analysis.

Tissues distribution study

Tissue distribution studies were carried out in 36 male SD rats. Animals were randomly divided into two groups (n=18 per group): MTX alone and MTX combined with SGR. MTX (6.0 mg/kg) was given orally to rats with and without a concomitant oral dose of SGR (30 g/kg of crude drug) at 5 min beforehand. Following intragastric administration, rats were anesthetized by 10% chloral hydrate (4 ml/kg; Tianjin Damao Chemical Reagent Factory, Tianjin, China) and sacrificed at predetermined time points (20, 60 and 240 min; 6 rats were sacrificed at each time point of each group). Blood samples were obtained from the abdominal aorta; the chest and abdominal cavity were opened and tissues of interest (heart, liver, spleen, kidney, lung, stomach, intestine and marrow) were harvested and rinsed with ice-cold 0.9% NaCl to remove the superficial blood. Following being blotted dry with filter paper, the tissue samples were stored at −80°C until analysis.

Sample preparation

The plasma was thawed and swirled for 10 sec, and then 100 µl plasma was added to a pre-conditioned SPE column. After washing with 1 ml deionized water, 1 ml washing solution [0.2% methanoic acid-methanol (v/v)] was used. The deionized water elution was discarded and washing solution elution was collected, then evaporated to dryness under a stream of nitrogen at 40°C. The residue was re-dissolved with 100 µl mobile phase and then filtered through a 0.22-µm disposable syringe filter, of which 10 µl was injected into the high-performance liquid chromatography (HPLC) system for analysis. Each tissue sample weight ~300 mg after thawing, and was homogenated in 0.9% NaCl [1:6 (w/v)]. Tissue homogenate samples were centrifuged at 3,500 × g for 15 min at 4°C, the supernatant was collected and conducted as plasma sample, and 10 µl supernatant was used for HPLC analysis.

HPLC analysis

The chromatographic analysis was performed on an Agilent 1200 system (Agilent Technologies, Inc., Santa Clara, CA, USA) with a VWD detector at 302 nm. Samples were analyzed on a Diamonsil C18 column (250×4.6 mm I.D, 5 µm; Dikma Technologies Inc.) at 30°C. The mobile phase consisted of 0.1% formic acid aqueous solution (A) and methanol (B), using a gradient elution (0 min: 10% B, 8 min: 60% B, 10 min: 100% B) at a flow rate of 1.0 ml/min, and the injection volume was 10 µl.

Preparation of standard solution and quality control samples

Standard solution of MTX was prepared by using 0.1% formic acid water containing 5% methanol; the working concentration was 200 mg/l. This was stored at 4°C in a dark place until use. Appropriate amounts of the standard solution were added to 100 µl blank rat plasma or tissue homogenates to prepare the calibration standards of MTX, the final calibration standard concentrations were 0.052, 0.104, 0.157, 0.313, 0.626, 1.252, 2.503 and 5.006 mg/l for plasma samples and 0.020, 0.039, 0.078, 0.156, 0.3125, 0.625, 1.25, 2.5 and 5 mg/l for tissue samples. Quality control (QC) samples were prepared at the lower limit of quantification (LLOQ); low, medium and high concentrations of 0.052, 0.313, 1.252 and 5.006 mg/l for plasma samples and 0.020, 0.078, 0.3125 and 1.25 mg/l for tissue samples.

Method validation

The specificity of the assay was assessed by comparing the chromatograms of blank sample with the corresponding spiked samples, and each blank sample was tested to ensure that it had no interference on the elution of MTX. The calibration curves were constructed from the peak area of each standard solution against homographic concentrations using eight-level nonzero standards and a linearly weighed (1/x) least squares regression model. The accuracy and precision were determined by replicate analysis (n=6) of QC samples on three different time points. Relative standard deviation (RSD)% was used to evaluate the accuracy and the intra- and inter-day precision. The extract recovery of MTX at QC levels were evaluated by assaying the samples as described above and comparing peak areas with those obtained from the compounds dissolved in the supernatant of the processed blank plasma. The stability of plasma and tissues was investigated by analyzing of the samples at QC levels (n=6) under different conditions.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Tissues were homogenized in RNAiso Plus (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) to extract total RNA according to the manufacturer's protocol. The quality and concentration of RNA were determined using the OD260/280 ratio measured by the Thermo NanoDrop 2000c (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and stored at −80°C prior to use. cDNA was synthesized from total RNA (1 µg; 20 µl final reaction volume) with oligo(dT) priming using M-MLV platinum Green qPCR Super Mix-UDG (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol, then performed on Veriti 96 Well Thermal Cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.).

qPCR was performed on an ABI Prism TM 7500 Real Time qPCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the SYBR Select Mastermix (Applied Biosystems; Thermo Fisher Scientific, Inc.). The experiment was carried out using optical 96-well reaction plates covered with plate sealers. Samples were treated following the instructions of SYBR Select Mastermix (Applied Biosystems; Thermo Fisher Scientific, Inc.): Each tube of reaction mix consisted of 2 µl of RT cDNA, forward and reverse primers (each 0.4 µl), 10 µl SYBR Select Mastermix and 7.2 µl no enzyme water (20 µl final reaction volume). Primer sequences used for RT-qPCR are listed in Table I. Cycling parameters were as follows: 50°C for 2 min, 95°C for 1 min, then 40 cycles of 95°C for 15 sec and 60°C for 1 min. A melting temperature-determining dissociation step was performed at 96°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec, for a total of 45 cycles in a procedure.

Table I.

Primer sequences used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences used in reverse transcription-quantitative polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Rat-P-gp ATGAAACTGCCCCACAAATT CTTTCTGTGTCCAAGGCTGA
Rat-OAT1 CCATGCTGTGGTTTGCCACTA ACAAACTTGGCAGGCAGGTC
Rat-OAT2 TGGCCTATGCCATTCCAGAC GGGATTCTGGGACAAACCAGT
Rat-GAPDH ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT
Rat-MRP1 AGGTTGGTATTGTGGGTCGTA GATGGTGATCTTGAAGCGCAGGTT
Rat-MRP2 GGGACTCCAACCTGACTGTAT CCTCTGGGCAAGGATTTGT
Rat-MRP3 TCAGCATCCTCATCAGGTTTATT ATGATAGCAGTCCGTATCCTCAA

The data were analyzed by the comparative Cq method (34). Cq was recorded for the expression of each gene assayed in the RT-qPCR. All the Cq values were means of triplicate samples tested. GAPDH was chosen as the reference gene for the internal control. Differences between the Cq values of the target gene and the internal control gene (∆Cq = Cq target - Cq internal control) were calculated to normalize the differences. Differences between ∆Cq of each sample and calibrator ∆∆Cq = (Cq calibrator - ∆Cq) were calculated. The change in the gene expression was calculated as 2−∆∆Cq.

Statistical analysis

DAS software version 2.0 (DAS for eCDM; Shanghai University of Traditional Chinese Medicine, Shanghai, China) was used to calculate the pharmacokinetic parameters by non-compartmental model. Concentrations below the lower limit of quantify were treated as 0. Data analysis was performed using SPSS version 19.0 software (IBM Corp., Armonk, NY, USA). One-way analysis of variance was used for multiple comparisons, and post hoc testing was performed using Tukey if necessary, or comparisons between two groups were made using Student's t-test. Data are expressed as the mean ± standard deviation and mean ± standard error of the mean. P<0.05 was considered to indicate a statistically significant difference.

Results

Method validation (Tables II and III)

No endogenous interference was observed at retention times of MTX. The calibration curves were linear over the concentration range of 0.052–5.006 mg/l with correlation coefficients of 0.9983 for plasma samples and 0.020–5.000 mg/l for tissue samples, with correlation coefficients over 0.9981. RSD in rat plasma and tissues were measured to be ranged between 2.3–6.3% for intra-day precision, and 3.1–9.4% for inter-day precision. The accuracy obtained was between 87.3 and 109.8% with RSD <8.6%. The extraction recoveries of MTX in plasma and various tissues were ranged from 77–102% with RSD <8.1%. Stability study demonstrated that after 24 h at room temperature, three freeze-thaw cycles and 2 weeks of storage, the sample was stable and the RSD were within 9.8%.

SGR affects the pharmacokinetics of MTX significantly

The pharmacokinetics of mean concentration-time curves of MTX are presented in Fig. 1. In general, the maximal MTX concentration in serum occurred in 1 h and then gradually decreased to below detectable levels. This is consistent with previous studies (35,36). The plasma concentration profiles of MTX demonstrated nonlinear pharmacokinetics. The corresponding pharmacokinetic parameters are listed as the mean ± standard deviation and presented in Table IV. When co-administrated with SGR, MTX demonstrated a much lower concentration than when used alone. The Cmax was significantly decreased by 44.5% and the T1/2, Tmax were significantly prolonged by 92.8 and 398.9%, respectively. Although SGR significantly decreased AUC0-t of MTX (P<0.001), it still had marginal effect on AUC0-∞, demonstrating an elimination inhibiting effect. The concentration-time profile of MTX in the combination group remained level, and very similar to the profile of sustained release pharmaceuticals, in which the flat profile is as a result of continuous slow absorption. Concentration levels peaked at 6 h, indicating that there may be circulation between the gut and liver (Fig. 1).

Figure 1.

Mean plasma concentration-time curve of MTX treatment alone or combined with SGR, after oral administration to rats. Data are presented as the mean ± standard deviation (n=6 per group). *P<0.05 compared with MTX+SGR group at each time point. MTX, methotrexate; SGR, Smilax glabra Rhizoma.

Table IV.

Pharmacokinetic parameters of MTX in rats orally administered MTX alone and in combination with SGR (n=6 per group).

Table IV.

Pharmacokinetic parameters of MTX in rats orally administered MTX alone and in combination with SGR (n=6 per group).

ParametersMTXMTX + SGR
AUC0-t/mg/h/l 1.353±0.169 0.751±0.163c
AUC0-∞/mg/h/l 2.698±0.403 2.871±1.488
MRT0-t/h 4.008±0.309 4.551±0.274
T1/2/h 9.884±3.283 19.058±10.616a
Cmax/mg/l 0.218±0.059 0.113±0.047b
CL/L/h/kg 2.271±0.370 2.663±1.440
Tmax/h 0.902±0.683 4.5±2.665a

{ label (or @symbol) needed for fn[@id='tfn2-mmr-16-05-7633'] } Data are expressed as the mean ± standard deviation.

a P<0.05

b P<0.01

c P<0.001 vs. MTX. MTX, methotrexate; SGR, Smilax glabra Rhizoma; Tmax, time of peak serum level; Cmax, concentration of peak serum level; T1/2, elimination half-life; AUC0-t, area under serum concentration-time curve to the last point; CL/L, clearance over absolute bioavailability; MRT0-t, mean residence time.

SGR affects tissue distribution of MTX with a tissue dependent manner

The concentration of MTX in tissue homogenate at 20, 60 and 240 min after oral administration are presented in Figs. 2 and 3. When MTX was used alone, the Cmax in majority tissues were 20 min, indicating that MTX underwent a rapid and wide distribution from blood to tissues, and this is in accordance with its wide curative effect to different diseases. The highest concentration of MTX was observed in the small intestine and stomach (Fig. 2), followed by the plasma, liver, and kidney (Fig. 3). MTX concentrations were relatively low in the lung, spleen and marrow (Fig. 3), and the concentration of MTX in the heart was too low to test, which is roughly consistent with previous studies (37,38).

Figure 2.

Mean concentration of MTX in the stomach and small intestine at 20, 60 and 240 min after oral administration to rats. Data are presented as the mean ± standard error (n=6 per group). *P<0.05 compared with MTX+SGR group at 20 min. MTX, methotrexate; SGR, Smilax glabra Rhizoma.

Figure 3.

Mean concentration of MTX in the plasma, liver, kidney, lung, spleen and marrow tissues at 20, 60 and 240 min after oral administration to rats. Data are presented as the mean ± standard error. *P<0.05 compared with MTX+SGR group at each time point. MTX, methotrexate; SGR, Smilax glabra Rhizoma.

When co-administered with SGR, the concentration of MTX in tissues changed in a tissue- and time-dependent manner. Although the Tmax was at 20 min, the Cmax decreased significantly compared with MTX used alone. Cmax in the small intestine, stomach, plasma, liver and kidney were decreased by 74.9, 56.2, 70.4, 48.9 and 40.0%, respectively, at 20 min. Following that, the effect of SGR seemed to weaken; at the 1-h time point, SGR decreased the concentration of MTX in the plasma and kidney markedly, but increased the concentration of MTX in the stomach and lung; no obvious differences of MTX concentration were observed between the two groups at 240 min. This indicated a much slower elimination in most tissues when combined with SGR, and which is accorded with the pharmacokinetic study.

On the whole, the total exposure of MTX was also significantly reduced in the small intestine, stomach, plasma and kidney by 61.6, 34.7, 63.3 and 46.1%, respectively. Notably, the total exposure of MTX in the lung and spleen were increased by 82.9 and 21.0%, respectively. However, was no obvious change was observed in the marrow.

SGR enhances P-gp gene expression in intestine but has a marginal effect on other transporters

As the effect of SGR on the in vivo behavior of MTX mainly focused on absorption and excretion, the gene expression of transporters which all transport MTX such as P-gp, MRP3, organic anion transporting polypeptide (OATP2), MRP2 in the intestine and P-gp, OAT1, OAT2, MRP1 and MRP2 in the kidney, were studied. The results are presented in Figs. 4 and 5.

Figure 4.

Relative gene expression of P-gp, OATP2, MRP3 and MRP2 in the small intestine at 20 and 60 min. Data are presented as the mean ± standard error. *P<0.05 compared with MTX alone at each time point. MTX, methotrexate; SGR, Smilax glabra Rhizoma; P-gp, P-glyocoprotein; OATP2, organic anion transporting polypeptide; MRP, multidrug resistance-associated protein.

Figure 5.

Relative gene expression of OAT1, OAT2, P-gp, MRP1 and MRP2 in the kidney at 20 and 60 min. Data are presented as the mean ± standard error. *P<0.05 compared with MTX alone at each time point. MTX, methotrexate; SGR, Smilax glabra Rhizoma; P-gp, P-glyocoprotein; MRP, multidrug resistance-associated protein; OAT, organic ion transporter.

The effect of SGR on gene expression demonstrated a time-, transporter- and tissue-dependent manner. SGR increased P-gp mRNA expression in the small intestine by 2.54 times (P<0.05) at both 20 and 60 min time points, but had marginal effects on the gene expression of OATP2, MRP2 and MRP3 in the intestine at all the time points (Fig. 4), indicating that upregulation of P-gp expression is the main effect of SGR-induced MTX absorption decreasing. However, different from the results in intestine, SGR had a marginal effect on P-gp, OAT1 and OAT2 expression in the kidney, but increased the expression of MRP2 and MRP3. The result is coincidence with the concentration decreasing of MTX in kidney (Fig. 5). This indicated that SGR prolonged the retention time of MTX in plasma by increasing the expression of MRP1 and MRP2. This may be one of the reasons of the flat profile and low elimination rate of MTX in plasma.

Discussion

SGR was originally recorded by ‘Diannan Materia Medica’ in the Ming Dynasty of China (1368–1644), and officially listed in the Chinese Pharmacopeia (2015 edition) (39). The stipulated prescription dose is 15–60 g, and when SGR is generally consumed in tea or soup, the dosage often exceeds the prescribed dose. MTX and SGR are frequently used combination in the clinic; however, the benefits remain unclear (40). To the best of our knowledge, the present study was the first to examine the in vivo effects of SGR on the fate of MTX, and the results demonstrated that SGR affected the absorption, distribution and elimination significantly, and may induce significant DHI.

Drug concentration in plasma is significantly reduced in the intestines, stomach, liver and kidney, and it was hypothesized that SGR may affect the MTX treatment effect when used in the treatment of psoriasis, digestive tract cancer and systemic lupus erythematosus. Additionally, when patients are receiving MTX therapy and taking SGR at the same time, it is suggested that the dosing interval should be extended to prevent unnecessary toxic effect, due to the significant inhibition of the elimination of MTX by SGR.

In the present study, although SGR significantly decreased the concentration of MTX in most tissues, its concentration in the lung, spleen and marrow were not reduced; it increased the drug concentration of MTX in lung and spleen significantly. Therefore, in the treatment of various types of cancer, such splenic carcinoma, osteosarcoma, acute leucocythemia, malignant lymphoma and multiple myeloma (41), MTX co-administration with SGR may be helpful to enhance its tumoricidal effect while decreasing the toxicity such as nausea, vomiting, diarrhea and stomatitis.

MTX is the substrate of many transporters, as previously described. The efficacy and toxicity of MTX may be changed drugs used in combination affect transporter activity (42). Transporters have different expression levels in different tissues, and our previous study demonstrated that the effect of drugs on the activity of transporters depends on the protein amount (data not shown) (43,44). The RT-qPCR results indicated that SGR increased P-gp expression by 2.5 times in the intestine; thus, it was hypothesized that SGR-induced gene expression of P-gp may be the reason for MTX low absorption in intestine, and much lower Cmax in blood. This is consistent with a previous report that P-gp is associated with clinical responses to MTX (45,46) On the other hand, in the present study, SGR increased the expression of MRP1 and MRP2 in the kidney, but had a marginal effect on P-gp. This may be because P-gp had much higher expression in the intestine than in the kidney, and vice versa. This may partially explain the flat profile of MTX concentration over time. Elimination of drugs from blood is the total effect of all tissues, so the mechanism requires further study.

In recent years, flavonoids-rich botanical products have been used as dietary supplements worldwide. However, their safety remains unanswered (47). Additionally, the pharmacokinetics of other acidic pharmaceuticals such as probenecid, ciprofloxacin and penicillin, which ware putative substrates of P-gp, may also be affected by concurrent use of SGR (48,49) As the side effect of drugs raised concern, herbal treatment has attracted increasing attention, particularly a combination of herbs and drugs. Therefore, investigations into herb-drug interactions HDI are urgently required.

In conclusion, to the best of our knowledge, the present study demonstrated for the first time the potential benefits of co-administration of MTX with SGR. Co-administration of SGR may be beneficial for therapy of lung cancer and splenic carcinoma, osteosarcoma, and liver diseases, but may reduce the therapeutic effect of treating cancer in the digestive tract, systemic lupus erythematosus and psoriasis (50–54). The herb-drug interaction may be associated with the activity change of transporters.

Acknowledgements

The present study was supported by the Science and Technology Department Program of Guangdong Province of China (grant no. 2013B090700015), the Teamwork Project of Natural Science Foundation of Guangdong Province of China (grant no. S2013030011515) and the project of Traditional Chinese Medicine Hospital of Guangdong Province (grant nos. YK2013B1N11 and YN2014ZHR211).

References

1 

Jolivet J, Cowan KH, Curt GA, Clendeninn NJ and Chabner BA: The pharmacology and clinical use of methotrexate. N Engl J Med. 309:1094–1104. 1983. View Article : Google Scholar : PubMed/NCBI

2 

Samarasekera E, Sawyer L, Parnham J and Smith CH: Guideline Development Group: Assessment and management of psoriasis: Summary of NICE guidance. BMJ. 345:e67122012. View Article : Google Scholar : PubMed/NCBI

3 

Kuroda T, Namba K, Torimaru T, Kawashima K and Hayashi M: Species differences in oral bioavailability of methotrexate between rats and monkeys. Biol Pharm Bull. 23:334–338. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Carneiro-Filho BA, Lima IP, Araujo DH, Cavalcante MC, Carvalho GH, Brito GA, Lima V, Monteiro SM, Santos FN, Ribeiro RA and Lima AA: Intestinal barrier function and secretion in methotrexate-induced rat intestinal mucositis. Dig Dis Sci. 49:65–72. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Duman DG, Kumral ZN, Ercan F, Deniz M, Can G and Cağlayan Yeğen B: Saccharomyces boulardii ameliorates clarithromycin- and methotrexate-induced intestinal and hepatic injury in rats. Br J Nutr. 110:493–499. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Alarcón GS, Tracy IC and Blackburn WD Jr: Methotrexate in rheumatoid arthritis. Toxic effects as the major factor in limiting long-term treatment. Arthritis Rheum. 32:671–676. 1989. View Article : Google Scholar : PubMed/NCBI

7 

Wang J, Li Q, Ivanochko G and Huang Y: Anticancer effect of extracts from a North American medicinal plant-wild sarsaparilla. Anticancer Res. 26:2157–2164. 2006.PubMed/NCBI

8 

Galhena PB, Samarakoon SR, Thabrew MI, Weerasinghe GA, Thammitiyagodage MG, Ratnasooriya WD and Tennekoon KH: Anti-inflammatory activity is a possible mechanism by which the polyherbal formulation comprised of Nigella sativa (seeds), Hemidesmus indicus (root), and Smilax glabra (rhizome) mediates its antihepatocarcinogenic effects. Evid Based Complement Alternat Med. 2012:1086262012. View Article : Google Scholar : PubMed/NCBI

9 

Gao Y, Su Y, Qu L, Xu S, Meng L, Cai SQ and Shou C: Mitochondrial apoptosis contributes to the anti-cancer effect of Smilax glabra Roxb. Toxicol Lett. 207:112–120. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Ooi LS, Sun SS, Wang H and Ooi VE: New mannose-binding lectin isolated from the rhizome of sarsaparilla Smilax glabra Roxb. (Liliaceae). J Agric Food Chem. 52:6091–6095. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Lu CL, Zhu W, Wang M, Xu XJ and Lu CJ: Antioxidant and anti-inflammatory activities of phenolic-enriched extracts of Smilax glabra. Evid Based Complement Alternat Med. 2014:9104382014. View Article : Google Scholar : PubMed/NCBI

12 

Jiang J and Xu Q: Immunomodulatory activity of the aqueous extract from rhizome of Smilax glabra in the later phase of adjuvant-induced arthritis in rats. J Ethnopharmacol. 85:53–59. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Xia D, Fan Y, Zhang P, Fu Y, Ju M and Zhang X: Protective effects of the flavonoid-rich fraction from rhizomes of Smilax glabra Roxb. On carbon tetrachloride-induced hepatotoxicity in rats. J Membr Biol. 246:479–485. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Roubille C, Richer V, Starnino T, McCourt C, McFarlane A, Fleming P, Siu S, Kraft J, Lynde C, Pope J, et al: The effects of tumour necrosis factor inhibitors, methotrexate, non-steroidal anti-inflammatory drugs and corticosteroids on cardiovascular events in rheumatoid arthritis, psoriasis and psoriatic arthritis: A systematic review and meta-analysis. Ann Rheum Dis. 74:480–489. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Chen L, Yin Y, Yi H, Xu Q and Chen T: Simultaneous quantification of five major bioactive flavonoids in Rhizoma Smilacis Glabrae by high-performance liquid chromatography. J Pharm Biomed Anal. 43:1715–1720. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Shi L, Xu L, Yang Y, Song H, Pan H and Yin L: Suppressive effect of modified Simiaowan on experimental gouty arthritis: An in vivo and in vitro study. J Ethnopharmacol. 150:1038–1044. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Smith CH and Barker JN: Psoriasis and its management. BMJ. 333:380–384. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Wang Y: Clinical observation of combining traditional Chinese and western medicine treatment rheumatoid arthritis. J New Chin Med. 47:103–105. 2015.

19 

Goldman ID and Matherly LH: The cellular pharmacology of methotrexate. Pharmacol Ther. 28:77–102. 1985. View Article : Google Scholar : PubMed/NCBI

20 

Henderson GB: Folate-binding proteins. Annu Rev Nutr. 10:319–335. 1990. View Article : Google Scholar : PubMed/NCBI

21 

de Graaf D, Sharma RC, Mechetner EB, Schimke RT and Roninson IB: P-glycoprotein confers methotrexate resistance in 3T6 cells with deficient carrier-mediated methotrexate uptake. Proc Natl Acad Sci USA. 93:1238–1242. 1996; View Article : Google Scholar : PubMed/NCBI

22 

Masuda M, I'Izuka Y, Yamazaki M, Nishigaki R, Kato Y, Ni'inuma K, Suzuki H and Sugiyama Y: Methotrexate is excreted into the bile by canalicular multispecific organic anion transporter in rats. Cancer Res. 57:3506–3510. 1997.PubMed/NCBI

23 

Kusuhara H and Sugiyama Y: Role of transporters in the tissue-selective distribution and elimination of drugs: Transporters in the liver, small intestine, brain and kidney. J Control Release. 78:43–54. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Ranganathan P and McLeod HL: Methotrexate pharmacogenetics: The first step toward individualized therapy in rheumatoid arthritis. Arthritis Rheum. 54:1366–1377. 2006. View Article : Google Scholar : PubMed/NCBI

25 

El-Sheikh AA, van den Heuvel JJ, Koenderink JB and Russel FG: Interaction of nonsteroidal anti-inflammatory drugs with multidrug resistance protein (MRP) 2/ABCC2- and MRP4/ABCC4-mediated methotrexate transport. J Pharmacol Exp Ther. 320:229–235. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Sweet DH, Bush KT and Nigam SK: The organic anion transporter family: From physiology to ontogeny and the clinic. Am J Physiol Renal Physiol. 281:F197–F205. 2001.PubMed/NCBI

27 

Sweet DH: Organic anion transporter (Slc22a) family members as mediators of toxicity. Toxicol Appl Pharmacol. 204:198–215. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Wang XD, Meng MX, Gao LB, Liu T, Xu Q and Zeng S: Permeation of astilbin and taxifolin in Caco-2 cell and their effects on the P-gp. Int J Pharm. 378:1–8. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Piskula MK: Factors affecting flavonoids absorption. Biofactors. 12:175–180. 2000. View Article : Google Scholar : PubMed/NCBI

30 

O'Leary KA, Day AJ, Needs PW, Mellon FA, O'Brien NM and Williamson G: Metabolism of quercetin-7- and quercetin-3-glucuronides by an in vitro hepatic model: The role of human beta-glucuronidase, sulfotransferase, catechol-O-methyltransferase and multi-resistant protein 2 (MRP2) in flavonoid metabolism. Biochem Pharmacol. 65:479–491. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Van Aubel RA, Masereeuw R and Russel FG: Molecular pharmacology of renal organic anion transporters. Am J Physiol Renal Physiol. 279:F216–F232. 2000.PubMed/NCBI

32 

Hirohashi T, Suzuki H and Sugiyama Y: Characterization of the transport properties of cloned rat multidrug resistance-associated protein 3 (MRP3). J Biol Chem. 274:15181–15185. 1999. View Article : Google Scholar : PubMed/NCBI

33 

Wang M, Chen W, Wang Z, Lu C and Zhu W: HP-20 macroporous adsorption resin enrichment and purification of total flavonoids of glabrous greenbrier rhizome. Chin Tradit Patent Med. 37:2074–2078. 2015.(In Chinese).

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Jacobs SA, Stoller RG, Chabner BA and Johns DG: 7-Hydroxymethotrexate as a urinary metabolite in human subjects and rhesus monkeys receiving high dose methotrexate. J Clin Invest. 57:534–538. 1976. View Article : Google Scholar : PubMed/NCBI

36 

Kuijpers AL and van de Kerkhof PC: Risk-benefit assessment of methotrexate in the treatment of severe psoriasis. Am J Clin Dermatol. 1:27–39. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Oliverio VT and Zaharko DS: Tissue distribution of folate antagonists. Ann N Y Acad Sci. 186:387–399. 1971. View Article : Google Scholar : PubMed/NCBI

38 

Scheufler E, Zetler G and Iven H: Pharmacokinetics and organ distribution of methotrexate in the rat. Pharmacology. 23:75–81. 1981. View Article : Google Scholar : PubMed/NCBI

39 

Chinese Pharmacopoeia Commission: Pharmacopoeia of the People's Republic of China 2015. China Medical Science and Technology Press; Bejing: 2015, (In Chinese).

40 

Chinese Pharmacopoeia Commission: Pharmacopoeia of the People's Republic of China, the First Division. China Medical Science and Technology Press; Bejing: 2010, (In Chinese).

41 

Aquerreta I, Aldaz A, Giráldez J and Sierrasesúmaga L: Methotrexate pharmacokinetics and survival in osteosarcoma. Pediatr Blood Cancer. 42:52–58. 2004. View Article : Google Scholar : PubMed/NCBI

42 

Chiang HM, Fang SH, Wen KC, Hsiu SL, Tsai SY, Hou YC, Chi YC and Chao PD: Life-threatening interaction between the root extract of Pueraria lobata and methotrexate in rats. Toxicol Appl Pharmacol. 209:263–268. 2005. View Article : Google Scholar : PubMed/NCBI

43 

Zhao R, Liu L, Wang Y and Xiao Z: Vinegar-baked Radix Bupleuri modulates the cell membrane constituents and inhibits the P-gp activity in rat hepatocytes. BMC Complement Altern Med. 14:3572014. View Article : Google Scholar : PubMed/NCBI

44 

Zhao Y, Feng LM, Liu LJ, Zhang X and Zhao RZ: Clerosterol from vinegar-baked radix bupleuri modifies drug transport. Oncotarget. 8:21351–21361. 2017.PubMed/NCBI

45 

Takatori R, Takahashi KA, Tokunaga D, Hojo T, Fujioka M, Asano T, Hirata T, Kawahito Y, Satomi Y, Nishino H, et al: ABCB1 C3435T polymorphism influences methotrexate sensitivity in rheumatoid arthritis patients. Clin Exp Rheumatol. 24:546–554. 2006.PubMed/NCBI

46 

Grabar P Bohanec, Logar D, Lestan B and Dolzan V: Genetic determinants of methotrexate toxicity in rheumatoid arthritis patients: A study of polymorphisms affecting methotrexate transport and folate metabolism. Eur J Clin Pharmacol. 64:1057–1068. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Boušová I and Skálová L: Inhibition and induction of glutathione S-transferases by flavonoids: Possible pharmacological and toxicological consequences. Drug Metab Rev. 44:267–286. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Lin SP, Tsai SY, Hou YC and Chao PD: Glycyrrhizin and licorice significantly affect the pharmacokinetics of methotrexate in rats. J Agric Food Chem. 57:1854–1859. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Yang SY, Juang SH, Tsai SY, Chao PD and Hou YC: St. John's wort significantly increased the systemic exposure and toxicity of methotrexate in rats. Toxicol Appl Pharmacol. 263:39–43. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Hirota BC, Paula CD, de Oliveira VB, da Cunha JM, Schreiber AK, Ocampos FM, Barison A, Miguel OG and Miguel MD: Phytochemical and antinociceptive, anti-inflammatory, and antioxidant studies of Smilax larvata (Smilacaceae). Evid Based Complement Alternat Med. 2016:98946102016. View Article : Google Scholar : PubMed/NCBI

51 

She T, Zhao C, Feng J, Wang L, Qu L, Fang K, Cai S and Shou C: Sarsaparilla (Smilax glabra Rhizome) extract inhibits migration and invasion of cancer cells by suppressing TGF-β1 pathway. PLoS One. 10:e01182872015. View Article : Google Scholar : PubMed/NCBI

52 

She T, Qu L, Wang L, Yang X, Xu S, Feng J, Gao Y, Zhao C, Han Y, Cai S and Shou C: Sarsaparilla (Smilax glabra Rhizome) extract inhibits cancer cell growth by S phase arrest, apoptosis, and autophagy via redox-dependent ERK1/2 pathway. Cancer Prev Res (Phila). 8:464–474. 2015. View Article : Google Scholar : PubMed/NCBI

53 

Samarakoon SR, Thabrew I, Galhena PB and Tennekoon KH: Modulation of apoptosis in human hepatocellular carcinoma (HepG2 cells) by a standardized herbal decoction of Nigella sativa seeds, Hemidesmus indicus roots and Smilax glabra rhizomes with anti-hepatocarcinogenic effects. BMC Complement Altern Med. 12:252012. View Article : Google Scholar : PubMed/NCBI

54 

Ooi LS, Wong EY, Chiu LC, Sun SS and Ooi VE: Antiviral and anti-proliferative glycoproteins from the rhizome of Smilax glabra Roxb (Liliaceae). Am J Chin Med. 36:185–195. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Y, Deng S, Ζhao Y, Liu L and Zhao R: Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration. Mol Med Rep 16: 7633-7640, 2017.
APA
Li, Y., Deng, S., Ζhao, Y., Liu, L., & Zhao, R. (2017). Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration. Molecular Medicine Reports, 16, 7633-7640. https://doi.org/10.3892/mmr.2017.7559
MLA
Li, Y., Deng, S., Ζhao, Y., Liu, L., Zhao, R."Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration". Molecular Medicine Reports 16.5 (2017): 7633-7640.
Chicago
Li, Y., Deng, S., Ζhao, Y., Liu, L., Zhao, R."Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration". Molecular Medicine Reports 16, no. 5 (2017): 7633-7640. https://doi.org/10.3892/mmr.2017.7559
Copy and paste a formatted citation
x
Spandidos Publications style
Li Y, Deng S, Ζhao Y, Liu L and Zhao R: Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration. Mol Med Rep 16: 7633-7640, 2017.
APA
Li, Y., Deng, S., Ζhao, Y., Liu, L., & Zhao, R. (2017). Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration. Molecular Medicine Reports, 16, 7633-7640. https://doi.org/10.3892/mmr.2017.7559
MLA
Li, Y., Deng, S., Ζhao, Y., Liu, L., Zhao, R."Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration". Molecular Medicine Reports 16.5 (2017): 7633-7640.
Chicago
Li, Y., Deng, S., Ζhao, Y., Liu, L., Zhao, R."Smilax glabra Rhizoma affects the pharmacokinetics and tissue distribution of methotrexate by increasing the P‑glycoprotein mRNA expression in rats after oral administration". Molecular Medicine Reports 16, no. 5 (2017): 7633-7640. https://doi.org/10.3892/mmr.2017.7559
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team