Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma

  • Authors:
    • Shuyang Hu
    • Qing Ouyang
    • Qingbao Cheng
    • Jinghan Wang
    • Feiling Feng
    • Liang Qiao
    • Wei Gan
    • Yang Shi
    • Demin Wu
    • Xiaoqing Jiang
  • View Affiliations / Copyright

    Affiliations: First Department of Biliary Surgery, Eastern Hepatobiliary Surgical Hospital, The Second Military Medical University, Shanghai 200438, P.R. China
  • Pages: 6028-6032
    |
    Published online on: February 8, 2018
       https://doi.org/10.3892/mmr.2018.8573
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Cholangiocarcinoma (CCA) is an aggressive malignant tumor and the prognosis of patients with advanced stage disease remains poor. Therefore, the identification of novel treatment agents for CCA is required. In the present study, the biological effects of the diabetes therapeutic agent, phenformin, in CCA cell lines was investigated. Cell Counting Kit‑8 cell viability, cellular clone formation and subcutaneous tumor formation assays were performed, which revealed that phenformin inhibited CCA cell proliferation and growth both in vitro and in vivo. In addition, phenformin induced CCA cell apoptosis and autophagy. Phenformin partly activated the liver kinase B1 (LKB1)/5' AMP‑activated protein kinase signaling pathway to exert its biological effects on CCA cell lines, as demonstrated by knockdown of LKB1, which reversed these effects. In conclusion, the present study demonstrated the biological effects of phenformin in CCA and suggested that phenformin may be a potential novel agent for CCA treatment.

Introduction

Cholangiocarcinoma (CCA) is a malignant tumor that arises from the epithelial cells in intrahepatic or extrahepatic bile ducts, and is difficult to diagnose and has a poor prognosis (1–3). Although surgical resection and liver transplantation are potentially curative treatments, the majority of patients present with unresectable tumors and succumb to disease within a year of diagnosis (4). CCA is frequently resistant to chemotherapy as results of monotherapy and combination chemotherapy are often disappointing (5–7). Therefore, finding novel chemical agents for the treatment of CCA is required.

The diabetes therapeutic biguanide compound, phenformin, has been demonstrated to inhibit complex I of the mitochondria (8). In previous studies, phenformin was identified to inhibit tumor growth in xenograft, transgenic and carcinogen-induced mouse cancer models (9,10). As phenformin increases intracellular adenosine monophosphate (AMP) and adenosine diphosphate and subsequently induces the activation of liver kinase B1 (LKB1)/5′ AMP-activated protein kinase(AMPK) signaling. The LKB1/AMPK axis may inhibit cancer cell proliferation and growth and functions as a tumor suppressive signaling pathway (8). Phenformin has the potential to be a novel agent that inhibits CCA cell proliferation and tumor growth.

In the present study, CCA cell lines were treated with phenformin and the biological effects were observed. Phenformin inhibited CCA cell proliferation and tumor growth and induced cell apoptosis and autophagy.

Materials and methods

Cell culture

BE and Huh28 human CCA cell lines were purchased from American Type Culture Collection (Manassas, VA, USA) and were maintained under standard culture conditions (37°C and 5% CO2) in RPMI 1640 supplement with 10% (v/v) FBS (both Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

RNA isolation and quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNA was purified from CCA cells or CCA adjacent tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 1 µg RNA was reverse transcribed using SuperScript Reverse Transcriptase II (Invitrogen; Thermo Fisher Scientific, Inc.) in 37°C for 1 h. RT-qPCR was performed using SYBR® Green Supermix (4473369; Applied Biosystems; Thermo Fisher Scientific, Inc.) on an Applied Biosystems 7500 PCR system with the following program: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 31 sec, and finally 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. The relative expression of each gene was analyzed by the comparative cycle threshold method (2−ΔΔCq method) (11) which was normalized to GAPDH. Primers used in the present study are described in Table I.

Table I.

Sequences of primers and siRNAs.

Table I.

Sequences of primers and siRNAs.

NameSequence (5′-3′)
BECN1F, TGGACACGAGTTTCAAGATCC
R, CTCCTGGGTCTCTCCTGGTT
ATG5F, AAAGATGTGCTTCGAGATGTGT
R, CACTTTGTCAGTTACCAACGTCA
ATG7F, ATGATCCCTGTAACTTAGCCCA
R, CACGGAAGCAAACAACTTCAAC
GAPDHF, AGCCTCAAGATCATCAGCAATGCC
R, TGTGGTCATGAGTCCTTCCACGAT
siRNA-NC ACGUGACACGUUCGGAGAATT
siRNA-LKB1 CTGGTTGATACCCACTCAAAAAG

[i] siRNA, short interfering RNA; BECN1, Beclin1 gene; ATG5, autophagy 5 gene; ATG7, autophagy 7 gene; NC, negative control; LKB1, liver kinase B1; F, forward; R, reverse.

Western blotting

Cells were lysed in IP lysis buffer (catalog no. P0013, Beyotime Institute of Biotechnology, Haimen, China), according to the manufacturer's protocol. Subsequently, the protein concentration was measured by BCA assay kit (Thermo Fisher Scientific, Inc.) and cell lysates were boiled in 5X SDS-PAGE loading buffer for 10 min and resolved by 8% SDS-PAGE prior to transfer onto a nitrocellulose membrane. The membrane was blocked by 5% (m/v) non-fat milk (BD Biosciences, Franklin Lakes, NJ, USA). The following primary antibodies were used: LKB1 (3047;1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), phosphorylated (p)-AMPK (2532; 1:1,000; Cell Signaling Technology, Inc.), AMPK (2532; 1:1,000; Cell Signaling Technology, Inc.) and GAPDH (60004-1-Ig; 1:5,000; ProteinTech Group, Inc., Chicago, IL, USA). All these antibodies were incubated at 4°C overnight. Then the membranes were incubated with HRP-linked anti-rabbit IgG (7074; 1:2,000; Cell Signaling Technology, Inc.) or HRP-linked anti-mouse IgG (7076, 1:2,000; Cell Signaling Technology, Inc.) for 1 h at room temperature. Proteins were then visualized with an Enhanced Chemiluminescence kit (Thermo Fisher Scientific, Inc.).

Cell Counting Kit-8 (CCK-8) cell viability assays

Cells were seeded into a 96-well plate at 3×103 cells per well with 100 µl culture medium containing 0 or 2 mM phenformin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and cultured at 37°C and 5% CO2 for 12, 24 or 48 h. The cell viability was quantified by addition 10 µl of CCK-8 reagent (Dojindo Molecular Technologies, Inc., Kumamoto, Japan). After a 1.5 h incubation, the optical density (OD) was measured using a Power Wave XS microplate reader (Omega Bio-Tek, Inc., Norcross, GA, USA) at a wavelength of 450 nm.

Colony formation assays

A total of 500 cells/well were seeded in 6-well plates and incubated for 10 days at 37°C and 5% CO2. Colonies were fixed and stained with 0.5% crystal violet at room temperature and the number of colonies was counted.

Flow cytometry cell apoptosis assays

A total of 2×105 cells/well were seeded into 6-well plates and treated with 0 or 2 mM phenformin in an incubator at 37°C. After 24 h, cells were washed twice with 1X cold PBS, and stained with Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI; BD Biosciences, Franklin Lakes, NJ, USA), according to the manufacture's protocol. BD FACSCalibur (BD Biosciences) was used for the detection and CellQuest Pro software (BD Biosciences) for the analysis.

In vivo tumor formation assay

A total of 10 male BALB/c (nu/nu) mice (Shanghai SLAC Laboratory Animal Co., Ltd.; 5 weeks old, mean weight 15 g) were kept at 25°C and 45% humidity with 12-h light/dark cycle with free access to sterile food and water. Then, 4×106 RBE cells were subcutaneously injected into the right flank of the mice. After 2 weeks, the mice were intratumorally injected with 0 (physiological saline) or 2 mM phenformin (5 mice/group) every 4 days for a month. Tumor sizes were measured once a week and mice were sacrificed for the analysis of tumor burden after 4 weeks. The procedures in the present study were approved by the Ethics Committee of the Second Military Medical University (Shanghai, China).

siRNA treatment

The sequences for LKB1 siRNAs are described in Table I. A total of 3×105 RBE and Huh28 cells were transfected with 100 nM LKB1 siRNA or with 100 nM negative control siRNA (Table I) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). After 24 h these transfected cell lines were used to perform the subsequent assays.

Statistical analysis

Data are expressed as the mean ± standard deviation; two-way analysis of variance followed by the LSD post-hoc test was performed for comparisons between groups. GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA) was used for analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Phenformin inhibits CCA cell line proliferation and growth in vitro and in vivo

An inhibitor of mitochondrial complex 1, phenformin, has been demonstrated to inhibit tumor growth in lung cancer and delay tumor progression in a lymphoma mouse model (8). In the present study, CCK-8 assays were performed after treating two CCA cell lines, RBE and Huh28, with 2 mM phenformin. Phenformin significantly inhibited the proliferation of these cell lines compared with cells treated with 0 mM, after 12, 24 and 48 h (Fig. 1A). Clone formation assays revealed that phenformin significantly inhibited the ability of the cell lines to form clones compared with cells treated with 0 mM phenformin (P<0.01; Fig. 1B). Subcutaneous tumor formation assays revealed that mice injected with 2 mM phenformin exhibited a significantly smaller RBE tumor volume compared with the 0 mM control group after 28 days (P<0.01; Fig. 1C). These results suggested that phenformin inhibits CCA cell proliferation and growth in vitro and in vivo.

Figure 1.

Phenformin inhibits CCA cell line proliferation and growth. (A) Phenformin inhibits the proliferation of RBE and Huh28CCA cell lines. (B) Cellular clone formation assays indicated that phenformin inhibited RBE and Huh28 cell growth. (C) Subcutaneous tumor formation assays suggested that phenformin inhibited RBE cell proliferation and growth in vivo, n=5. *P<0.05, **P<0.01 and ***P<0.0001 0 mM phenformin. In vitro assays were performed in triplicate. CCA, cholangiocarcinoma; Phen, phenformin.

Phenformin induces CCA cell apoptosis and autophagy

As phenformin inhibited cell proliferation, the role of phenformin in CCA cell apoptosis and autophagy was determined. When cells were treated with 2 mM phenformin for 24 h, a significant amount of cell death was observed compared with cells treated with 0 mM phenformin (P<0.01; Fig. 2A). In addition, the mRNA expression levels of autophagy-associated genes, Beclin-1 (BECN1), autophagy (ATG)5 and ATG7 (12) were upregulated after treatment with 2 mM phenformin in the two cell lines compared with cells treated with 0 mM phenformin (Fig. 2B). These findings suggested that phenformin induces CCA cell apoptosis and autophagy.

Figure 2.

Phenformin promotes cholangiocarcinoma cell line apoptosis and autophagy. (A) Annexin V-FITC/PI cell apoptosis assays revealed that phenformin induces apoptosis in RBE and Huh28 cells. (B) mRNA expression levels of autophagy-associated genes, BECN1, ATG5 and ATG7, were elevated following 24 h phenformin treatment in RBE and Huh28 cells. **P<0.01 vs 0 mM phenformin. Assays were performed in triplicate. FITC, fluorescein isothiocyanate; PI, propidium iodide; BECN1, Beclin1 gene; ATG5, autophagy 5 gene; ATG7, autophagy 7 gene.

Phenformin exerts its effects via the LKB1/AMPK axis in CCA

A previous study revealed that phenformin induces apoptosis in LKB1-deficient non-small cell lung cancer cell lines (13). This finding suggests that phenformin may activate the LKB1/AMPK signaling pathway to inhibit CCA cell proliferation and induce apoptosis and autophagy. In the present study, the protein expression levels of LKB1 was reduced in RBE and Huh28 cell lines following knockdown of LKB1 using a specific siRNA, compared with cells treated with negative control siRNA (Fig. 3A). The expression levels of the target of LKB1, p-AMPK, following knockdown of LKB1 in the cell lines was measured after treatment with phenformin. Knockdown of LKB1 reduced the expression levels of p-AMPK when treated with phenformin for 12 h (Fig. 3B). In addition, the cell viability was reduced in LKB1 knockdown cells with phenformin treatment, as determined by a CCK-8 cell viability assay (Fig. 3C). The mRNA expression levels of autophagy-associated genes, BECN1, ATG5 and ATG7, were reduced in LKB1 knockdown cell lines treated with phenformin, compared with cells transfected with negative control siRNA (P<0.01; Fig. 3D). These results suggested that phenformin exerts its effects via activation of the LKB1/AMPK signaling pathway.

Figure 3.

Phenformin exerts its effects via the LKB1/AMPK axis in cholangiocarcinoma cell lines. (A) Protein expression levels of LKB1 were reduced following transfection of cells with an LKB1-specific siRNA. (B) Knockdown of LKB1 inhibited the activation and phosphorylation of AMPK in the two cell lines following treatment with 2 mM phenformin. (C) Knockdown LKB1 significantly inhibited the cell viability of the two cell lines. (D) mRNA expression levels of autophagy-associated genes, BECN1, ATG5 and ATG7, were reduced following knockdown of LKB1 in cell lines treated with phenformin for 24 h. Assays were performed in triplicate. *P<0.05 and **P<0.01 vs. siRNA-NC. NC, negative control; BECN1, Beclin1 gene; ATG5, autophagy 5 gene; ATG7, autophagy 7 gene; LKB1, liver kinase B1; AMPK, 5′ AMP-activated protein kinase; Phen, phenformin; siRNA; short interfering RNA.

Discussion

The present study investigated the biological effects of phenformin in CCA cell lines and demonstrated that phenformin inhibited CCA cell proliferation and growth and induced cell apoptosis and autophagy.

Phenformin is a biguanide compound and paralog to metformin, which is widely used in as a therapy for type 2 diabetes worldwide (14). Phenformin has been previously demonstrated to exhibit potential anti-cancer properties. Shackelford et al (13) revealed that phenformin inhibits LKB1-deficient non-small cell lung cancer progression. Liu et al (15) reported that phenformin induces cell cycle alterations and apoptosis in breast cancer. Cancer cells exhibit alterations in cellular metabolism to enable their continued growth and proliferation (16,17). Phenformin is a biguanide compound that inhibits complex 1 of mitochondria, resulting in increased intracellular AMP and ADP that induces the LKB1/AMPK signaling loop (8). AMPK is a conserved sensor of intracellular energy levels (18) and phenformin treatment and the activation of the LKB1/AMPK signaling pathway may significantly inhibit anabolic pathways and cell proliferation (19). In the present study, phenformin significantly inhibited CCA cell proliferation and induced cell apoptosis and autophagy. These effects may be induced by the LKB1/AMPK signaling pathway in CCA cell lines.

Wang et al (20) reported that LKB1 is frequently downregulated in CCA tissues. The findings of the present study suggested that silencing of LKB1 in combination with phenformin led to these cells being more susceptible to death. The current findings suggest that Phenformin has the potential to be a therapeutic agent for CCA treatment.

Acknowledgements

The present study was funded by The National Natural Science Fund (grant no. 81472280).

References

1 

Bismuth H, Nakache R and Diamond T: Management strategies in resection for hilar cholangiocarcinoma. Ann Surg. 215:31–38. 1992. View Article : Google Scholar : PubMed/NCBI

2 

Lim J and Park C: Pathology of cholangiocarcinoma. Abdom Imaging. 29:540–547. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Khan SA, Toledano MB and Taylor-Robinson SD: Epidemiology, risk factors, and pathogenesis of cholangiocarcinoma. HPB (Oxford). 10:77–82. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Khan SA, Davidson BR, Goldin R, Pereira SP, Rosenberg WM, Taylor-Robinson SD, Thillainayagam AV, Thomas HC, Thursz MR and Wasan H; British Society of Gastroenterology, : Guidelines for the diagnosis and treatment of cholangiocarcinoma: Consensus document. Gut. 51 Suppl 6:VI1–VI9. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Anderson CD, Pinson CW, Berlin J and Chari RS: Diagnosis and treatment of cholangiocarcinoma. Oncologist. 9:43–57. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Khan SA, Davidson BR, Goldin RD, Heaton N, Karani J, Pereira SP, Rosenberg WM, Tait P, Taylor-Robinson SD, Thillainayagam AV, et al: Guidelines for the diagnosis and treatment of cholangiocarcinoma: An update. Gut. 61:1657–1669. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Knol JA and Pelletier SJ: Primary Carcinomas of the Liver. Surgical treatment: Resection and transplantation. Cambridge University Press; Cambridge: pp. 177–194. 2009

8 

Hawley SA, Ross FA, Chevtzoff C, Green KA, Evans A, Fogarty S, Towler MC, Brown LJ, Ogunbayo OA, Evans AM and Hardie DG: Use of cells expressing γ subunit variants to identify diverse mechanisms of AMPK activation. Cell Metab. 11:554–565. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Algire C, Amrein L, Bazile M, David S, Zakikhani M and Pollak M: Diet and tumor LKB1 expression interact to determine sensitivity to anti-neoplastic effects of metformin in vivo. Oncogene. 30:1174–1182. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Memmott RM, Mercado JR, Maier CR, Kawabata S, Fox SD and Dennis PA: Metformin prevents tobacco carcinogen-induced lung tumorigenesis. Cancer Prev Res (Phila). 3:1066–1076. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Pyo JO, Yoo SM and Jung YK: The interplay between autophagy and aging. Diabates Metab J. 37:333–339. 2013. View Article : Google Scholar

13 

Shackelford DB, Abt E, Gerken L, Vasquez DS, Seki A, Leblanc M, Wei L, Fishbein MC, Czernin J, Mischel PS and Shaw RJ: LKB1 inactivation dictates therapeutic response of non-small cell lung cancer to the metabolism drug phenformin. Cancer Cell. 23:143–158. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Davidson MB and Peters AL: An overview of metformin in the treatment of type 2 diabetes mellitus. Am J Med. 102:99–110. 1997. View Article : Google Scholar : PubMed/NCBI

15 

Liu Z, Ren L, Liu C, Xia T, Zha X and Wang S: Phenformin induces cell cycle change, apoptosis, and mesenchymal-epithelial transition and regulates the AMPK/mTOR/p70s6k and MAPK/ERK pathways in breast cancer cells. PloS One. 10:e01312072015. View Article : Google Scholar : PubMed/NCBI

16 

Muñoz-Pinedo C, El Mjiyad N and Ricci JE: Cancer metabolism: Current perspectives and future directions. Cell Death Dis. 3:e2482012. View Article : Google Scholar : PubMed/NCBI

17 

Kroemer G and Pouyssegur J: Tumor cell metabolism: Cancer's Achilles' heel. Cancer Cell. 13:472–482. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Shaw RJ: Glucose metabolism and cancer. Curr Opin Cell Biol. 18:598–608. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Shackelford DB and Shaw RJ: The LKB1-AMPK pathway: Metabolism and growth control in tumour suppression. Nat Rev Cancer. 9:563–575. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Wang J, Zhang K, Wang J, Wu X, Liu X, Li B, Zhu Y, Yu Y, Cheng Q, Hu Z, et al: Underexpression of LKB1 tumor suppressor is associated with enhanced Wnt signaling and malignant characteristics of human intrahepatic cholangiocarcinoma. Oncotarget. 6:18905–18920. 2015.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hu S, Ouyang Q, Cheng Q, Wang J, Feng F, Qiao L, Gan W, Shi Y, Wu D, Jiang X, Jiang X, et al: Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma. Mol Med Rep 17: 6028-6032, 2018.
APA
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L. ... Jiang, X. (2018). Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma. Molecular Medicine Reports, 17, 6028-6032. https://doi.org/10.3892/mmr.2018.8573
MLA
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L., Gan, W., Shi, Y., Wu, D., Jiang, X."Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma". Molecular Medicine Reports 17.4 (2018): 6028-6032.
Chicago
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L., Gan, W., Shi, Y., Wu, D., Jiang, X."Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma". Molecular Medicine Reports 17, no. 4 (2018): 6028-6032. https://doi.org/10.3892/mmr.2018.8573
Copy and paste a formatted citation
x
Spandidos Publications style
Hu S, Ouyang Q, Cheng Q, Wang J, Feng F, Qiao L, Gan W, Shi Y, Wu D, Jiang X, Jiang X, et al: Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma. Mol Med Rep 17: 6028-6032, 2018.
APA
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L. ... Jiang, X. (2018). Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma. Molecular Medicine Reports, 17, 6028-6032. https://doi.org/10.3892/mmr.2018.8573
MLA
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L., Gan, W., Shi, Y., Wu, D., Jiang, X."Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma". Molecular Medicine Reports 17.4 (2018): 6028-6032.
Chicago
Hu, S., Ouyang, Q., Cheng, Q., Wang, J., Feng, F., Qiao, L., Gan, W., Shi, Y., Wu, D., Jiang, X."Phenformin inhibits cell proliferation and induces cell apoptosis and autophagy in cholangiocarcinoma". Molecular Medicine Reports 17, no. 4 (2018): 6028-6032. https://doi.org/10.3892/mmr.2018.8573
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team