Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2018 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing

  • Authors:
    • Gang Li
    • Xuehai Wang
    • Qingsong Luo
    • Chongzhi Gan
  • View Affiliations / Copyright

    Affiliations: Department of Thoracic Surgery, Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital, Chengdu, Sichuan 610072, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 6456-6464
    |
    Published online on: March 1, 2018
       https://doi.org/10.3892/mmr.2018.8656
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Celecoxib is an inhibitor of cyclooxygenase-2, a gene that is often aberrantly expressed in the lung squamous cell carcinoma (LSQCC). The present study aims to provide novel insight into chemoprevention by celecoxib treatment. The human LSQCC cell line SK‑MES‑1 was treated with or without celecoxib and RNA‑sequencing (RNA‑seq) was performed on the Illumina HiSeq 2000 platform. Expression levels of genes or long non‑coding RNAs (lncRNAs) were calculated by Cufflinks software. Subsequently, differentially expressed genes (DEGs) and differentially expressed lncRNAs (DE‑LNRs) between the two groups were selected using the limma package and LNCipedia 3.0, respectively; followed by co‑expression analysis based on their expression correlation coefficient (CC). Enrichment analysis for the DEGs and co‑expressed DE‑LNRs were performed. Protein‑protein interaction (PPI) network analysis for DEGs was performed using STRING database. A set of 317 DEGs and 25 DE‑LNRs were identified between celecoxib‑treated and non‑treated cell lines. A total of 12 pathways were enriched by the DEGs, including ‘protein processing in endoplasmic reticulum’ for activating transcription factor 4 (ATF4), ‘mammalian target of rapamycin (mTOR) signaling pathway’ for vascular endothelial growth factor A (VEGFA) and ‘ECM‑receptor interaction’ for fibronectin 1 (FN1). Genes such as VEGFA, ATF4 and FN1 were highlighted in the PPI network. VEGFA was linked with lnc‑AP000769.1‑2:10 (CC= ‑0.99227), whereas ATF4 and FN1 were closely correlated with lnc‑HFE2‑2:1 (CC=0.996159 and ‑0.98714, respectively). lncRNAs were also enriched in pathways such as ‘mTOR signaling pathway’ for lnc‑HFE2‑2:1. Several important molecules were identified in celecoxib‑treated LSQCC cell lines, such as VEGFA, ATF4, FN1, lnc‑AP000769.1‑2:10 and lnc‑HFE2‑2:1, which may enhance the anti‑cancer effects of celecoxib on LSQCC.

Introduction

Lung cancer is one of the most frequently diagnosed cancers with high mortality worldwide, with >1,500,000 new cases diagnosed annually (1,2). Based on the cancer statistics data from 2015, lung and bronchial cancers are expected to have the highest mortality among all cancers in the USA, with the estimated mortality rate of 158,040 (3). Lung squamous cell carcinoma (LSQCC) is the second most common type of lung cancer, with an annual mortality rate of ~400,000 worldwide (4). Chemotherapy and radiotherapy are the most common treatments for LSQCC; however, patient responses to these therapies are limited (5). Therefore, there is a requirement for additional agents to be developed that may enhance the response to these treatments.

Cyclooxygenase (COX)-2 serves an important role in the tumorigenesis of various types of cancer, and COX-2 inhibitors may effectively prevent tumor progression (6). Celecoxib is a selective COX-2 inhibitor; at the early stages of non-small-cell lung cancer (NSCLC), celecoxib was reported to increase the anti-cancer properties of preoperative chemotherapies, such as paclitaxel and carboplatin (7). In addition, celecoxib treatment upregulated the expression of death receptor 5 (DR5), decreased cell survival and induced apoptosis in NSCLCs (8). Increased expression of COX-2 has been reported in LSQCC, and its inhibitor celecoxib is predicted as the beneficial target for chemotherapy (9). Although these previous studies have implied that celecoxib enhances the response sensitivity of chemotherapy in LSQCC, the specific molecular mechanisms of this inhibitor are still unknown. Several previous studies have indicated that celecoxib treatment may result in cell cycle arrest by downregulating the expression of p21 and p27, which may account for the reduction of cyclin-dependent kinase activity (10,11). In addition, celecoxib may contribute to the inhibition of angiogenesis by suppressing the expression of angiogenic factors in tumor cells (12). However, additional studies are required to comprehensively determine the mechanism of celecoxib on chemoprevention.

Long noncoding RNAs (lncRNAs) are a recently described RNA transcript species that is different from mRNAs and microRNAs. They are not transcriptional ‘noise’, but are important genes that function in numerous biological processes (13,14). Currently, several lncRNAs have been identified with significant functions in lung cancer; for example, the upregulation of PVT1 was reported to promote oncogenesis in NSCLCs (15), and prostate cancer-associated transcript 6 was predicted as an oncogenic lncRNA in the growth and invasion of lung cancer cells (16). In addition, a recent study demonstrated that the novel lncRNA onco-lncRNA 230 was able to induce invasion and apoptosis in LSQCC, and it was suggested as a possible new diagnostic marker for the disease (17). These imply that regulation of lncRNAs serves a key role in LSQCC. However, lncRNA expression under celecoxib treatment has not been reported. A previous study demonstrated that celecoxib treatment (50 µM) induced significant overexpression of Bcl-2, Bcl-extra large and survivin following 24 h treatment, whereas no significant alterations in expression were identified in the activation of caspase-3, caspase-8 or caspase-9 (18). Another study revealed that the expression of multidrug resistance-associated-4, a member of the ATP-binding cassette transporters, was significantly upregulated in human LSQCC SK-MES-1 cells following treatment with 5 and 50 µmol/l of celecoxib for 24, 48 and 72 h (19). These data suggested that celecoxib treatment may induce a series of variations in the metabolism of SK-MES-1 cells; however, no lncRNAs have been identified. Therefore, the present study used RNA-sequencing (RNA-seq), which facilitates transcript analysis in various cancers (20), to identify differentially expressed genes (DEGs) and differentially expressed lncRNAs (DE-LNRs) between SK-MES-1 cells cultured with or without celecoxib treatment. In addition, potential correlations were calculated, followed by pathway exploration of the lncRNAs. This study aimed to provide novel insight into celecoxib chemoprevention and to identify potential targeting markers for COX-2 induced LSQCC.

Materials and methods

Cell culture and drug treatment

The human LSQCC cell line SK-MES-1 was purchased from the Cell Bank of Type Culture Collection Chinese Academy of Sciences (Shanghai, China). Cells were cultured in the RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), at 37°C and 5% CO2.

Cells at the logarithmic growth phase (at a confluency of 70–75%) were divided into two groups: i) Two identical SK-MES-1 cell samples were treated with 10 µM celecoxib in 1% DMSO medium (celecoxib-treated group); and ii) two identical SK-MES-1 cell samples were treated with equal amounts of DMSO (Control group). Both groups were cultured for 48 h at 37°C.

RNA extraction and RNA-seq

A total of 5×107 cells were utilized to isolate RNA using the RNeasy kit (catalog no. 74106; Qiagen Sciences, Inc., Gaithersburg, MD, USA) according to the manufacturer's protocol. RNA purity was analyzed with a NanoDrop 2000 spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.), and the RNA was reverse transcribed into cDNA for library preparation using NEBNext Ultra RNA Library Prep kit for Illumina (catalog no. E7530L; New England BioLabs, Inc., Ipswich, MA, USA), following the manufacturer's protocol. Briefly, RNA (5 µg) from each sample was sheared into small fragments (200 nucleotides) prior to cDNA synthesis using fragment buffer. Subsequently, the cDNA was blunt-ended and phosphorylated. A single 3′ adenosine moiety and Illumina adapters were added on the repaired ends, followed by 15 cycles of polymerase chain reaction (PCR) according to the protocol of the kit. preamplification were performed using the NEB Phusion DNA polymerase (New England BioLabs, Inc.). RNA-seq was performed on the Illumina Hiseq 2000 Sequencing System (Illumina, Inc., San Diego, CA, USA) using the 2×50 paired-end sequencing method.

Pretreatment of RNA-seq data

Quality control (QC) of raw sequencing reads was performed using the next generation sequencing (NGS) QC Toolkit, as previously described (21). Briefly, the adaptor sequences in the reads were removed, and the low-quality reads with the base quality score <20 were filtered out. High quality sequences were defined having bases with a quality score >20 that accounted for >90% of its length. Subsequently, the clean reads were aligned against the University of California Santa Cruz Homo sapiens reference genome (hg19 assembly, http://www.genome.ucsc.edu/index.html) using TopHat2 software (v2.0.9; http://ccb.jhu.edu/software/tophat) with the default parameters (22).

Identification of DEGs

Cufflinks (v2.2.1; http://cufflinks.cbcb.umd.edu/index.html) software was used to calculate the fragments per kilobase of exon per million fragments mapped (FPKM), from which the gene expression values were obtained (23). The linear models for microarray analysis (limma; v3.10.3) package in R (http://www.bioconductor.org/packages/release/bioc/html/limma.html) was used to select DEGs between the two groups (24), with the thresholds of q-value<0.05 and |log2(FC)|>0.58; where FC is fold change.

Selection of DE-LNRs

LNCipedia 3.0 (http://www.lncipedia.org), an online storage of lncRNA annotation (25), was used to acquire information on lncRNAs. Subsequently, Cufflinks was used to screen the DE-LNRs. Similar to the selection of DEGs, the cut-off values were q<0.05 and |log2(FC)|> 0.58.

Enrichment analysis of the DEGs

To explore potential functions and pathways that the DEGs may participate in, function enrichment and pathway enrichment were implemented based on the Gene Ontology (GO; http://www.geneontology.org) (26) database and the Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.genome.jp/kegg/pathway.html) database, respectively, and the Database for Annotation, Visualization and Integration Discovery (DAVID; v6.8; http://david.abcc.Ncifcrf.gov) (27). Selection criteria for a significant GO or KEGG pathway category were P<0.05 with ≥2 genes enriched in a category.

Protein-protein interaction (PPI) network construction

The Search Tool for the Retrieval of Interacting Genes (STRING; v10.0, http://string-db.org) database was searched to discover potential interactions of proteins encoded by the identified DEGs (28). With the selection criterion of a combined score >0.7, a PPI network was established, which was drawn using Cytoscape (v3.2.0; http://cytoscape.org) software (29).

Co-expression analysis of lncRNAs and mRNAs

For the identified DE-LNRs and DEGs, their correlation coefficient (CC) was calculated by Pearson correlation. The co-expressed DE-LNRs and DEGs were selected under the condition of |CC|>0.98. Subsequently, enrichment analysis of the co-expressed DEGs was performed to predict biological functions of the DE-LNRs.

Validation of identified DEGs and lncRNA

To further confirm the identification of DEGs and DE-LNRs, expression levels of fibronectin 1 (FN1), vascular endothelial growth factor A (VEGFA) and lncAP000769.1-2:10 were determined using reverse transcription-quantitative PCR (RT-qPCR) in SK-MES-1 cells treated with 10 µM celecoxib or DMSO for 48 h. Total RNA was isolated from cells at a confluency of 70–75% using TRIzol agent (Takara Biotechnology Co., Ltd., Dalian, China), and reverse transcribed to cDNA using the PrimeScript RT Reagent kit (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocol. qPCR was performed using a SYBR Green kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) on a ViiA7 PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 1 cycle of 50°C for 3 min and 95°C for 3 min; followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. GAPDH was used as the internal control during expression analysis, and gene expression was calculated using the 2−∆∆Cq method (30). Primer sequences are provided in Table I.

Table I.

Primer sequences of genes and lncRNA determined using reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences of genes and lncRNA determined using reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequence (5′→3′)
VEGFAF: CTGTCTAATGCCCTGGAGCC
R: ACGCGAGTCTGTGTTTTTGC
FN1F: TTGCTCCTGCACATGCTTTG
R: CATGAAGCACTCAATTGGGCA
Lnc-AP000769.F: GGGGAAGTAGTCTCGGGTAT
1-2:10R: GTCGTTATGAAGGCAATGTG
GAPDHF: TGACAACTTTGGTATCGTGGAAGG
R: AGGCAGGGATGATGTTCTGGAGAG

[i] FN1, fibronectin 1; lnc, long noncoding; VEGFA, vascular endothelial growth factor A.

Statistical analysis

DEGs were screened using the limma package in R with the thresholds of q<0.05 and |log2(FC)|>0.58; DE-LNRs were screened using Cufflinks software with the same thresholds. Continuous variables are presented as the mean ± standard deviation, and difference between groups was calculated using Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

DEGs and DE-LNRs identification

According to the aforementioned criteria, a set of 261 upregulated and 56 downregulated DEGs were identified in celecoxib-treated group, compared with the untreated Control cells. Gene expressions in each group are presented in a scatter plot of FPKM (Fig. 1). Based on the predefined selection criterion, 17 lncRNAs were upregulated and 8 lncRNAs were downregulated in celecoxib-treated group compared with the untreated Control cells (Table II).

Figure 1.

Scatter plot of FPKM in celecoxib-treated SK-MES-1 cells and untreated Control cells. Red dots represent upregulated genes in the celecoxib-treated group; green dots represent downregulated genes; and blue dots represent genes without differential expressions. The x-axis denotes cells in the Control group, and the y-axis denotes celecoxib-treated cells. FPKM, fragments per kilobase of exon per million fragments mapped.

Table II.

Differentially expressed lncRNAs in the celecoxib-treated group and Control group.

Table II.

Differentially expressed lncRNAs in the celecoxib-treated group and Control group.

A, Upregulated

lncRNAValue_1Value_2Log2 (FC)q-value
lnc-C14orf166B-3:4183.118400.277112.823 5.35×10−4
lnc-CNN3-3:1112.248179.2370.675 5.06×10−8
lnc-CTSL1-2:2327.718549.9360.747 2.63×10−2
lnc-CXCL3-1:1128.05734.035141.023 8.89×10−13
lnc-ENTPD6-2:1101.243188.5220.897 1.7×10−2
lnc-ERN1-1:1750.668164.504113.187 8.84×10−8
lnc-HES1-10:1258.042694.213142.777 5.96×10−4
lnc-HFE2-2:1343.839851.858130.8880
lnc-KIAA1257-3:1132.56821.2110.678 6.09×10−4
lnc-KSR1-1:1108.716165.8870.610 1.57×10−2
lnc-MOGAT2-5:1930.449140.7220.597 2.81×10−2
lnc-MT2A-1:21990.133034.10.608 2.03×10−8
lnc-RAB44-3:1517.827879.9170.765 1.22×10−8
lnc-RBM3-1:1726.858139.5980.942 1.57×10−2
lnc-RP11-231C14.2.1–3:1164.477551.775174.619 1.89×10−2
lnc-RSPH9-4:1658.082105.150.676 1.33×10−8
lnc-TRIB3-1:2366.972569.2990.634 7.30×10−3

B, Downregulated

lnc-AP000769.1-2:10895.237589.174−0.604 6.98×10−5
lnc-BOLA3-2:2136.8390 −1.80×10−8 4.31×10−2
lnc-E2F2-1:1200.807118.647−0.759 1.50×10−6
lnc-FOXG1-7:139.7490 −1.80×10−8 4.16×10−13
lnc-GNLY-4:290.639306.009−156.656 3.67×10−3
lnc-KIAA0226-2:1219.7130.367−258.257 1.62×10−4
lnc-LTBP3-2:511.504730.114−0.656 5.95×10−3
lnc-TOR1A-2:123.017131.966−0.803 1.40×10−2

[i] FC, fold change; lncRNA, long noncoding RNA.

Pathway enrichment analysis of DEGs

KEGG pathway analysis indicated that the upregulated DEGs were significantly enriched in 12 pathway categories, including Aminoacyl-tRNA biosynthesis, protein processing in endoplasmic reticulum (ER), protein export, amino sugar and nucleotide sugar metabolism and mammalian target of rapamycin (mTOR) signaling pathway. The downregulated DEGs were enriched in 17 pathways, such as ‘transforming growth factor (TGF)-β signaling pathway’, ‘extracellular matrix (ECM)-receptor interaction’, ‘cytokine-cytokine receptor interaction’ and ‘p53 signaling pathway’ (Table III).

Table III.

Top 10 identified KEGG enrichment pathways of identified DEGs.

Table III.

Top 10 identified KEGG enrichment pathways of identified DEGs.

A, Upregulated DEGs
KEGG IDPathway nameCountaGenesP-value
970Aminoacyl-tRNA biosynthesis10AARS, CARS, EPRS, GARS, IARS 4.49×10−7
4141Protein processing in endoplasmic reticulum15ATF4, DDIT3, DNAJB2, ERN1, HERPUD1 1.05×10−6
260Glycine, serine and threonine metabolism  6CBS, CTH, PHGDH, PSAT1, PSPH, SHMT2 3.78×10−5
3060Protein export  4HSPA5, SEC11C, SEC63, SRPRB 1.09×10−3
520Amino sugar and nucleotide sugar metabolism  5GFPT1, GFPT2, GMPPB, HKDC1, NAGK 2.79×10−3
250Alanine, aspartate and glutamate metabolism  4ASNS, GFPT1, GFPT2, GPT2 3.84×10−3
4150mTOR signaling pathway  5DDIT4, EIF4EBP1, RPS6KA2, ULK1, VEGFA 3.97×10−3
860Porphyrin and chlorophyll metabolism  4EPRS, FTH1, HMOX1, UROS 1.11×10−2
5020Prion diseases  3EGR1, HSPA5, IL1A 3.39×10−2
450Selenocompound metabolism  2CTH, MARS 4.62×10−2

B, Downregulated DEGs

KEGG IDPathway nameCountaGenesP-value

4350TGF-β signaling pathway  4ID1, ID3, TGFβ2, THBS1 1.94×10−4
5323Rheumatoid arthritis  4CCL2, CSF1, CXCL6, TGFβ2 2.65×10−4
5144Malaria  3CCL2, TGFβ2, THBS1 7.36×10−4
5200Pathways in cancer  6AXIN2, E2F2, EGLN3, FN1, MITF, TGFβ2 7.47×10−4
4512ECM-receptor interaction  3COL1A1, FN1, THBS1 3.23×10−3
5146Amoebiasis  3COL1A1, FN1, TGFβ2 6.01×10−3
5219Bladder cancer  2E2F2, THBS1 9.63×10−3
4380Osteoclast differentiation  3CSF1, MITF, TGFβ2 1.01×10−2
4060Cytokine-cytokine receptor interaction  4CCL2, CSF1, CXCL6, TGFβ2 1.32×10−2
4115p53 signaling pathway  2RRM2, THBS1 2.41×10−2

a The number of genes that were enriched in a specific pathway category. KEGG, Kyoto Encyclopedia of Genes and Genomes; DEG, differentially expressed gene.

PPI network of DEGs

In the established PPI network (Fig. 2), several genes were highlighted that had high degrees; that is, a high number of connections between one gene and the others, such as VEGFA (degree=23), activating transcription factor (ATF)-4 (degree=19), FN1 (degree=16), urokinase-type plasminogen activator PLAU (degree=13), ATF3 (degree=11) and serpin E1 (SERPINE1; degree=10).

Figure 2.

Protein-protein interaction network of the differentially expressed genes. Red circles represent upregulated genes, and green circles represent downregulated genes.

Co-expressed DE-LNRs and DEGs and their enriched functions

Using the criterion of |CC|>0.98, the co-expressed DE-LNRs and DEGs were screened out. As presented in Table IV, SERPINE1 was co-expressed with lnc-CTSL1-2:2 (CC=0.998577) and lnc-CXCL3-1:1 (CC=0.986928); VEGFA was linked with lnc-HES1-10:1 (CC=0.98906) and lnc-AP000769.1-2:10 (CC=−0.99227); lnc-HFE2-2:1 was co-expressed with ATF4 (CC=0.996159) and FN1 (CC= −0.98714); ATF3 was co-expressed with lnc-KIAA1257-3:1 (CC=0.990212), lnc-KSR1-1:1 (CC=0.99655) and lnc-RP11-231C14.2.1-3:1 (CC= 0.993415); lnc-BOLA3-2:2 was linked with PLAU (CC= −0.99288); and lnc-KIAA0226-2:1 was co-expressed with FN1 (CC=0.981655).

Table IV.

The most highly correlated co-expressed DE-LNRs and DEGs.

Table IV.

The most highly correlated co-expressed DE-LNRs and DEGs.

DE-LNRDEGCC
lnc-C14orf166B-3:4VEGFA   0.999351
CLDN11−0.98538
lnc-CNN3-3:1ACOT8   0.994477
ATAD2−0.99951
lnc-CTSL1-2:2SERPINE1   0.998577
AMER1−0.99246
lnc-CXCL3-1:1SERPINE1   0.986928
AXIN2−0.9893
lnc-ENTPD6-2:1ACVR1   0.995922
ASPN−0.98602
lnc-ERN1-1:1ABTB2   0.996183
AXIN2−0.98832
lnc-HES1-10:1VEGFA   0.98906
AMER1−0.99383
lnc-HFE2-2:1ATF4   0.996159
FN1−0.98714
lnc-KIAA1257-3:1ATF3   0.990212
LRFN1−0.98734
lnc-KSR1-1:1ATF3   0.99655
CCDC80−0.9997
lnc-MOGAT2-5:1ACVR1   0.986953
ASPN−0.9935
lnc-MT2A-1:2AASR   0.991019
ATAD2−0.99032
lnc-RAB44-3:1ACOT8   0.997679
ATAD2−0.99846
lnc-RBM3-1:1ACOT8   0.990015
ATAD2−0.99475
lnc-RP11-231C14.2.1–3:1ATF3   0.993415
CCDC80−0.98512
lnc-RSPH9-4:1ACOT8   0.990293
CCNF−0.988
lnc-TRIB3-1:2ACOT8
ATAD2−0.98366
lnc-AP000769.1-2:10ASPN   0.987202
VEGFA−0.99227
lnc-BOLA3-2:2CCNF   0.985247
PLAU−0.99288
lnc-E2F2-1:1AMER1   0.987329
AARS−0.98601
lnc-FOXG1-7:1AMER1   0.988729
ANTXR2−0.9897
lnc-GNLY-4:2COL1A1   0.989359
CDH13−0.99856
lnc-KIAA0226-2:1FN1   0.981655
AARS−0.99647
lnc-LTBP3-2:5ASPN   0.993248
BTG1−0.993
lnc-TOR1A-2:1ATOH8   0.98542
CDH13−0.99533

[i] CC, correlation coefficient; DEG, differentially expressed gene; DE-LNR, differentially expressed long noncoding RNA.

According to the enrichment analysis results of the co-expressed DEGs, the co-expressed DE-LNRs were mainly enriched in the ‘p53 signaling pathway’ (for example, lnc-HES1-10:1, lnc-HFE2-2:1, lnc-KIAA1257-3:1 and lnc-KSR1-1:1; Fig. 3) and the ‘mTOR signaling pathway’ (for example, lnc-CTSL1-2:2, lnc-CXCL3-1:1, lnc-ERN1-1:1, lnc-HES1-10:1 and lnc-HFE2-2:1; Fig. 3).

Figure 3.

Enriched pathways of the co-expressed lncRNAs. Red indicates that the lncRNA was enriched in a specific pathway. Rows indicate pathways and columns indicate lncRNAs. lncRNA, long noncoding RNA.

Validations of DEGs and lncRNA

To verify the identification of possible DEGs and DE-LNRs, the expression levels of VEGFA, FN1 and lnc-AP000769.1-2:10 were analyzed by RT-qPCR. The results revealed that the expression level of VEGFA was significantly increased in celecoxib-treated SK-MES-1 cells compared with untreated Control cells (Fig. 4A). However, the expression levels of FN1 and lnc-AP000769.1-2:10 were significantly decreased in the celecoxib-treated group compared with the Control group (Fig. 4B and C, respectively). These results were consistent with the aforementioned bioinformatics analytical results.

Figure 4.

Expression levels of (A) VEGFA, (B) FN and (C) lncAP000769 1–2:10 were determined in SK-MES-1 cells using reverse transcription-quantitative polymerase chain reaction. *P<0.05 vs. Control. FN1, fibronectin 1; lnc, long noncoding; VEGFA, vascular endothelial growth factor A.

Discussion

The present study identified a number of genes and lncRNAs that exhibited differential expression levels in celecoxib-treated human LSQCC SK-MES-1 cells, compared with untreated cells, including the genes VEGFA, ATF4 and FN1, and the lncRNAs lnc-AP000769.1-2:10 and lnc-HFE2-2:1. Notably, many of the identified DEGs and DE-LNRs were significantly enriched in pathways like ‘protein processing in endoplasmic reticulum’, ‘mTOR signaling pathway’ and ‘ECM-receptor interaction’.

VEGFA is an essential growth factor for stimulating angiogenesis, which often accompanies tumoral growth (31). A previous study reported that by upregulating the expression of FLJ10540, VEGFA activates the phosphatidylinositol 3-kinase/AKT signaling pathway, subsequently promoting cell invasion and migration in lung cancer (32). mTOR is located downstream of AKT signaling and functions in the control of angiogenesis and cell proliferation during tumor progression (33). VEGFA was also reported to activate the downstream mTOR signaling pathway to promote cancer growth (34). Notably, several therapeutic drugs for lung cancer have been reported to function through this pathway. 2-(18F)-fluoro-2-deoxy-d-glucose (18F-FDG) is a radiolabelled sugar molecule that is commonly used to monitor the therapeutic effects of chemotherapy for many malignant tumors, and the accumulation of 18F-FDG is regulated by the activation of mTOR signaling in NSCLC (35). Cis-diamminedichloroplatinum (II) (CDDP; also known as cisplatin) is an effective drug for the treatment of many cancers (36). However, resistance to this drug limited its potential use in lung cancer treatment. It was previously reported that overexpression of AKT activates the mTOR signaling pathway, which induces CDDP resistance in lung cancer cells (37). Therefore, inhibitors of the AKT/mTOR signaling pathway may provide a promising therapeutic target. In lung cancer, targeting of mTOR signaling was suggested as an effective method in developing therapeutic drugs (38). Curcumin, a natural extract of turmeric, is considered as an antitumoral agent, which was reported to enhance the anti-cancer ability of chemotherapy in LSQCC by regulating multiple pathways such as VEGF signaling (39). Notably, VEGFA was also indicated to be enriched in the mTOR signaling pathway (36). In the present study, VEGFA was identified as an upregulated DEG in celecoxib-treated LSQCC cells, and was demonstrated to be significantly enriched in the mTOR signaling pathway. These data suggested that VEGFA may be a sensitive gene in response to celecoxib, and the increased expression may inhibit the activation of mTOR signaling, which may improve the anti-tumor effects of celecoxib on LSQCC cells.

In addition, lncRNAs may also serve crucial roles in the amplification of anti-tumor effects. Nuclear paraspeckle assembly transcript 1 (Neat1; ENST00000501122.2) is a factor required for the assembly of paraspeckle compartments in the cell (40). Neat1-containing paraspeckles were reported to be responsible for the regulation of chemosensitivity and may be induced by p53 (41). The biofunction of Neat1 is similar to lnc-AP000769.1-2:3. However, no information about lnc-AP000769.1-2:10 has yet been reported. In the present study, lnc-AP000769.1-2:10 was closely correlated with VEGFA, which was enriched in the mTOR signaling pathway following celecoxib treatment. In addition, the expression of lnc-AP000769.1-2:10 was significantly decreased in celecoxib treated SK-MES-1 cells. Therefore, the present study hypothesized that this lncRNA may regulate VEGFA gene expression in the mTOR signaling pathway, which may facilitate to the enhancement of anti-tumor effect of celecoxib for LSQCC treatment.

ATF4 was reported to be associated with cisplatin sensitivity in lung cancer cell lines (42). Celecoxib has been demonstrated to induce the expression of DR5 (43). In addition, C/EBP homologous protein (CHOP) was revealed to serve a crucial role in celecoxib-induced DR5 expression and may also be upregulated by celecoxib (44). Inhibition of ATF4 expression by small interfering RNAs was able to abolish CHOP induction, which indicated the involvement of ATF4 in celecoxib-induced apoptosis (45). The ER is an essential site for protein processing. In many types cancer, the ER serves an important role in the structural maintenance of proteins in pivotal signaling pathways (46). Control of these proteins may offer promising target therapies. In the present study, ATF4 was indicated as enriched in the protein processing in ER pathway, which suggested that it may influence the sensitivity of celecoxib in LSQCC through the regulation of protein processing.

The FN1 protein may be involved in several cellular activities, such as cell adhesion and migration (47,48). In lung cancer, knockdown of FN1 was previously reported to increase the chemosensitivity of cisplatin and promote apoptosis in tumor cells (49). Notably, in the present study, FN1 expression was downregulated in the celecoxib-treated LSQCC cells, which suggested that the reduced expression of this gene may also enhance the sensitivity of tumor cells in response to celecoxib. In addition, FN1 has been implicated in pathways such as the ECM-receptor interaction pathway in many types cancer (50,51). Consistent with these results, FN1 was significantly enriched in the ECM-receptor interaction pathway in the present study, which indicated that FN1 may exert its function through its involvement in this pathway. Results from the present study also predicted that both FN1 and ATF4 were targets of lnc-HFE2-2:1, which suggested that the two genes may be regulated by this lncRNA in LSQCC cells following celecoxib treatment. However, there is still little information available about this lncRNA. Based on the present results, lnc-HFE2-2:1 may be a novel target to predict sensitivity of celecoxib for the treatment of LSQCC, through the regulation of FN1 and ATF4 expressions.

There were some limitations to the present study. First, although some genes and lncRNA had been validated in this study, the regulatory relationships between lncRNAs and DEGs have yet to be confirmed with in vitro experiments. Second, as LSQCC may develop from a number of lung cell dysfunctions, SK-MES-1 cells may not reflect the wider results of celecoxib. Therefore, different types of LSQCC cell lines should be used in future studies, and the intersection of DEGs and lncRNAs may be focused. Finally, an appropriate animal model should be used to confirm the identified DEGs and DE-LNRs, including investigations on the predicted signaling pathways.

In conclusion, genes (such as VEGFA, ATF4 and FN1), and lncRNAs (such as lnc-AP000769.1-2:10 and lnc-HFE2-2:1) may be crucial molecules to enhance the anti-cancer effects of celecoxib treatment on LSQCC, and may be used as predictors for chemosensitivity of celecoxib. However, additional validation experiments are required in further studies.

Glossary

Abbreviations

Abbreviations:

18F-FDG

2-(18F)-fluoro-2-deoxy-d-glucose

ATF4

activating transcription factor 4

CC

correlation coefficient

CDDP

cis-diamminedichloroplatinum (II)

CHOP

C/EBP homologous protein

COX

cyclooxygenase

DEG

differentially expressed gene

DR5

death receptor 5

ER

endoplasmic reticulum

FC

fold change

FN1

fibronectin 1

GO

gene ontology

lncRNA

long noncoding RNA

LSQCC

lung squamous cell carcinoma

mTOR

mammalian target of rapamycin

NSCLC

non-small-cell lung cancer

PCR

polymerase chain reaction

PPI

protein-protein interaction

RNA-seq

RNA-sequencing

VEGFA

vascular endothelial growth factor A

References

1 

Henley SJ, Richards TB, Underwood JM, Eheman CR, Plescia M and McAfee TA: Centers for Disease Control and Prevention (CDC): Lung cancer incidence trends among men and women-United States, 2005–2009. MMWR Morb Mortal Wkly Rep. 63:1–5. 2014.PubMed/NCBI

2 

de Groot P and Munden RF: Lung cancer epidemiology, risk factors, and prevention. Radiol Clin North Am. 50:863–876. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–298. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Cancer Genome Atlas Research Network: Comprehensive genomic characterization of squamous cell lung cancers. Nature. 489:519–525. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Bendale Y, Bendale V, Birari-Gawande P, Kadam A and Gund P: Tumor regression with ayurvedic rasayana therapy in squamous cell carcinoma of lungs. Rasamruta. 7:1–5. 2015.

6 

Mascaux C, Martin B, Verdebout JM, Ninane V and Sculier JP: COX-2 expression during early lung squamous cell carcinoma oncogenesis. Eur Respir J. 26:198–203. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Altorki NK, Keresztes RS, Port JL, Libby DM, Korst RJ, Flieder DB, Ferrara CA, Yankelevitz DF, Subbaramaiah K, Pasmantier MW and Dannenberg AJ: Celecoxib, a selective cyclo-oxygenase-2 inhibitor, enhances the response to preoperative paclitaxel and carboplatin in early-stage non-small-cell lung cancer. J Clin Oncol. 21:2645–2650. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Liu X, Yue P, Zhou Z, Khuri FR and Sun SY: Death receptor regulation and celecoxib-induced apoptosis in human lung cancer cells. J Natl Cancer Inst. 96:1769–1780. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Gold KA, Kim ES, Lee JJ, Wistuba II, Farhangfar CJ and Hong WK: The BATTLE to personalize lung cancer prevention through reverse migration. Cancer Prev Res (Phila). 4:962–972. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Fu SL, Wu YL, Zhang YP, Qiao MM and Chen Y: Anti-cancer effects of COX-2 inhibitors and their correlation with angiogenesis and invasion in gastric cancer. World J Gastroenterol. 10:1971–1974. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Mineo TC, Ambrogi V, Cufari ME and Pompeo E: May cyclooxygenase-2 (COX-2), p21 and p27 expression affect prognosis and therapeutic strategy of patients with malignant pleural mesothelioma? Eur J Cardiothorac Surg. 38:245–252. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Khan Z, Khan N, Tiwari RP, Sah NK, Prasad GB and Bisen PS: Biology of Cox-2: An application in cancer therapeutics. Curr Drug Targets. 12:1082–1093. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long noncoding RNAs. Cell. 136:629–641. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Wang KC and Chang HY: Molecular mechanisms of long noncoding RNAs. Mol Cell. 43:904–914. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Yang YR, Zang SZ, Zhong CL, Li YX, Zhao SS and Feng XJ: Increased expression of the lncRNA PVT1 promotes tumorigenesis in non-small cell lung cancer. Int J Clin Exp Pathol. 7:6929–6935. 2014.PubMed/NCBI

16 

Wan L, Zhang L, Fan K, Cheng ZX, Sun QC and Wang JJ: Knockdown of long noncoding RNA PCAT6 inhibits proliferation and invasion in lung cancer cells. Oncol Res. 24:161–170. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Tang CY, Silva-Fisher JM, Dang HX, White NM and Maher CA: Abstract 971: A novel long noncoding RNA, onco-lncRNA 230, induces apoptosis and invasion in lung squamous cell carcinoma. Cancer Res. 76 14 Suppl:S9712016. View Article : Google Scholar

18 

Gradilone A, Silvestri I, Scarpa S, Morrone S, Gandini O, Pulcinelli FM, Gianni W, Frati L, Aglianò AM and Gazzaniga P: Failure of apoptosis and activation on NFkappaB by celecoxib and aspirin in lung cancer cell lines. Oncol Rep. 17:823–828. 2007.PubMed/NCBI

19 

Gradilone A, Pulcinelli FM, Lotti LV, Martino S, Mattiello T, Frati L, Aglianò AM and Gazzaniga P: Celecoxib induces MRP-4 in lung cancer cells: Therapeutic implications. J Clin Oncol. 25:4318–4320. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Lin L, Abo R, Dolcen D, Paquette R, Laing A, de Waal L, Thorner A, Ducar M, Ziaugra L, Wollison B, et al: Abstract 1115: Targeted RNA sequencing improves transcript analysis in cancer samples. Cancer Res. 75 15 Suppl:S11152015. View Article : Google Scholar

21 

Patel RK and Jain M: NGS QC Toolkit: A toolkit for quality control of next generation sequencing data. PLoS One. 7:e306192012. View Article : Google Scholar : PubMed/NCBI

22 

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R and Salzberg SL: TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14:R362013. View Article : Google Scholar : PubMed/NCBI

23 

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL and Pachter L: Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 7:562–578. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W and Smyth GK: limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 43:e472015. View Article : Google Scholar : PubMed/NCBI

25 

Volders PJ, Verheggen K, Menschaert G, Vandepoele K, Martens L, Vandesompele J and Mestdagh P: An update on LNCipedia: A database for annotated human lncRNA sequences. Nucleic Acids Res. 43:(Database Issue). D174–D180. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Gene Ontology Consortium: Gene ontology consortium: Going forward. Nucleic Acids Res. 43:(Database Issue). D1049–D1056. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Dennis G, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC and Lempicki RA: DAVID: Database for annotation, visualization and Integrated discovery. Genome Biol. 4:P32003. View Article : Google Scholar : PubMed/NCBI

28 

Szklarczyk D, Franceschini A, Kuhn M, Simonovic M, Roth A, Minguez P, Doerks T, Stark M, Muller J, Bork P, et al: The STRING database in 2011: Functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 39:(Database Issue). D561–DD68. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Smoot ME, Ono K, Ruscheinski J, Wang PL and Ideker T: Cytoscape 2.8: New features for data integration and network visualization. Bioinformatics. 27:431–432. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using rea-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2011. View Article : Google Scholar

31 

Claesson-Welsh L and Welsh M: VEGFA and tumour angiogenesis. J Intern Med. 273:114–127. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Chen CH, Lai JM, Chou TY, Chen CY, Su LJ, Lee YC, Cheng TS, Hong YR, Chou CK, Whang-Peng J, et al: VEGFA upregulates FLJ10540 and modulates migration and invasion of lung cancer via PI3K/AKT pathway. PLoS One. 4:e50522009. View Article : Google Scholar : PubMed/NCBI

33 

Inoki K, Corradetti MN and Guan KL: Dysregulation of the TSC-mTOR pathway in human disease. Nat Genet. 37:19–24. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Chen B, Zhang C, Dong P, Guo Y and Mu N: Molecular regulation of cervical cancer growth and invasion by VEGFa. Tumor Biol. 35:11587–11593. 2014. View Article : Google Scholar

35 

Kaira K, Serizawa M, Koh Y, Takahashi T, Yamaguchi A, Hanaoka H, Oriuchi N, Endo M, Ohde Y, Nakajima T and Yamamoto N: Biological significance of 18F-FDG uptake on PET in patients with non-small-cell lung cancer. Lung Cancer. 83:197–204. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Petryk AA, Giustini AJ, Gottesman RE, Kaufman PA and Hoopes PJ: Magnetic nanoparticle hyperthermia enancement of cisplatin chemotherapy cancer treatment. Int J Hyperthermia. 29:845–851. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Liu LZ, Zhou XD, Qian G, Shi X, Fang J and Jiang BH: AKT1 amplification regulates cisplatin resistance in human lung cancer cells through the mammalian target of rapamycin/p70S6K1 pathway. Cancer Res. 67:6325–6332. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Ekman S, Wynes MW and Hirsch FR: The mTOR pathway in lung cancer and implications for therapy and biomarker analysis. J Thorac Oncol. 7:947–953. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Zhao W, Wang Y, Wang Y, Gao N, Han Z and Yu H: Potential anti-cancer effect of curcumin in human lung squamous cell carcinoma. Thoracic Cancer. 6:508–516. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Imamura K, Imamachi N, Akizuki G, Kumakura M, Kawaguchi A, Nagata K, Kato A, Kawaguchi Y, Sato H, Yoneda M, et al: Long noncoding RNA NEAT1-dependent SFPQ relocation from promotor region to paraspeckle mediates IL8 expression upon immune stimuli. Mol Cell. 53:393–406. 2014. View Article : Google Scholar : PubMed/NCBI

41 

Adriaens C, Standaert L, Barra J, Latil M, Verfaillie A, Kalev P, Boeckx B, Wijnhoven PW, Radaelli E, Vermi W, et al: p53 induces formation of NEAT1 lncRNA-containing paraspeckles that modulate replication stress response and chemosensitivity. Nat Med. 22:861–868. 2016. View Article : Google Scholar : PubMed/NCBI

42 

Tanabe M, Izumi H, Ise T, Higuchi S, Yamori T, Yasumoto K and Kohno K: Activating transcription factor 4 increases the cisplatin resistance of human cancer cell lines. Cancer Res. 63:8592–8595. 2003.PubMed/NCBI

43 

He Q, Luo X, Jin W, Huang Y, Reddy MV, Reddy EP and Sheikh MS: Celecoxib and a novel COX-2 inhibitor ON09310 upregulate death receptor 5 expression via GADD153/CHOP. Oncogene. 27:2656–2660. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Kim SJ, Ha GH, Bae JH, Kim GR, Son CH, Park YS, Yang K, Oh SO, Kim SH and Kang CD: COX-2 and endoplasmic reticulum stree-independent induction of ULBP-1 and enhancement of sensitivity to NK cell-mediated cytotocity by celecoxib in colon cancer cells. Exp Cell Res. 330:451–459. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Oh YT, Liu X, Yue P, Kang S, Chen J, Taunton J, Khuri FR and Sun SY: ERK/ribosomal S6 kinase (RSK) signaling positively regulates death receptor 5 expression through co-activation of CHOP and Elk1. J Biol Chem. 285:41310–41319. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Dong HS, Kim MK, Kim HS, Chung HH and Yong SS: Unfolded protein response to autophagy as a promising druggable target for anticancer therapy. Ann N Y Acad Sci. 1271:20–32. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Veluscek G, Li Y, Yang SH and Sharrocks AD: Jun-mediated changes in cell adhesion contribute to mouse embryonic stem cell exit from ground state pluripotency. Stem Cells. 34:1213–1224. 2016. View Article : Google Scholar : PubMed/NCBI

48 

Lou X, Xu H, Jin C, Tian W, Yu W, Dong D, Cheng L, Huang B, Jiang H and Lin B: SOX2 targets fibronectin 1 to promote cell migration and invasion in ovarian cancer: New molecular leads for therapeutic intervention. OMICS. 17:520–508. 2013. View Article : Google Scholar

49 

Gao W, Liu Y, Qin R, Liu D and Feng Q: Silence of fibronectin 1 increases cisplatin sensitivity of non-small cell lung cancer cell line. Biochem Biophys Res Commun. 476:35–41. 2016. View Article : Google Scholar : PubMed/NCBI

50 

Fang L, Gao X, Jing W, Chao G, Li X, Li X, Gong X and Zeng X: Transcriptome sequencing to identify transcription factor regulatory network and alternative splicing in endothelial cells under VEGF stimulation. J Mol Neurosci. 58:170–177. 2016. View Article : Google Scholar : PubMed/NCBI

51 

Wang Y and Li Y: Analysis of molecular pathways in pancreatic ductal adenocarcinomas with a bioinformatics approach. Asian Pac J Cancer Prev. 16:2561–2567. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li G, Wang X, Luo Q and Gan C: Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing. Mol Med Rep 17: 6456-6464, 2018.
APA
Li, G., Wang, X., Luo, Q., & Gan, C. (2018). Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing. Molecular Medicine Reports, 17, 6456-6464. https://doi.org/10.3892/mmr.2018.8656
MLA
Li, G., Wang, X., Luo, Q., Gan, C."Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing". Molecular Medicine Reports 17.5 (2018): 6456-6464.
Chicago
Li, G., Wang, X., Luo, Q., Gan, C."Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing". Molecular Medicine Reports 17, no. 5 (2018): 6456-6464. https://doi.org/10.3892/mmr.2018.8656
Copy and paste a formatted citation
x
Spandidos Publications style
Li G, Wang X, Luo Q and Gan C: Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing. Mol Med Rep 17: 6456-6464, 2018.
APA
Li, G., Wang, X., Luo, Q., & Gan, C. (2018). Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing. Molecular Medicine Reports, 17, 6456-6464. https://doi.org/10.3892/mmr.2018.8656
MLA
Li, G., Wang, X., Luo, Q., Gan, C."Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing". Molecular Medicine Reports 17.5 (2018): 6456-6464.
Chicago
Li, G., Wang, X., Luo, Q., Gan, C."Identification of key genes and long non‑coding RNAs in celecoxib‑treated lung squamous cell carcinoma cell line by RNA‑sequencing". Molecular Medicine Reports 17, no. 5 (2018): 6456-6464. https://doi.org/10.3892/mmr.2018.8656
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team