Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling

  • Authors:
    • Lifan Zhu
    • Zhen Weng
    • Pengcheng Shen
    • Jianxin Zhou
    • Jincai Zeng
    • Fengbiao Weng
    • Xiaojian Zhang
    • Huilin Yang
  • View Affiliations / Copyright

    Affiliations: Department of Orthopaedics, The First People's Hospital of Wujiang, Suzhou, Jiangsu 215200, P.R. China, Cyrus Tang Hematology Center, Soochow University, Suzhou, Jiangsu 215006, P.R. China, Department of Surgery, The First People's Hospital of Wujiang, Suzhou, Jiangsu 215200, P.R. China, Department of Orthopaedics, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006, P.R. China
    Copyright: © Zhu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4855-4864
    |
    Published online on: October 1, 2018
       https://doi.org/10.3892/mmr.2018.9523
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study aimed to investigate the role of S100B in the inflammation process during osteoarthritis (OA). OA cartilage samples were collected for S100B expression analysis. S100B expression levels were significantly increased in patients with OA compared with the Controls (1.28±0.66 vs. 0.42±0.31; P=0.01) and were determined to be correlated with TNF‑α (r=0.42; P=0.04) and IL‑1β (r=0.73; P=0.001) expression levels. Orthopedic casting tape was used to immobilize the right knee at 180˚ extension of adult female New Zealand white rabbits for 4 weeks to establish an OA model. Cartilage specimens from the medial femoral condyle of these rabbits were used for histological confirmation and immunohistochemical analyses, whereas synovial fluid was used in ELISA assays for tumor necrosis factor (TNF)‑α and interleukin (IL)‑1β expression levels. Human synovial fibroblasts from the knee synovial tissues of normal patients with traumatic injury were transfected with S100B overexpression and knockdown plasmids and subjected to lipopolysaccharide (LPS) stimulation; subsequently, TNF‑α and IL‑1β expression levels in conditioned medium were determined by ELISA; S100B overexpression and knockdown significantly increased and decreased the TNF‑α and IL‑1β expression levels, respectively. Increased TNF‑α (573.3±15.4 vs. 102.6±8.7 pg) and IL‑1β (378.6±7.2 vs. 170.1±5.8 pg) expression levels were detected in OA model rabbits compared with the Control rabbits. Additionally, S100B, fibroblast growth factor (FGF)‑1 and FGF receptor (FGFR)‑1 mRNA and protein expression levels were increased in OA model rabbits compared with the Control group. FGFR1 knockdown significantly decreased TNF‑α and IL‑1β expression levels in LPS‑stimulated S100B‑overexpressing human synovial fibroblasts. S100B is involved in FGFR1 signaling‑mediated inflammatory response during OA, which may be considered as a potential therapeutic target.

Introduction

Osteoarthritis (OA) is one of the most common types of joint disease, particularly in the elderly, with ~3 million newly diagnosed cases each year (1,2). Owing to limited information about the pathophysiological process of OA, joint replacement remains the main treatment for patients with advanced OA (3), and only limited effective disease-modifying OA drugs have been used for treatment (4). Further understanding of the mechanism underlying OA may provide insights for the development of novel treatments.

Previous studies have demonstrated that inflammation contributes to the pathogenesis and the progression of OA (5,6), and is a major factor associated with cartilage loss and disease symptoms, including joint pain, swelling and stiffness, as well as synovitis indications, such as joint tenderness and abscesses (7). Infiltration of mononuclear cells into the synovial membrane and production of proinflammatory mediators, such as interleukin 1β (IL-1β), tumor necrosis factor-α (TNF-α) and chemokines, may initiate and exacerbate OA (7). Exploration of the mechanisms and identification of the key mediators involved in the inflammatory process, particularly to those associated with IL-1β and TNF-α, will aid in prevention and management of OA.

S100B is a 21 kDa EF hand-type cytosolic calcium-binding protein that has been demonstrated to serve a stimulatory role for inflammatory responses in multiple cells, such as macrophages, lymphocytes, endothelial cells, vascular smooth muscle cells and cardiomyocytes (8,9). According to previous studies (10,11), S100B has been revealed to be expressed in human articular cartilage, and the expression of S100B is upregulated in diseased tissue. In addition, a previous study suggested that extracellular S100B is a pro-catabolic and pro-inflammatory factor that promotes cartilage degradation (11). However, the exact role of S100B in OA as well its association with important inflammatory factors, such as IL-1β and TNF-α, have not been investigated. Therefore, the aim of the present study was to explore the role of S100B in the inflammation process during OA. Furthermore, lipopolysaccharides (LPS), an important proinflammatory product of the microbiome, has a role in the pathogenesis of OA, and both systemic and local LPS burden is considered to be associated with knee OA (12). Therefore, LPS was as the stimulator in the cell culture system used in the present study (12).

Materials and methods

Ethics approval of the study protocol

All research involving human participants was approved by the Institutional Review Board of Soochow University (Suzhou, China). Written informed consent was provided by all participants. The animal study protocol was approved by the Institutional Animal Care and Use Committee of Soochow University and was conducted following the international guidelines for animal experimentation (13).

OA cartilage samples

OA cartilage samples (n=23; age 74.0±3.9 years old; sex, 21 females and 2 males) were collected between January and December 2016 during total knee arthroplasty in the Department of Orthopaedics at The First Affiliated Hospital of Soochow University. Inclusion criteria were as follows: Patients were diagnosed with OA in accordance with the definition and classification provided by the Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association (14); patients with rheumatoid arthritis and other autoimmune diseases, as well as chondrodysplasias and posttraumatic OA were excluded from the study. For RNA extraction, cartilage samples (2–3 g) were collected in 1.5 ml centrifugation tube, grinded with liquid nitrogen, mixed with 1 ml TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and stored in −80°C in the absence of extraction prior to subsequent use. For immunohistochemical analyses, cartilage samples were fixed with 10% neutral formalin prior to further processing. A total of 20 samples of articular cartilage were obtained from patients (age, 71.7±3.6 years old; sex, 18 females and 2 males) with tibial plateau fracture and without OA were also collected as control between January and December 2016 at the same hospital. Written informed consent was obtained from all OA and control subjects. The patient demographic data, including age, sex, disease duration and Kellgren-Lawrence grading are listed in Table I.

Table I.

Clinicopathological characteristics of the patients with OA used in the present study.

Table I.

Clinicopathological characteristics of the patients with OA used in the present study.

CharacteristicOAControlP-value
Patients (n)2320
K/L Grading
  Grade 2+34
  Grade 419
Age (years)74.0±3.971.7±3.60.24
Sex (F/M)21/218/20.70
Disease duration (months)140.6±80.8

[i] F, female; K/L, Kellgren-Lawrence; M, male; OA, osteoarthritis.

Rabbit OA model establishment

Female adult New Zealand white rabbits (n=9, 6 rabbits were used to establish the OA model and 3 rabbits were used as control; age, 4 months; weight, 3.2–3.8 kg) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China), housed in an air-conditioned room at 22°C with a 12/12 h light/dark cycle and 40–60% humidity. Rabbits were permitted free access to standard laboratory food and water, and underwent right knee immobilization at 180° of extension using orthopedic casting tape (Nanjing Shuangwei Biotech Co., Ltd., Jiangsu, China). Normal weight bearing was carried out in all immobilized rabbits. Following 4 weeks immobilization, the tape was removed and cartilage samples were collected for experimentation. Successful establishment of the OA model was confirmed by visual observation of roughness of articular cartilage at 4 weeks in 5 rabbits and the efficacy was 83.3% (5 out of 6 rabbits were successfully established into to OA model; roughness of articular cartilage was not observed in the remaining rabbit, which suggested that OA was not successfully established). In addition, 3 rabbits without right knee immobilization were employed as normal Control. Therefore, 5 and 3 rabbits were used as the OA model and the control group, respectively.

Sample collection and histological assessment

The intermediate region of the medial femoral condyles of the OA and control osteochondral samples obtained from humans and rabbits were fixed with 10% neutral formalin at 22°C for 24 h, followed by 5% nitric acid decalcification for 4 days, dehydration in a graded ethanol series at 22°C (70, 80, 90 and 100%; each for 10 min), and then xylene clearance was performed using the following steps: Incubation at 60°C for 10 min and then two incubations at 22°C for 10 min. Following this, sections were embedded in paraffin at 22°C, and then cut into sections (5 µm). Sections were stained with hematoxylin and eosin (H&E) for general examination and Safranin-O/Fast-Green (SO) for glycosaminoglycan distribution was performed on the sections. Staining results in four visual fields were evaluated separately using a light microscope (Nikon Corporation, Tokyo, Japan). OA severity was evaluated by the Mankin and Osteoarthritis Research Society International scoring system (15).

Synovial fluid was obtained from the knee joint of OA and Control rabbits by injecting 0.5 ml saline solution followed by aspiration, which was performed three times. Synovial fluid (~0.8–1 ml) was extracted and samples were centrifuged at 2,200 × g for 10 min. The supernatant was collected and stored at −70°C until further use.

Immunohistochemical evaluation

Human OA and control sections were treated for 30 min with proteinase K (Kangchen BioTech Co., Ltd., Shanghai, China), 10 min with 3% hydrogen peroxide/methanol and 30 min with 10% goat serum (Vector Laboratories, Inc., Burlingame, CA, USA). Sections were incubated with mouse primary antibodies against TNF-α (1:100; cat. no. sc-52746; Santa Cruz Biotechnology Inc., Dallas, TX, USA); IL-1β (1:100; cat. no. sc-7884; Santa Cruz Biotechnology Inc.), type II collagen (1:100; cat. no. NB600-844; Novus Biologicals, LLC, Littleton, CO, USA) and S100B (1:100; cat. no. HPA015768; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 90 min. Subsequently, the sections were incubated with a secondary goat anti-mouse antibody (1:200; cat. no. KGAA37; Nanjing KeyGen Biotech. Co., Ltd., Nanjing, China) for 30 min at room temperature, followed by 5 min 3,3′-diaminobenzidine tetrahydrochloride solution staining, 8 min hematoxylin counterstaining and mounted using neutral balsam. A light microscope was used for evaluation and four distinct visual fields were observed. Digital images were subsequently analyzed using ImageJ software version 1.42q (National Institute of Health, Bethesda, MD, USA), according to previous studies (16,17), and the results are expressed as relative intensity of staining.

Human synovial fibroblast isolation and culture

Knee synovial tissues were obtained from normal patients with traumatic injury (as aforementioned) and human synovial fibroblasts were prepared using outgrowth technology, as described in a previous study (16). Briefly, synovial tissue samples were washed twice with PBS, minced into 1 mm pieces and placed in a 35 mm tissue culture dish and incubated in Ham's F12 medium supplemented with 10% FBS and penicillin/streptomycin (100 U/ml; all purchased from Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The medium was changed every 3–4 days. Following confluency (80–90%), cells were detached with 0.05% trypsin/EDTA solution and subcultured at a ratio of 1:3 (one plate was split into three plates). Human synovial fibroblasts were used between passage four and eight.

Lentiviral short interfering (si)RNA and overexpression vectors

Recombinant lentiviral particles overexpressing S100B or siRNA against S100B or fibroblast growth factor receptor 1 (FGFR1), and the controls (empty vector or Scrambled siRNA; sequences are provided in Table II). pLVX-IRES-ZsGreen1 was used as the overexpression vector, whereas pLVX-shRNA2 was used as the siRNA vector (both obtained from GenePharma Inc., Shanghai, China). Cells were grown to 40% confluency and transduced with complete medium containing lentiviral particles overexpressing S100B or siRNA against S100B or FGFR1 at concentrations of 1×108 transducing units/ml [multiplicity of infection (MOI) of 20] (18) at 37°C for 48 h. Polybrene (cat. no. H9268; Sigma-Aldrich; Merck KGaA) at a concentration of 8 µg/ml was added simultaneously to increase infection efficiency. No adverse effects were observed on the cell viability by siRNA or Polybrene (data not shown). The siRNAs had no off-target effects, and did not affect cell adherence, shape and viability at the MOI of 20, according to manufacturer's protocol and treatment duration.

Table II.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction and siRNA sequences.

Table II.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction and siRNA sequences.

GenePrimer sequence (5′-3′)
S100BF: CTGGAGAAGGCCATGGTTGC
R: CTCCAGGAAGTGAGAGAGCT
TNF-αF: GGAGAAGGGTGACCGACTCA
R: CTGCCCAGACTCGGCAA
IL-1βF: AAGCTGATGGCCCTAAACAG
R: AGGTGCATCGTGCACATAAG
FGF1F: ACAAGGGACAGGAGCGAC
R: TCCAGCCTTTCCAGGAACA
FGFR1F: TTCCTCATCTCCTGCATGGT
R: GTGGTGCTGAGTGTGCAAAT
GAPDHF: CAAAGCCAGAGTCCTTCAGA
R: GATGGTCTTGGTCCTTAGCC

GenesiRNA sequence (5′-3′)

S100B GGAATTCATGGCCTTTGTT
FGF CCACAGAATTGGAGGCTACAA
Scramble CCGTATCGTAAGCAGTACTTT

[i] IL-1β, interleukin 1β; FGF1, fibroblast growth factor 1; FGFR1, fibroblast growth factor receptor 1; TNF-α, tumor necrosis factor α.

Cell treatment and LPS simulation

To observe the effects of S100B on inflammatory cytokines, human synovial fibroblasts were infected with S100B overexpression, S100B siRNA, Scrambled siRNA or empty vector lentivirus as aforementioned, and subjected to LPS stimulation at 20 µg/l for 48 h, followed by cell lysing using 200–500 µl radioimmunoprecipitation assay (RIPA) buffer (Beyotime Institute of Biotechnology, Haimen, China) at 4°C and subsequently subjected to centrifugation at 14,000 × g for 15 min at 4°C to separate the total protein. In addition, condition medium was collected following further centrifugation at 1,500 × g for 15 min at 4°C. To observed the effects FGFR1 on inflammatory cytokines, human synovial fibroblasts were infected with S100B overexpression or empty vector lentivirus alone or co-transfected with FGFR1 siRNA or scramble siRNA lentivirus, stimulated with 20 µg/l LPS for 48 h before cell lysis and condition medium collection, as aforementioned.

ELISA

TNF-α and IL-1β expression levels from OA model and Control rabbit synovial fluid or condition medium of human synovial fibroblasts following cell treatment and LPS simulation were detected using the following ELISA kits purchased from R&D Systems, Inc. (Minneapolis, MN, USA): Rabbit TNF-α kit (cat. no. DY5670), human TNF-α kit (cat. no. DY210-05), rabbit IL-1β kit (cat. no. DY7464) and human IL-1β kit (cat. no. DY201-05). Following this, absorbance values were measured at 450 nm to determine the concentrations, according to the manufacturer's protocol.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

Total RNA was extracted from human synovial fibroblasts (1×106) that had previously undergone different treatments, or osteochondral samples from control and OA rabbits, using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). One Step SYBR PrimeScript RT-PCR kit (Takara Biotechnology Co., Ltd., Dalian, China) and an iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) were used for PCR. The temperature protocol used for RT was 42°C for 5 min followed by 95°C for 10 sec. The following thermocyling conditions were used for qPCR: 40 cycles at 95°C for 5 sec followed by 60°C for 30 sec; followed by a final termination step at 4°C for 10 min. Relative gene expression was determined by the 2−ΔΔCq method (19) and expression level of the GAPDH gene from the same samples was used as an internal control. Specific oligonucleotide primers for S100B, TNF-α, IL-1β, FGFR1 and GAPDH are listed in Table II.

Western blot analysis

Human synovial fibroblasts or cells (1×107 cells) in cartilage tissue (2–3 g) from OA model or Control rabbits were lysed in radioimmunoprecipitation assay buffer (RIPA; Beyotime Institute of Biotechnology, Nantong, China), and extracted by supernatant collection following high speed centrifugation at 14,000 × g for 15 min at 4°C, followed by bicinchoninic acid assay for protein quantification. Cellular proteins (20 µg) were separated by 10% SDS-PAGE gel and transferred onto polyvinylidene difluoride membranes. Subsequently, the membranes were blocked with non-fat milk and incubated with primary monoclonal antibodies at 4°C overnight against S100B (cat. no. 9550), FGF1 (cat. no. 3139) and FGFR1 (cat. no. 9740; all from Cell Signaling Technology, Inc., Danvers, MA, USA); and anti-β-actin antibody (Santa Cruz Biotechnology Inc.) was used as the loading control. Protein bands were incubated with horseradish peroxidase-conjugated secondary antibodies (cat. no. 7074; 1:2,000; Cell Signaling Technology, Inc.) at room temperature for 1 h and developed with SuperSignal Ultra Chemiluminescent Substrate (Pierce; Thermo Fisher Scientific, Inc.) and exposed on X-ray films (Kodak, Rochester, NY, USA). Image J software version 1.42 q (National Institutes of Health) was used for densitometric analysis, and protein expression levels were normalized against β-actin.

Statistical analysis

All experiments were performed at least three times. SPSS v18 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Data are presented as the mean ± standard deviation. Between-group comparisons were performed by using Student's t-test or one-way analysis of variance followed by Tukey's post hoc test. Correlation analysis was performed with Pearson's correlation. P<0.05 was considered to indicate a statistically significant difference.

Results

S100B, TNF-α and IL- expression in human OA tissues

Expression analysis of S100B, TNF-α and IL-1β was performed in human OA tissues (Fig. 1A; Table III). The relative staining intensity of S100B (1.28±0.66 vs. 0.42±0.31; P=0.01), TNF-α (2.17±0.63 vs. 1.02±0.61; P=0.02) and IL-1β (2.01±0.50 vs. 1.11±0.50; P=0.02) expression levels were significantly increased in the patients with OA compared with Control patients. Correlation analysis revealed a significant correlation between S100B and TNF-α (r=0.42; P=0.04; Fig. 1B) and between S100B and IL-1β (r=0.73; P=0.001; Fig. 1C).

Figure 1.

S100B expression levels are increased in patients with OA. (A) Immunohistochemical expression patterns and relative staining intensity quantification of the inflammatory mediators and growth factor in the cartilage tissue of patients with OA and healthy Controls. Correlation analysis between S100B and either (B) TNF-α or (C) IL-1β. IL, interleukin; OA, osteoarthritis; TNF, tumor necrosis factor. *P<0.05 vs. Control.

Table III.

Quantification of mRNA expression levels of S100B, TNF-α and IL-1β in human OA tissues.

Table III.

Quantification of mRNA expression levels of S100B, TNF-α and IL-1β in human OA tissues.

Gene nameOA (n=23)Control (n=20)P-value
S100B1.28±0.660.42±0.310.01
TNF-α2.17±0.631.02±0.610.02
IL-1β2.01±0.501.11±0.500.02

[i] IL-1β, interleukin 1β; OA, osteoarthritis; TNF-α, tumor necrosis factor α.

Increased expression levels of inflammatory cytokines in synovial joint fluid in OA model rabbits

A rabbit model of OA was established and the cartilage tissue and synovial fluid were collected for disease assessment. H&E staining revealed an increased cartilage tissue destruction; there was decreased SO staining of the superficial cartilage layer, as well as increased Mankin score, which indicated successful establishment of OA model (Fig. 2A and B, respectively). ELISA analysis was performed to quantify the level of inflammatory cytokines in synovial fluid, and it was demonstrated that TNF-α (573.3±15.4 vs. 102.6±8.7 pg; Fig. 2C) and IL-1β (378.6±7.2 vs. 170.1±5.8 pg; Fig. 2D) expression levels were significantly increased in OA compared with Control rabbits.

Figure 2.

Expression levels of inflammatory cytokines are increased in synovial joint fluid in a OA model rabbits. (A) Histological assessment of OA model by H&E and Safranin-O/Fast-Green staining. Decreased Safranin-O staining superficial cartilage layer in the OA knees indicated the successful establishment of OA model. (B) Mankin score assessment of OA model. Significantly increased Mankin score was demonstrated in OA compared with the control rabbits. (C) Increased expression levels of TNF-α were demonstrated in OA compared with the control rabbits. (D) Increased expression levels of IL-1β were demonstrated in OA compared with the control rabbits. **P<0.01 vs. Control. H&E, hematoxylin and eosin; IL, interleukin; OA, osteoarthritis; TNF, tumor necrosis factor.

S100B expression levels are increased in OA rabbits

Owing to the increased expression levels of inflammatory cytokines in OA rabbits, the possible changes of the genes including S100B, FGF1 and FGFR1 were investigated using OA and Control cartilage tissue. The results demonstrated that S100B mRNA (3.5±0.8 vs. 1.0±0.4) and protein (1.7-fold) expression levels were significantly increased in OA compared with Control rabbits (Fig. 3A and B, respectively). Significant increases in expression were also observed for FGF1 mRNA (2.1±0.7 vs. 1.0±0.3) and protein (2.1-fold) levels, as well as FGFR1 mRNA (1.8±0.7 vs. 1.0±0.3) and protein (2.0-fold) levels in OA compared with the Control rabbits (Fig. 3A and B). In addition, immunohistochemical staining confirmed that the expression levels of S100B were increased and the level of type II collagen was decreased in OA compared with the Control rabbits (Fig. 3C).

Figure 3.

S100B, FGF1 and FGFR1 expression levels are increased in OA model rabbits. (A) Increased expression levels of S100B, FGF1 and FGFR1 mRNA in OA rabbits compared with Control rabbits were determined by reverse transcription-quantitative polymerase chain reaction. (B) Increased protein expression levels of S100B, FGF1 and FGFR1 were determined by western blotting. (C) Immunohistochemical analysis demonstrated increased S100B-specific staining and decreased type II collagen staining in OA rabbits compared with Control rabbits. *P<0.05 vs. Control. FGF, fibroblast growth factor; FGFR, FGF receptor; OA, osteoarthritis.

S100B regulates inflammatory cytokine secretion in human synovial fibroblasts

Owing to the increased expression levels of S100B and some inflammatory cytokines in OA rabbits, synovial fibroblasts were isolated from normal human cartilage tissues and the expression levels of inflammatory cytokines were analyzed in the condition medium following manipulation of S100B expression by overexpression vector or siRNA transfection (Fig. 4). The results indicated that S100B overexpression significantly increased TNF-α (623.8±23.8 vs. 214.5±14.8 pg; Fig. 4B) and IL-1β (1101.3±29.6 vs. 617.5±37.5 pg; Fig. 4C) expression levels in LPS-stimulated human synovial fibroblasts compared with Control transfected cells, whereas S100B knockdown decreased TNF-α (186.2±16.7 vs. 214.5±14.8 pg; Fig. 4E) and IL-1β (404.1±15.99 vs. 617.5±37.5 pg; Fig. 4F) expression levels in the LPS-stimulated human synovial fibroblasts compared with the Controls.

Figure 4.

S100B regulates inflammatory cytokine expression levels in human synovial fibroblasts. (A) S100B overexpression was confirmed by RT-qPCR. (B) Increased TNF-α levels in S100B-overexpressing, LPS-stimulated fibroblast, as measured by ELISA. (C) Increased expression levels of IL-1β in S100B-overexpressing LPS-stimulated fibroblasts, as measured by ELISA. (D) S100B knockdown was confirmed by RT-qPCR. (E) TNF-α levels were reduced in LPS-stimulated fibroblasts transfected with S100B siRNA. (F) IL-1β levels were reduced in LPS-stimulated fibroblasts transfected with S100B siRNA. *P<0.05 vs. Empty vector or Scrambled siRNA controls; **P<0.01 vs. Empty vector; #P<0.05 vs. LPS group; †P<0.05 vs. LPS + Empty vector; ‡P<0.05 vs. LPS + scramble siRNA. IL, interleukin; LPS, lipopolysaccharide; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; siRNA, small interfering RNA; TNF-α, tumor necrosis factor.

FGFR1 is involved in the S100B-mediated inflammation response in LPS-treated synovial fibroblasts

As S100B is an intracellular protein and FGFR1-mediated signaling pathway is involved in the inflammatory effects in synovial tissues (20), the roles of S100B and FGFR1 were investigated. FGFR1 mRNA and protein expression levels (Fig. 5A and B, respectively) were increased in human synovial fibroblasts cells overexpressing S100B and were significantly decreased in cells treated with S100B siRNA knockdown, compared with Control cells. Furthermore, FGFR1 knockdown was performed (Fig. 5C), and the results of the RT-qPCR analyses revealed significantly decreased levels of FGF1 mRNA in knockdown cells, which confirmed that transfection was successfully performed. In addition, the change of inflammatory cytokine expression into the condition medium of LPS stimulated human synovial fibroblasts was investigated, and the results revealed that increased FGFR1 expression induced by LPS and S100B overexpression was significantly attenuated following treatment with FGFR1 siRNA (Fig. 5D and E). The results demonstrated that FGFR1 knockdown significantly decreased TNF-α (197.9±16.7 vs. 631±33 pg; Fig. 5F) and IL-1β (588.7±33.1 vs. 1173±30 pg; Fig. 5G) secretion levels in LPS-stimulated S100B-overexpressing human synovial fibroblasts.

Figure 5.

FGFR1 mediates the inflammatory effects of S100B. (A) FGFR1 mRNA expression levels were increased or decreased in S100B-overexpressing and S100B-siRNA synovial fibroblasts, respectively, as measured by RT-qPCR. (B) FGFR1 protein expression levels were increased or decreased in S100B-overexpressing and S100B-siRNA synovial fibroblasts, respectively, as measured by western blotting. (C) Validation of the FGFR1 knockdown FGFR1, by RT-qPCR. (D) RT-qPCR and (E) western blotting were used to determine FGFR1 expression levels in LPS-simulated S100B overexpressed synovial fibroblasts. Increased FGFR1 expression induced by LPS and S100B overexpression was significantly attenuated by FGFR1 siRNA. (F) TNF-α expression levels were decreased following FGFR1 knockdown in LPS-simulated, S100B-overexpressing synovial fibroblasts. (G) IL-1β expression levels were decreased following FGFR1 knockdown in LPS-simulated, S100B-overexpressing synovial fibroblasts. **P<0.01 vs. LPS + Empty vector or LPS + Scrambled siRNA; †P<0.05 vs. LPS + Empty vector; $P<0.05 vs. LPS + Scrambled siRNA; #P<0.05 vs. LPS + S100B + Scrambled siRNA. IL-1β, interleukin 1β; FGFR, fibroblast growth factor receptor; LPS, lipopolysaccharide; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; siRNA, small interfering RNA; TNF-α, tumor necrosis factor.

Discussion

In the present study, cartilage tissue and synovial fluid from patients with OA and a rabbit model of OA, as well as human synovial fibroblasts were used to investigate the role of S100B in the inflammatory response during OA. The results demonstrated that increased expression levels of the inflammatory cytokines TNF-α and IL-1β in OA rabbits were accompanied with significantly increased expression of S100B, FGF1 and FGFR1 at the mRNA and protein level. Furthermore, S100B overexpression and knockdown revealed its regulatory role on the production of TNF-α and IL-1β in LPS-stimulated human synovial fibroblasts. In addition, it was also demonstrated that FGFR1-mediated signaling pathway may be involved in the effects of S100B on inflammatory cytokines. To the best of our knowledge, this is the first study to explore the role of S100B in inflammatory response regulation during OA.

The S100 protein family includes 24 members that function as intracellular and/or extracellular regulators (21). Within cells, S100 proteins serve important roles in multiple biological processes, including cell proliferation, differentiation, apoptosis, Ca2+ homeostasis, energy metabolism, inflammation and migration/invasion through interactions with a variety of target proteins (such as enzymes, cytoskeletal subunits, receptors, transcription factors and nucleic acids). S100B is expressed in chondrocytes (22) and synovial fibroblasts (23). S100B has also been associated with chronic inflammation conditions such as rheumatoid arthritis, diabetes and cystic fibrosis (24); however, its role in inflammation regulation during OA has not yet been explored. In the present study, it was demonstrated that S100B mRNA and protein expression levels were increased in OA rabbits and S100B overexpression and knockdown experiments indicated a regulatory role on the production of TNF-α and IL-1β in LPS-stimulated human synovial fibroblasts.

FGFRs contain an extracellular ligand-binding domain and an intracellular tyrosine kinase domain, and are single-pass transmembrane receptors that belong to the receptor tyrosine kinases (RTK) family (25). Activation of RTKs by their corresponding ligands (such as FGFs) activate kinases that subsequently initiate intracellular signaling networks that regulate key cellular processes such as cell proliferation, growth, differentiation, migration and survival (25,26). Furthermore, the spatial and temporal expression of ligands and receptors, as well as the binding specificity between ligands and receptors may affect FGF signaling pathway regulation (27,28). Specificity of FGFR-mediated signaling depends on the cell type and the maturation stage of the cell, and a number of different signaling pathways are involved, including the mitogen-activated protein kinase pathway (extracellular signal-regulated kinases 1 and 2, p38, and c-Jun N-terminal kinases), the phosphoinositide 3-kinase/Akt pathway, and the phospholipase Cγ pathway (29). As FGF ligands are involved in articular cartilage maintenance, it is reasonable to postulate that FGFRs may also serve a crucial role in articular cartilage homeostasis. Notably, highly expressed FGFR1 and FGFR3 in human articular chondrocytes have been implicated in cartilage metabolism (30). In myoblasts, extracellular S100B was demonstrated to modulate differentiation, stimulate proliferation and reduce apoptosis in vitro by engaging its multi-ligand receptor, receptor for advanced glycosylation end-products, or enhancing basic-FGF (bFGF)-FGFR1 signaling, depending on myoblast density (31,32). In early acute injuries, muscles release S100B prior to bFGF and high mobility group box protein (HMGB)-1, and this initial expression diminishes over time, suggesting that S100B may regulate the initial phases of the regeneration process (24). According to a previous study, synovial macrophages and fibroblasts were demonstrated to actively secrete HMGB1 in collagen-induced arthritis and in hypoxic conditions (33). These similarities between myoblasts and bone tissues may indirectly support the association between S100B and FGFR1 in synovial macrophages. The present results indicated that FGF1 and FGFR1 expression levels were significantly increased during OA and were consistent with the pattern of increased S100B expression. Furthermore, a previous study demonstrated that silencing of FGFR1 in adult mouse articular chondrocytes inhibits cartilage degeneration progression (34). Knockdown FGFR1 in S100B-overexpressing human synovial fibroblasts in the present study demonstrated that FGFR1 knockdown may attenuate the inflammatory effects exerted by S100B. These data provided a potential link between FGFR1, S100B and inflammatory effects. However, owing to the lack of a purified S100B, whether S100B may also interact with bFGF extracellularly, as previously described (35), were not explored in the present study.

Furthermore, spontaneous OA models, which were not induced via gene modification methods such as knockout mice or animals, would provide the best models to study the aging phenotype as they represent primary OA (36). In the present study an OA model rabbit was established, which is also a spontaneous OA model. Compared with the more expensive genetically modified models (fit for specific gene function investigation) and large animal models (suitable for therapy test) (36), the present model could mimic OA disease progression condition with a lower cost.

In conclusion, it was demonstrated that S100B may be involved in the FGFR1-mediated inflammatory response during OA, which may be considered as a potential therapeutic target; however, further studies are needed to confirm the present findings.

Acknowledgements

Not applicable.

Funding

The present study was supported by Science and Technology Plan of Suzhou Municipal Government (grant. no. SYS201502, to Lifan Zhu) and Ke Jiao Xing Wei Plan of Wujiang District (grant no. wwk201704, to Pengcheng Shen).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LZ, ZW, PS and HY analyzed and interpreted the patient data. LZ, ZW, PS, JZhou, JZen, FW, XZ and HY performed the experiments and analyzed the data. LZ, ZW, PS and HY contributed to the writing of the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Review Board of Soochow University; written informed consent was provided by all participants. The animal study protocol was approved by the Institutional Animal Care and Use Committee of Soochow University and was conducted following the international guidelines for animal experimentation.

Patient consent for publication

Patients provided written informed consent for publication.

Competing interests

The authors declare that they have no competing interests.

References

1 

Palazzo C, Nguyen C, Lefevre-Colau MM, Rannou F and Poiraudeau S: Risk factors and burden of osteoarthritis. Ann Phys Rehabil Med. 59:134–138. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Prieto-Alhambra D, Judge A, Javaid MK, Cooper C, Diez-Perez A and Arden NK: Incidence and risk factors for clinically diagnosed knee, hip and hand osteoarthritis: Influences of age, gender and osteoarthritis affecting other joints. Ann Rheum Dis. 73:1659–1664. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Lohmander LS and Roos EM: Clinical update: Treating osteoarthritis. Lancet. 370:2082–2084. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Karsdal MA, Michaelis M, Ladel C, Siebuhr AS, Bihlet AR, Andersen JR, Guehring H, Christiansen C, Bay-Jensen AC and Kraus VB: Disease-modifying treatments for osteoarthritis (DMOADs) of the knee and hip: Lessons learned from failures and opportunities for the future. Osteoarthritis Cartilage. 24:2013–2021. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Goldring MB and Otero M: Inflammation in osteoarthritis. Curr Opin Rheumatol. 23:471–478. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Berenbaum F: Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis Cartilage. 21:16–21. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Sellam J and Berenbaum F: The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat Rev Rheumatol. 6:625–635. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Sorci G, Bianchi R, Riuzzi F, Tubaro C, Arcuri C, Giambanco I and Donato R: S100B protein, a damage-associated molecular pattern protein in the brain and heart, and beyond. Cardiovasc Psychiatry Neurol. 2010:6564812010. View Article : Google Scholar : PubMed/NCBI

9 

Sorci G, Riuzzi F, Arcuri C, Tubaro C, Bianchi R, Giambanco I and Donato R: S100B protein in tissue development, repair and regeneration. World J Biol Chem. 4:1–12. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Yammani RR: S100 proteins in cartilage: Role in arthritis. Biochim Biophys Acta. 1822:600–606. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Yammani RR, Carlson CS, Bresnick AR and Loeser RF: Increase in production of matrix metalloproteinase 13 by human articular chondrocytes due to stimulation with S100A4: Role of the receptor for advanced glycation end products. Arthritis Rheum. 54:2901–2911. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Huang ZY, Stabler T, Pei FX and Kraus VB: Both systemic and local lipopolysaccharide (LPS) burden are associated with knee OA severity and inflammation. Osteoarthritis Cartilage. 24:1769–1775. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Ferdowsian HR and Beck N: Ethical and scientific considerations regarding animal testing and research. PLoS One. 6:e240592011. View Article : Google Scholar : PubMed/NCBI

14 

Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, Christy W, Cooke TD, Greenwald R and Hochberg M: Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and therapeutic criteria committee of the American rheumatism association. Arthritis Rheum. 29:1039–1049. 1986. View Article : Google Scholar : PubMed/NCBI

15 

Pritzker KP, Gay S, Jimenez SA, Ostergaard K, Pelletier JP, Revell PA, Salter D and van den Berg WB: Osteoarthritis cartilage histopathology: Grading and staging. Osteoarthritis Cartilage. 14:13–29. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Ogura N, Tobe M, Sakamaki H, Kujiraoka H, Akiba M, Abiko Y and Nagura H: Interleukin-1beta induces interleukin-6 mRNA expression and protein production in synovial cells from human temporomandibular joint. J Oral Pathol Med. 31:353–360. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Ji Y, Strawn TL, Grunz EA, Stevenson MJ, Lohman AW, Lawrence DA and Fay WP: Multifaceted role of plasminogen activator inhibitor-1 in regulating early remodeling of vein bypass grafts. Arterioscler Thromb Vasc Biol. 31:1781–1787. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Chang J, Tang L, Lei H, Zhang XG, Zuo Z, Huang W and Fu H: Effects of lentiviral infection of mesenchymal stem cells on the expression of octamer transcription factor 4. Mol Med Rep. 10:2249–2254. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Gupta AA, Chou RH, Li H, Yang LW and Yu C: Structural insights into the interaction of human S100B and basic fibroblast growth factor (FGF2): Effects on FGFR1 receptor signaling. Biochim Biophys Acta. 1834:2606–2619. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Donato R, Cannon BR, Sorci G, Riuzzi F, Hsu K, Weber DJ and Geczy CL: Functions of S100 proteins. Curr Mol Med. 13:24–57. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Donato R, Sorci G, Riuzzi F, Arcuri C, Bianchi R, Brozzi F, Tubaro C and Giambanco I: S100B's double life: Intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793:1008–1022. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Bo GP, Zhou LN, He WF, Luo GX, Jia XF, Gan CJ, Chen GX, Fang YF, Larsen PM and Wu J: Analyses of differential proteome of human synovial fibroblasts obtained from arthritis. Clin Rheumatol. 28:191–199. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Hofmann MA, Drury S, Fu C, Qu W, Taguchi A, Lu Y, Avila C, Kambham N, Bierhaus A, Nawroth P, et al: RAGE mediates a novel proinflammatory axis: A central cell surface receptor for S100/calgranulin polypeptides. Cell. 97:889–901. 1999. View Article : Google Scholar : PubMed/NCBI

25 

Schlessinger J: Cell signaling by receptor tyrosine kinases. Cell. 103:211–225. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Lemmon MA and Schlessinger J: Cell signaling by receptor tyrosine kinases. Cell. 141:1117–1134. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Turner N and Grose R: Fibroblast growth factor signalling: From development to cancer. Nat Rev Cancer. 10:116–129. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Dailey L, Ambrosetti D, Mansukhani A and Basilico C: Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor Rev. 16:233–247. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Ornitz DM and Itoh N: The fibroblast growth factor signaling pathway. Wiley Interdiscip Rev Dev Biol. 4:215–266. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Tang J, Su N, Zhou S, Xie Y, Huang J, Wen X, Wang Z, Wang Q, Xu W, Du X, et al: Fibroblast growth factor receptor 3 inhibits osteoarthritis progression in the knee joints of adult mice. Arthritis Rheumatol. 68:2432–2443. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Riuzzi F, Beccafico S, Sagheddu R, Chiappalupi S, Giambanco I, Bereshchenko O, Riccardi C, Sorci G and Donato R: Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy. Sci Rep. 7:125372017. View Article : Google Scholar : PubMed/NCBI

32 

Juban G and Chazaud B: Metabolic regulation of macrophages during tissue repair: Insights from skeletal muscle regeneration. FEBS Lett. 591:3007–3021. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Bertheloot D and Latz E: HMGB1, IL-1α, IL-33 and S100 proteins: Dual-function alarmins. Cell Mol Immunol. 14:43–64. 2017. View Article : Google Scholar : PubMed/NCBI

34 

Weng T, Yi L, Huang J, Luo F, Wen X, Du X, Chen Q, Deng C, Chen D and Chen L: Genetic inhibition of fibroblast growth factor receptor 1 in knee cartilage attenuates the degeneration of articular cartilage in adult mice. Arthritis Rheum. 64:3982–3992. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Riuzzi F, Sorci G and Donato R: S100B protein regulates myoblast proliferation and differentiation by activating FGFR1 in a bFGF-dependent manner. J Cell Sci. 124:2389–2400. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Kuyinu EL, Narayanan G, Nair LS and Laurencin CT: Animal models of osteoarthritis: Classification, update, and measurement of outcomes. J Orthop Surg Res. 11:192016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu L, Weng Z, Shen P, Zhou J, Zeng J, Weng F, Zhang X and Yang H: S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling. Mol Med Rep 18: 4855-4864, 2018.
APA
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F. ... Yang, H. (2018). S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling. Molecular Medicine Reports, 18, 4855-4864. https://doi.org/10.3892/mmr.2018.9523
MLA
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F., Zhang, X., Yang, H."S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling". Molecular Medicine Reports 18.6 (2018): 4855-4864.
Chicago
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F., Zhang, X., Yang, H."S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling". Molecular Medicine Reports 18, no. 6 (2018): 4855-4864. https://doi.org/10.3892/mmr.2018.9523
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu L, Weng Z, Shen P, Zhou J, Zeng J, Weng F, Zhang X and Yang H: S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling. Mol Med Rep 18: 4855-4864, 2018.
APA
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F. ... Yang, H. (2018). S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling. Molecular Medicine Reports, 18, 4855-4864. https://doi.org/10.3892/mmr.2018.9523
MLA
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F., Zhang, X., Yang, H."S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling". Molecular Medicine Reports 18.6 (2018): 4855-4864.
Chicago
Zhu, L., Weng, Z., Shen, P., Zhou, J., Zeng, J., Weng, F., Zhang, X., Yang, H."S100B regulates inflammatory response during osteoarthritis via fibroblast growth factor receptor 1 signaling". Molecular Medicine Reports 18, no. 6 (2018): 4855-4864. https://doi.org/10.3892/mmr.2018.9523
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team