Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2019 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2019 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression

  • Authors:
    • Danmei Pang
    • Qian Hu
    • Xiaoshan Lan
    • Yingxin Lin
    • Haibo Duan
    • Shuo Cao
    • Yaodong Lin
    • Litao Li
    • Feng Peng
    • Fengtao Pan
  • View Affiliations / Copyright

    Affiliations: Department of Breast Cancer Oncology, Foshan Hospital of Sun Yat‑Sen University, Foshan, Guangdong 528000, P.R. China
  • Pages: 1824-1832
    |
    Published online on: December 24, 2018
       https://doi.org/10.3892/mmr.2018.9789
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Long non‑coding RNAs (lncRNAs) have recently been reported to act as important mediators of tumor initiation and progression. The present study aimed to investigate the expression and pathogenic roles of the lncRNA prostate cancer‑associated non‑coding RNA (PRNCR)1‑2 in breast cancer. The expression levels of PRNCR1‑2 were detected in breast cancer tissues and numerous breast cancer cell lines using reverse transcription‑quantitative polymerase chain reaction. Depletion of PRNCR1‑2 expression in breast cancer cells was conducted through small interfering RNA‑mediated silencing. Subsequently, cell proliferation was assessed by MTS assay, cell migration and invasion capacities were evaluated using the Transwell culture system, and cell cycle progression and apoptosis were analyzed by flow cytometry. Protein expression levels of the signaling components checkpoint kinase 2 (CHK2), protein kinase B (AKT), phosphorylated (p)‑CHK2 and p‑AKT were measured by western blotting. The results demonstrated that PRNCR1‑2 expression was significantly elevated in breast cancer tissues compared with in adjacent normal tissues. Furthermore, depletion of PRNCR1‑2 in HS‑578T and MDA‑MB‑231 breast cancer cells markedly suppressed their proliferation rates, migration and invasion capacities, and cell cycle progression; however, it had no effect on cell apoptosis. In addition, PRNCR1‑2 depletion increased CHK2 phosphorylation and decreased AKT phosphorylation in HS‑578T and MDA‑MB‑231 cells. In conclusion, the lncRNA PRNCR1‑2 may promote breast cancer cell proliferation, migration, invasion and cell cycle progression.

Introduction

Breast cancer is a major human malignancy and is the second leading cause of cancer-associated mortality in women worldwide, following lung cancer (1). As estimated by the American Cancer Society, there will be >266,000 new cases of breast cancer and >40,000 cases of breast cancer-associated mortality in the next 10 years in the United States, thus accounting for 30 and 14% of total cancer cases and cases of cancer-associated mortality, respectively (1). Survival rates of patients with breast cancer is relatively low, particularly in developing countries; however, a 5-year survival rate of >80% has been achieved in England and the United States (2). As a complex heterogeneous malignancy, breast cancer remains a severe public health concern, due to ambiguities regarding the stepwise pathological processes from normal breast tissue to metastatic cancer tissue (3,4). Previous studies have revealed that the pathogenesis of breast cancer is accompanied and driven by a series of successive mutations in genetic and epigenetic networks in breast cells, finally resulting in activation of various hallmarks, malignant transformation and metastasis (5,6). In recent years, it has been suggested that noncoding RNAs (ncRNAs) are responsible for genetic and epigenetic dysregulation, which is associated with various developmental and pathological processes, including tumorigenesis (7,8). However, the specific roles of ncRNAs in breast cancer remain to be investigated.

Long ncRNAs (lncRNAs) refer to ncRNA transcripts containing >200 nucleotides, which are involved in post-transcriptional regulation of gene expression by interfering with microRNA functioning (9). Through modulating gene expression at the transcriptional, post-transcriptional and epigenetic levels, lncRNAs have been reported to be associated with various physiological and pathological processes, including stem cell development, neurogenesis and oncogenesis (8,9). In various types of human cancer, lncRNAs act as promoters and maintainers of cancer initiation and progression; therefore, they have been considered potential biomarkers for clinical diagnosis, and also as therapeutic targets for the development of novel treatments (10,11). Based on functional studies using cellular and animal models, it has been reported that lncRNAs are involved in various cancer-associated cellular phenotypes, including cell death inhibition, activation of invasion, proliferation maintenance, dysregulated cellular energetics, genomic instability and evasion of growth suppressors (12). LncRNAs have also been identified as key regulators in breast cancer. For example, the lncRNA HOX transcript antisense RNA, which promotes cancer metastasis by modulating chromatin states, has been identified as a potential prognostic marker of cancer metastasis for estrogen receptor (ER)-positive breast cancer (13). Furthermore, the lncRNA urothelial cancer-associated 1 has been reported to enhance breast tumor growth through suppression of p27 protein levels via competitive inhibition (14). An accumulating number of lncRNAs have been demonstrated to be associated with breast cancer initiation and progression, thus suggesting that functional elucidation of key lncRNAs in breast cancer cells may provide valuable information for clinical screening and management. Prostate cancer-associated ncRNA 1 (PRNCR1) is closely associated with resistance of prostate cancer to castration (15), colorectal cancer cell proliferation and cell cycle progression (16), and progression of other types of cancer (17). However, to the best of our knowledge, the implications of PRNCR1 in breast cancer progression have not been previously addressed.

In the present study, the expression levels of PRNCR1 were detected in clinical tissues from patients with breast cancer, as well as in numerous breast cancer cell lines. Subsequently, PRNCR1 expression was knocked down in breast cancer cells and a functional analysis was conducted. The present study identified an association between PRNCR1 and breast cancer, and therefore provided a novel candidate for ncRNA-based breast cancer diagnosis and treatment. These findings may also result in future elucidation of the pathological mechanisms underlying breast cancer initiation and progression.

Materials and methods

Cancer tissues and cell lines

Breast cancer tissues and paired adjacent normal tissues were collected from 20 patients at the Department of Breast Surgery, Foshan First People's Hospital (Foshan, China) between June 2015 and July 2017. Breast cancer was confirmed by pathological diagnosis post-operation, and the clinicopathological data of patients are displayed in Table I. The experimental procedures were approved by the Ethics Committee of Foshan First People's Hospital, and written informed consent was obtained from each participant prior to surgery. The breast cancer cell lines HS-578T (cat. no. HTB-126), MCF-7 (cat. no. HTB-22), MDA-MB-468 (cat. no. HTB-132), MDA-MB-231 (cat. no. HTB-26) and BT-549 (cat. no. HTB-122), and the mammary epithelial cell line MCF10A (cat. no. CRL-10317) were obtained from the American Type Culture Collection (Manassas, VA, USA). Breast cancer cells and the mammary epithelial cell line were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Biowest, Nuaillé, France) in a humidified atmosphere supplied with 5% CO2 at 37°C.

Table I.

Clinicopathological data of patients with breast cancer.

Table I.

Clinicopathological data of patients with breast cancer.

CharacteristicNumber
Age (years)
  <5512
  >558
Sex
  Male0
  Female20
Distant metastasis
  Absent10
  Present10
Histological grade
  13
  211
  36
Tumor size (cm)
  ≤26
  2-513
  >51
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Relative lncRNA expression levels were measured in total RNA samples extracted from breast cancer tissues and cell lines by RT-qPCR. Prior to RNA extraction, breast tissues were homogenized in liquid nitrogen and breast cell lines were collected by centrifugation at 800 × g for 10 min at room temperature, followed by three washes with PBS. Total RNA samples were extracted using TRIzol® solution (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA concentrations were determined by spectrophotometer (NanoDrop™ 1000; NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). Subsequently, 2.0 µg RNA was used for cDNA synthesis by Moloney Murine Leukemia Virus reverse transcriptase (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol, and PCR analysis was performed using the 2X EasyTaq PCR SuperMix kit (cat. no. AS111-03; Beijing Transgen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. The thermocycling conditions for qPCR were: An initial denaturation at 95°C for 120 sec, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec for primer annealing and elongation, ending with a melting curve step of 65°C to 95°C with an increment of 0.5°C/5 sec. β-actin was used as an internal standard for quantification. The relative expression levels of genes were calculated using the 2−ΔΔCq method (18). For statistical analysis, at least three biological and technical replicates were performed. The following primers were used for detection of PRNCR1-2 expression: Forward, 5-CCTTTCCCTCATGACCCAGT-3 and reverse, ATTGGTGTGAGGGGAGTCTG. β-Actin: Forward, CATGTACGTTGCTATCCAGGC and reverse, CTCCTTAATGTCACGCACGAT.

Cell transfection

For knockdown of PRNCR1-2 expression, breast cancer cells were digested with trypsin solution, seeded into 6-well plates and cultured overnight at 37°C in an atmosphere containing 5% CO2. Once cells reached 80% confluence, they were washed twice with PBS and added to 1.5 ml fresh basal DMEM. Subsequently, the cells were mixed with 10 µl 20 µM small interfering RNA (siRNA; sequence: 5′-CCATTAAGCTTGAGGCAAT-3′; 5′-ATTGCCTCAAGCTTAATGG-3′), or negative control siRNA (sequence: 5′-UUCUCCGAACGUGUCACGUTT-3′; 5′-ACGUGACACGUUCGGAGAATT-3′), synthesized by Guangzhou Forevergen Biosciences Co., Ltd., Guangzhou, China and dissolved in 250 µl Gibco™ Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.). The cells were then incubated with 5 µl Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.), which was pre-mixed with 250 µl Opti-MEM, at 37°C for 4 h in an atmosphere containing 5% CO2. Finally, cells were cultured in fresh DMEM 48 h prior to the subsequent assays.

Cell proliferation assay

Proliferation rates of breast cancer cells were determined using the MTS method. A single-cell suspension was prepared by digesting breast cancer cells with trypsin solution, followed by cell counting. Cell density was adjusted to 3×104 cells/ml, and cells were seeded into 96-well plates (100 µl/well). MTS solution (10 µl; cat. no. ab197010; Abcam, Cambridge, UK) was added to the cultured breast cancer cells at a 1:10 ratio, and cells were incubated at 37°C for 4 h in an atmosphere containing 5% CO2. Finally, cell proliferation rates were measured by detecting the absorbance at 490 nm using a microplate reader. At least three biological repeats were performed for statistical analysis.

Cell migration and invasion assays

To evaluate breast cancer cell migration, cultured cells were collected by trypsin digestion and centrifugation at 100 × g for 1 min at room temperature, diluted in serum-free medium to obtain 1×105 cells/ml, and a 100-µl cell suspension was added to the upper chambers of a Transwell system. The lower chambers of the Transwell system were filled with 600 µl fresh DMEM. After being cultured under normal conditions for 48 h, migrated cells were fixed with 4% paraformaldehyde for 15 min, stained with 1% crystal violet for 10 min both at room temperature, washed with PBS, and finally observed and counted under an inverted fluorescence microscope (Leica Microsystems GmbH, Wetzlar, Germany). To assess cell invasion, Matrigel matrix (Corning Incorporation, Corning, NY, USA) was mixed with DMEM at a ratio of 1:3, and was added to the Transwell chambers and incubated at 37°C for 2 h. Cells were then cultured for 48 h at 37°C, fixed with 4% paraformaldehyde for 15 min, stained with 1% crystal violet for 10 min, both at room temperature, and finally analyzed under a microscope.

Cell cycle progression analysis

Breast cancer cells (80% confluence) were washed three times with PBS, and a single-cell suspension was generated through trypsin digestion. Subsequently, ~1×106 cells were fixed with 70% ethanol at −20°C overnight. Cells were then collected by centrifugation at 500 × g for 5 min and were washed twice with PBS. Cell precipitates were then resuspended in 500 ml Cell Cycle staining buffer (cat. no. F559763; Guangzhou Forevergen Biosciences Co., Ltd.), incubated at 37°C for 30 min, and finally detected by flow cytometry (Sysmex Partec GmbH, Görlitz, Germany). Three biological replicates were performed for statistical analysis.

Cell apoptosis assay

Cell apoptosis was determined using the Annexin V-allophycocyanin/7-aminoactinomycin D (7-AAD) Apoptosis Detection kit (cat. no. 40309ES20; Yeasen, Shanghai, China), according to the manufacturer's protocol. Breast cancer cells were collected by digestion with EDTA-free trypsin solution and were centrifuged at 800 × g for 5 min. Cell precipitates were then resuspended in 1X binding buffer, and cell density was adjusted to 1×106 cells/ml. Finally, 100 µl cells were incubated with 5 µl Annexin V and 5 µl 7-AAD in the dark for 15 min at room temperature, incubated with 400 µl binding buffer for 1 h, and analyzed by flow cytometry (Sysmex Partec GmbH). Data from three biological repeats were used for statistical analysis.

Western blotting

Protein was extracted using RIPA Lysis Buffer (Beyotime Institute of Biotechnology, Haimen, China). The concentration was determined using the Bicinchoninic Acid Kit for Protein Determination (Sigma-Aldrich; Merck KGaA). Total proteins were extracted from breast tissues and breast cancer cell lines for immunoblotting. Briefly, 35 µg total proteins were boiled at 100°C for 5 min, loaded and separated by 12% SDS-PAGE, and electroblotted onto polyvinylidene fluoride (PVDF) membranes (EMD Millipore, Billerica, MA, USA). PVDF membranes were then blocked with 5% lipid-free milk solution for 1 h at room temperature, and incubated with primary antibodies against phosphorylated (p)-checkpoint kinase 2 p-CHK2 (cat. no. ab59408; 1:1,000), CHK2 (cat. no. ab47433; 1:1,000), p-protein kinase B p-AKT (cat. no. ab38449; 1:500) and AKT (cat. no. ab179463; 1:500; all Abcam) at room temperature for 1 h. The membranes were then washed three times with PBS, incubated with horseradish peroxidase-conjugated secondary antibodies (cat. no. ab6940; 1:10,000; Abcam) at room temperature for 1 h, and finally detected with enhanced chemiluminescence solutions (Thermo Fisher Scientific, Inc., Waltham, MA, USA). GAPDH (cat. no. ab181602; 1:10,000; Abcam) was used as an internal standard, and three biological repeats were performed. Signals were densitometrically assessed using Quantity One® software version 4.5 (Bio Rad Laboratories, Inc., Hercules, CA, USA).

Statistical analysis

Data were presented as mean ± standard error of the mean. The present findings were statistically analyzed using SPSS 18.0 software package (SPSS, Inc., Chicago, IL, USA) via Student's t-test or one way analysis of variance, least significant difference test was used to analyze the differences among more than two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

PRNCR1-2 expression is elevated in breast cancer

To identify a novel lncRNA associated with breast cancer pathogenesis, the expression levels of PRNCR1-2 were analyzed in 20 pairs of breast cancer and adjacent normal tissues (Fig. 1A). Compared with the normal tissues, the expression levels of PRNCR1-2 were significantly elevated in breast cancer tissues (P<0.05; Fig. 1A). For further validation, PRNCR1-2 expression was confirmed in five breast cancer cell lines and a mammary epithelial cell line; PRNCR1-2 were successfully overexpressed in the cancer cell lines HS-587T, MCF-7, MDA-MB-468 and MDA-MB-231 compared with the mammary epithelial cell line MCF10A, but failed to overexpress in the cancer cell line BT-549 (Fig. 1B). The upregulation of PRNCR1-2 expression in breast cancer tissues suggested that PRNCR1-2 may have pathogenic roles in breast cancer. Due to the high expression level of PRNCR1-2 in HS-587T and MDA-MB-231 cells, these two cell lines were chosen for the following studies.

Figure 1.

PRNCR1-2 expression in breast cancer. (A) PRNCR1-2 expression in breast cancer tissues and paired adjacent normal tissues. (B) PRNCR1-2 expression in MCF10A and five breast cancer cell lines. The relative expression levels of PRNCR1-2 were determined by reverse transcription-quantitative polymerase chain reaction. **P<0.01 vs. N or MCF10A. N, normal adjacent tissues; PRNCR1-2, prostate cancer-associated non-coding RNA 1–2; T, tumor tissues.

PRNCR1-2 depletion in HS-587T and MDA-MB-231 cells

To investigate the potential roles of the lncRNA PRNCR1-2 in breast cancer pathogenesis, HS-587T and MDA-MB-231 breast cancer cells were transfected with a specific siRNA against PRNCR1-2. It was revealed that transfection with siRNA-PRNCR1-2 markedly reduced PRNCR1-2 expression in HS-587T and MDA-MB-231 cells, compared with in the negative control group (Fig. 2A and B). siRNA-PRNCR1-2-transfected HS-587T and MDA-MB-231 cells were used for subsequent functional assays.

Figure 2.

Depletion of PRNR1-2 expression in breast cancer cells. (A) Expression of PRNCR1-2 in HS-587T breast cancer cells transfected with siPRNCR1-2. (B) Expression of PRNCR1-2 in MDA-MB-231 breast cancer cells transfected with siPRNCR1-2. Reverse transcription-quantitative polymerase chain reaction was conducted for PRNCR1-2 expression in HS-587T and MDA-MB-231 cells. ***P<0.001; ****P<0.0001. NC, negative control; PRNCR1-2, prostate cancer-associated non-coding RNA 1; si, small interfering RNA.

PRNCR1-2 regulates breast cancer cell proliferation, migration and invasion

To explore the possible roles of PRNCR1-2 in breast cancer initiation and progression, the proliferation, migration, invasion, cell cycle progression and apoptosis of siRNA-PRNCR1-2-transfected HS-587T and MDA-MB-231 cells were analyzed. The results of the MTS assay revealed that the proliferation rates of siRNA-PRNCR1-2-transfected HS-587T cells were markedly downregulated compared with in the negative control group (Fig. 3A), thus indicating the ability of PRNCR1-2 to modulate breast cancer cell proliferation. Furthermore, the migration and invasion of PRNCR1-2-depleted HS-587T cells were analyzed using Transwell assays; the migration and invasion of HS-587T cells were markedly suppressed by transfection with siRNAs targeting PRNCR1-2 (Fig. 3B). Consistent with PRNCR1-2 depletion-induced alterations in proliferation, the cell cycle progression of siRNA-PRNCR1-2-transfected HS-587T cells was markedly altered, with more cells arrested in S phase, thus indicating the involvement of PRNCR1-2 in promoting S/G2 transition of breast cancer cells (Fig. 3C). The proportion of apoptotic cells in the siRNA-PRNCR1-2 group was also analyzed by flow cytometry; however, no marked alterations in cell apoptosis were observed in siRNA-PRNCR1-2-transfected HS-587T cells (Fig. 3D). The aforementioned experiments were repeated in MDA-MB-231 cells and similar results were obtained, as shown in Fig. 4. Taken together, these cellular assays suggested that PRNCR1-2 may be involved in breast cancer progression by promoting cell proliferation, migration and invasion, and by modulating cell cycle progression, but not via modulation of breast cell apoptosis.

Figure 3.

Cellular properties of HS-587T cells with PRNCR1-2 knockdown. (A) Proliferation of HS-587T cells with PRNCR1-2 knockdown. Cell proliferation was assessed by MTS assay. (B) Migration and invasion of HS-587T cells transfected with siPRNCR1-2. Transwell assays were used for analysis of cell migration and invasion. (C) Cell cycle progression of PRNCR1-2-depleted HS-587T cells. (D) Apoptotic cell ratios of PRNCR1-2-depleted HS-587T cells. Cell cycle progression and apoptosis were analyzed by flow cytometry. **P<0.01; ***P<0.001. NC, negative control; PRNCR1-2, prostate cancer-associated non-coding RNA 1–2; si, small interfering RNA.

Figure 4.

Cellular properties of MDA-MB-231 cells with PRNCR1-2 knockdown. (A) Proliferation of MDA-MB-231 cells with PRNCR1-2 knockdown. Cell proliferation was assessed by MTS assay. (B) Migration and invasion of MDA-MB-231 cells transfected with siPRNCR1-2. Transwell assays were used for analysis of cell migration and invasion. (C) Cell cycle progression of PRNCR1-2-depleted MDA-MB-231 cells. (D) Apoptotic cell ratios of PRNCR1-2-depleted MDA-MB-231 cells. Cell cycle progression and apoptosis were analyzed by flow cytometry. ***P<0.001. NC, negative control; PRNCR1-2, prostate cancer-associated non-coding RNA 1–2; si, small interfering RNA.

Signaling in HS-587T and MDA-MB-231 cells is modulated by PRNCR1-2 depletion

For more insights into PRNCR1-2-induced regulation of cell functions during breast cancer progression, key signaling pathway components associated with cell proliferation, migration, invasion, cell cycle progression and apoptosis were detected in HS-587T and MDA-MB-231 cells transfected with siRNA-PRNCR1-2 by western blotting. The results demonstrated that the protein expression levels of p-CHK2 were significantly elevated in siRNA-PRNCR1-2-transfected HS-587T and MDA-MB-231 cells (Fig. 5). Furthermore, depletion of PRNCR1-2 expression using specific siRNA resulted into significant inhibition of p-AKT in HS-587T and MDA-MB-231 cells; however, PRNCR1-2 depletion had no effect on the abundance of total CHK2 and AKT proteins (Fig. 5). The selectively altered expression of key signaling components suggested that regulation of breast cancer cell proliferation, migration, invasion and cell cycle progression by PRNCR1-2 may be at least partially mediated by modulating phosphorylation of CHK2 and AKT.

Figure 5.

Signaling pathways regulated by PRNCR1-2 in breast cancer cells. The abundance and phosphorylation of key components associated with cell proliferation, migration, invasion, apoptosis and cell cycle progression in HS-587T and MDA-MB-231 cells transfected with siPRNCR1-2 were determined by western blotting. GAPDH was used as an internal standard. *P<0.05; **P<0.01. AKT, protein kinase B; CHK2, checkpoint kinase 2; NC, negative control; p, phosphorylated; PRNCR1-2, prostate cancer-associated non-coding RNA 1–2; si, small interfering RNA.

Discussion

Non-coding components that account for large volumes of the human genome have long been predicted to have important roles in various physiological and pathological processes (19). Various types of ncRNAs, including microRNAs, siRNAs, Piwi-interacting RNAs, small nucleolar RNAs and lncRNAs critically contribute to cancer initiation and progression, much more than previously expected (8,10–12,20). Increasing evidence has suggested that lncRNAs may be involved in tumor pathogenesis, thus promoting trials of their application in breast cancer diagnosis and prognosis. The lncRNA H19 is characterized as a highly expressed biomarker in ER-positive MCF-7 breast cancer cells, which is involved in breast cell survival and estrogen-induced cell proliferation during breast cancer development (21). In addition, its diagnostic value as a novel biomarker for breast cancer has been reported, due to its detectable expression in the urine and serum of patients with breast cancer (22,23). Accumulating numbers of such ncRNAs as candidate targets for cancer diagnosis and treatment highlight the importance of further characterization of novel ncRNAs in breast cancer pathogenesis.

Aiming to provide a novel candidate for breast cancer diagnosis and treatment, the present study analyzed the expression levels of the lncRNA PRNCR1-2 in cancer tissues collected from patients with breast cancer. PRNCR1-2 expression was significantly increased in cancer tissues, thus suggesting its potential association with breast cancer development. Subsequently, a knockdown assay was conducted to deplete PRNCR1-2 expression in breast cancer cells. The marked alterations in breast cancer cell proliferation, migration, invasion and cell cycle progression following suppression of PRNCR1-2 expression indicated that PRNCR1-2 may be considered a novel non-coding regulator in breast cancer pathogenesis. Significantly altered AKT and CHK2 phosphorylation further validated the critical roles served by PRNCR1-2 in breast cancer cells. In accordance with previous findings regarding lncRNAs in breast cancer (8), the present results revealed the cellular functions of PRNCR1-2 in breast cancer cells, which may be applied as a biomarker for breast cancer diagnosis and therapy.

The molecular mechanisms by which PRNCR1-2 promotes breast cancer cell proliferation, migration and cell cycle progression deserve further investigations. Previous studies reported that interactions of lncRNAs with proteins or RNA partners may be important for the functioning of lncRNA molecules (10,24). A recent study also demonstrated that lncRNAs can bind with Janus kinase 2 (JAK2), thus promoting JAK2 activation and signal transducer and activation of transcription 3 phosphorylation, finally mediating breast cancer brain metastases (25). Therefore, it is reasonable to speculate that PRNCR1-2 may also carry out its role in breast cancer cell proliferation and migration via its association with key protein components of these cellular processes. The large-scale identification of proteins or RNA partners interacting with PRNCR1-2 during breast cancer development may provide novel perspectives on pathogenic roles of non-coding molecules in breast cancer, as well as other types of human cancer. It is also possible that PRNCR1-2 may be directly involved in the post-translational modifications of key signaling proteins. Metastasis associated in lung adenocarcinoma transcript 1 (MALAT1) interacts with both serine and arginine-rich splicing factor 1 (SRSF1) and SRSF protein kinase 1. In colorectal cancer cells, the lncRNA MALAT1 regulates cancer cell proliferation and migration by promoting phosphorylation of SRSF1 (26). In the present study, it was revealed that depletion of PRNCR1-2 markedly altered the phosphorylation of AKT and CHK2, whereas total AKT and CHK2 protein levels were not affected. CHK2 acts as an important regulator of cell cycle progression and proliferation (27,28), and CHK2 signaling is activated by phosphorylation of itself and downstream substrates (29). AKT is another key regulator of tumor cell proliferation, cell cycle progression, migration and invasion (30–32), which is also activated by its phosphorylation (33). These observations suggested that PRNCR1-2 may modulate the phosphorylation of CHK2 and AKT by interacting with a specific kinase or phosphatase. The role of PRNCR1-2 in CHK2 and AKT phosphorylation and regulation requires further investigation.

In conclusion, this study reported that the lncRNA PRNCR1-2 is highly expressed in breast cancer tissues, and depletion of PRNCR1-2 in breast cancer cells results in the suppression of cell proliferation, migration, invasion and cell cycle progression. These findings indicated that PRNCR1-2 may be explored as a breast cancer biomarker for the development of novel diagnostic or therapeutic methods for patients with breast cancer.

Acknowledgements

The present study was supported by Guangzhou Forevergen Company. The authors would also like to thank Dr Kewei Li of Foshan First People's Hospital for the specimen collection.

Funding

The present study was supported by grants from the Specialized Research Fund for the Technology Innovation of Foshan City (grant no. 2014AG10003) and the Research Fund for the Guangdong Province Health Bureau (grant no. A2017464).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

DP and QH conceived and designed the study, and drafted and critically revised the manuscript. XL and YXL performed the experiments and analyzed the data. HD, SC, YDL, LL, FPe and FPa participated in study design, study implementation and manuscript revision. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experimental procedures were approved by the Ethics Committee of Foshan First People's Hospital, and written informed consent was obtained from each participant prior to surgery.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA Cancer J Clin. 68:7–30. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Desantis C, Ma J, Bryan L and Jemal A: Breast cancer statistics, 2013. CA Cancer J Clin. 64:52–62. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Bombonati A and Sgroi DC: The molecular pathology of breast cancer progression. J Pathol. 223:307–317. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Lopez-Garcia MA, Geyer FC, Lacroix-Triki M, Marchió C and Reis-Filho JS: Breast cancer precursors revisited: Molecular features and progression pathways. Histopathology. 57:171–192. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Byler S, Goldgar S, Heerboth S, Leary M, Housman G, Moulton K and Sarkar S: Genetic and epigenetic aspects of breast cancer progression and therapy. Anticancer Res. 34:1071–1077. 2014.PubMed/NCBI

6 

Welch DR and Wei LL: Genetic and epigenetic regulation of human breast cancer progression and metastasis. Endocrine-Related Cancer. 5:155–197. 1998. View Article : Google Scholar

7 

Mercer TR and Mattick JS: Structure and function of long noncoding RNAs in epigenetic regulation. Nat Struct Mol Biol. 20:300–307. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Lo PK, Wolfson B, Zhou X, Duru N, Gernapudi R and Zhou Q: Noncoding RNAs in breast cancer. Brief Funct Genomics. 15:200–221. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Cao J: The functional role of long non-coding RNAs and epigenetics. Biol Proced Online. 16:112014. View Article : Google Scholar : PubMed/NCBI

10 

Lin C and Yang L: Long noncoding RNA in cancer: Wiring signaling circuitry. Trends Cell Biol. 28:287–301. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Slaby O, Laga R and Sedlacek O: Therapeutic targeting of non-coding RNAs in cancer. Biochem J. 474:4219–4251. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Huarte M: The emerging role of lncRNAs in cancer. Nature Medicine. 21:1253–1261. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Sørensen KP, Thomassen M, Tan Q, Bak M, Cold S, Burton M, Larsen MJ and Kruse TA: Long non-coding RNA HOTAIR is an independent prognostic marker of metastasis in estrogen receptor-positive primary breast cancer. Breast Cancer Res Treat. 142:529–536. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Huang J, Zhou N, Watabe K, Lu Z, Wu F, Xu M and Mo YY: Long non-coding RNA UCA1 promotes breast tumor growth by suppression of p27 (Kip1). Cell Death Dis. 5:e10082014. View Article : Google Scholar : PubMed/NCBI

15 

Prensner JR, Sahu A, Iyer MK, Malik R, Chandler B, Asangani IA, Poliakov A, Vergara IA, Alshalalfa M, Jenkins RB, et al: The lncRNAs PCGEM1 and PRNCR1 are not implicated in castration resistant prostate cancer. Oncotarget. 5:1434–1438. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Yang L, Qiu M, Xu Y, Wang J, Zheng Y, Li M, Xu L and Yin R: Upregulation of long non-coding RNA PRNCR1 in colorectal cancer promotes cell proliferation and cell cycle progression. Oncol Rep. 35:318–324. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Sattarifard H, Hashemi M, Hassanzarei S, Narouie B and Bahari G: Association between genetic polymorphisms of long non-coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population. Mol Clin Oncol. 7:1152–1158. 2017.PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Esteller M: Non-coding RNAs in human disease. Nature Reviews Genetics. 12:861–874. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Jing H, Markowitz GJ and Wang X: Noncoding RNAs regulating cancer signaling network. Adv Exp Med Biol. 927:297–315. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Sun H, Wang G, Peng Y, Zeng Y, Zhu QN, Li TL, Cai JQ, Zhou HH and Zhu YS: H19 lncRNA mediates 17β-estradiol-induced cell proliferation in MCF-7 breast cancer cells. Oncol Rep. 33:3045–3052. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Zhang K, Luo Z, Zhang Y, Zhang L, Wu L, Liu L, Yang J, Song X and Liu J: Circulating lncRNA H19 in plasma as a novel biomarker for breast cancer. Cancer Biomark. 17:187–194. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Zhang K, Zhang Y, Luo Z, Lichun WU, Zhang L and Liu J: Diagnostic value of urinary lncRNA H19 for breast cancer. Shandong Med J. 56:42–44. 2016.

24 

Lin A, Hu Q, Li C, Xing Z, Ma G, Wang C, Li J, Ye Y, Yao J, Liang K, et al: The LINK-AlncRNA interacts with PtdIns(3,4,5)P3 to hyperactivate AKT and confer resistance to AKT inhibitors. Nature Cell Biol. 19:238–251. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Wang S, Liang K, Hu Q, Li P, Song J, Yang Y, Yao J, Mangala LS, Li C, Yang W, et al: JAK2-binding long noncoding RNA promotes breast cancer brain metastasis. J Clin Invest. 127:4498–4515. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Hu ZY, Wang XY, Guo WB, Xie LY, Huang YQ, Liu YP, Xiao LW, Li SN, Zhu HF, Li ZG and Kan H: Long non-coding RNA MALAT1 increases AKAP-9 expression by promoting SRPK1-catalyzed SRSF1 phosphorylation in colorectal cancer cells. Oncotarget. 7:11733–11743. 2016.PubMed/NCBI

27 

Ingvarsson S, Sigbjornsdottir BI, Chen H, Hafsteinsdottir SH, Ragnarsson G, Barkardottir RB, Arason A, Egilsson V and Bergthorsson JT: Mutation analysis of the CHK2 gene in breast carcinoma and other cancers. Breast Cancer Res. 4:1–6. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Sullivan A, Yuille M, Repellin C, Reddy A, Reelfs O, Bell A, Dunne B, Gusterson BA, Osin P, Farrell PJ, et al: Concomitant inactivation of p53 and Chk2 in breast cancer. Oncogene. 21:1316–1324. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Xu X, Tsvetkov LM and Stern DF: Chk2 activation and phosphorylation-dependent oligomerization. Mol Cell Biol. 22:4419–4432. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Hartmann W, Digonsöntgerath B, Koch A, Waha A, Endl E, Dani I, Denkhaus D, Goodyer CG, Sörensen N, Wiestler OD and Pietsch T: Phosphatidylinositol 3′-kinase/AKT signaling is activated in medulloblastoma cell proliferation and is associated with reduced expression of PTEN. Clin Cancer Res. 12:3019–3027. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Kim D, Kim S, Koh H, Yoon SO, Chung AS, Cho KS and Chung J: Akt/PKB promotes cancer cell invasion via increased motility and metalloproteinase production. FASEB J. 15:1953–1962. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Chang F, Lee JT, Navolanic PM, Steelman LS, Shelton JG, Blalock WL, Franklin RA and McCubrey JA: Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: A target for cancer chemotherapy. Leukemia. 17:590–603. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Jacinto E, Facchinetti V, Liu D, Soto N, Wei S, Jung SY, Huang Q, Qin J and Su B: SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell. 127:125–137. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pang D, Hu Q, Lan X, Lin Y, Duan H, Cao S, Lin Y, Li L, Peng F, Pan F, Pan F, et al: The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression. Mol Med Rep 19: 1824-1832, 2019.
APA
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S. ... Pan, F. (2019). The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression. Molecular Medicine Reports, 19, 1824-1832. https://doi.org/10.3892/mmr.2018.9789
MLA
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S., Lin, Y., Li, L., Peng, F., Pan, F."The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression". Molecular Medicine Reports 19.3 (2019): 1824-1832.
Chicago
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S., Lin, Y., Li, L., Peng, F., Pan, F."The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression". Molecular Medicine Reports 19, no. 3 (2019): 1824-1832. https://doi.org/10.3892/mmr.2018.9789
Copy and paste a formatted citation
x
Spandidos Publications style
Pang D, Hu Q, Lan X, Lin Y, Duan H, Cao S, Lin Y, Li L, Peng F, Pan F, Pan F, et al: The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression. Mol Med Rep 19: 1824-1832, 2019.
APA
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S. ... Pan, F. (2019). The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression. Molecular Medicine Reports, 19, 1824-1832. https://doi.org/10.3892/mmr.2018.9789
MLA
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S., Lin, Y., Li, L., Peng, F., Pan, F."The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression". Molecular Medicine Reports 19.3 (2019): 1824-1832.
Chicago
Pang, D., Hu, Q., Lan, X., Lin, Y., Duan, H., Cao, S., Lin, Y., Li, L., Peng, F., Pan, F."The novel long non‑coding RNA PRNCR1‑2 is involved in breast cancer cell proliferation, migration, invasion and cell cycle progression". Molecular Medicine Reports 19, no. 3 (2019): 1824-1832. https://doi.org/10.3892/mmr.2018.9789
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team