Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2019 Volume 19 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2019 Volume 19 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages

  • Authors:
    • Lu Song
    • Jingyi Tan
    • Zhongxiu Wang
    • Peihui Ding
    • Qi Tang
    • Mengjiao Xia
    • Yingming Wei
    • Lili Chen
  • View Affiliations / Copyright

    Affiliations: Department of Periodontology, The Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang 310009, P.R. China
    Copyright: © Song et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4743-4752
    |
    Published online on: April 11, 2019
       https://doi.org/10.3892/mmr.2019.10155
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Interleukin 17A (IL‑17A) exerts pleiotropic effects on periodontitis, partially through enhancement of alveolar bone loss. Osteoclasts are the main culprits that absorb alveolar bone. However, studies describing the correlation between IL‑17A and osteoclasts are not conclusive. Previously, autophagy was revealed to be involved in osteoclast differentiation and bone resorption. However, the role of autophagy in IL‑17A‑mediated osteoclast formation is yet to be clarified. In the present study, bone marrow macrophages (BMMs) were treated with or without IL‑17A. 3‑Methyladenine (3‑MA) was applied to inhibit autophagy. Osteoclast formation was detected by tartrate‑resistant acid phosphatase (TRAP) staining, immunofluorescence, and scanning electron microscope. The effects of IL‑17A on osteoclast‑specific genes and autophagy‑related genes during osteoclast differentiation were examined by real‑time quantitative polymerase chain reaction and western blot analysis. Autophagosomes were observed by transmission electron microscope. Hematoxylin and eosin (H&E), and TRAP staining was adopted to assess alveolar bone destruction and the number of osteoclasts, respectively in a rat periodontitis model. Consequently, IL‑17A stimulated osteoclast differentiation and bone resorption of BMMs accompanied by an increase in the mRNA expression of osteoclast‑specific genes. Furthermore, IL‑17A increased the levels of autophagy‑related genes and proteins, and inhibition of autophagy with 3‑MA attenuated the IL‑17A‑mediated osteoclastogenesis. In addition, there was an increase in the number of osteoclasts and alveolar bone resorption with IL‑17A treatment in the periodontitis rat model. Collectively, these findings indicated that IL‑17A facilitated osteoclast differentiation and bone resorption in vitro and in vivo, which may contribute to the understanding of the molecular basis of IL‑17A in alveolar bone destruction and provide insight on the clinical therapeutic targets for periodontitis.

Introduction

Periodontitis is a chronic inflammatory disease with periodontal ligament inflammation and alveolar bone destruction (1). It is initiated by bacterial plaque, which induces inflammatory immune responses to perturb the bone homeostasis between bone construction and bone resorption (2). Although several studies have explored the complex regulatory mechanisms underlying alveolar bone loss, in the pathogenies of periodontitis, these are unclear (3).

Interleukin-17A (IL-17A) is a pro-inflammatory cytokine typically secreted by Th17 cells and contributes to the pathophysiology of periodontitis, notably aggravating gingival inflammation and alveolar bone loss (4). Emerging clinical studies have revealed that human periodontitis is related to the increased expression of IL-17 in peripheral blood, gingival crevicular fluid, gingival tissues, and alveolar bone when compared to a healthy periodontal group (5–7). Additionally, the increased number of IL-17-positive cells and osteoclasts were accumulated in the alveolar bone of periodontitis patients, indicating a causal relevance of IL-17 and osteoclasts in periodontitis (8). However, the underlying mechanism of IL-17A-mediated inflammatory periodontal bone destruction is yet to be elucidated.

Furthermore, osteoclasts are specialized multinucleated cells derived from macrophage precursors and activated to absorb the alveolar bone, ultimately resulting in bone loss in periodontitis (9). Notably, IL-17A was revealed to possess valid osteoclastogenic properties that stimulate the expression of the receptor activator of nuclear factor-κB ligand (RANKL), interleukin 1β (IL-1β), tumor necrosis factor-α (TNF-α), and prostaglandin E2. Of note, the targets of IL-17A contain osteoblasts, fibroblasts, and other stromal cells, indicating that IL-17A mediates osteoclast activity by promoting osteoclastogenesis factors on other cells (10–12). However, the study of osteoclast differentiation under the direct effect of IL-17A on osteoclast precursors is poorly understood.

Autophagy is an intracellular metabolic pathway, which orchestrates diverse aspects of cellular stress response, and the core molecular machinery of autophagy consists of autophagy-related proteins (13,14). Recently, autophagy has been demonstrated to be involved in osteoclast differentiation and bone resorption (15,16). Autophagy-related proteins, including Atg5, Atg7, Atg4B, and microtubule-associated protein 1 light chain 3 (LC3) are significantly responsible for the formation of ruffled border and facilitation of osteoclast polarization, ultimately resulting in bone resorption (17). Moreover, emerging evidence has indicated that several pro-inflammatory cytokines, including IL-1β and TNF-α, trigger autophagy in murine osteoclasts (18,19). However, whether autophagy is involved in IL-17A-mediated osteoclastogenesis requires further exploration.

In the present study, the effects of IL-17A on osteoclast differentiation and bone resorption of BMMs were investigated, and whether autophagy was involved in this process was analyzed. Moreover, the effect of IL-17A on osteoclast activity was detected on the alveolar bone surfaces in a rat periodontitis model.

Materials and methods

Materials

Soluble recombinant mouse IL-17A was obtained from PeproTech, Inc. (Rocky Hill, NJ, USA). Macrophage colony-stimulating factor (M-CSF) and RANKL were obtained from R&D Systems, Inc. (Minneapolis, MN, USA). All cell culture media and supplements were procured from Gibco; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Reagents for real-time quantitative polymerase chain reaction (PCR) were obtained from Takara Bio, Inc. (Otsu, Japan). RNA was extracted using TRIzol reagent from Thermo Fisher Scientific, Inc., according to the manufacturer's protocol. Antibodies against LC3B (cat. no. 192890; 1:2,000) and β-actin (cat. no. 8226; 1:1,000) were purchased from Abcam (Cambridge Science Park, Cambridge, UK). An antibody against IL-17A (cat. no. GB11110; 1:100) was purchased from Servicebio (Wuhan, Hubei, China). Goat anti-rabbit immunoglobulin G secondary antibody (cat. no. BA1054; 1:5,000) was obtained from Boster Biological Technology, Ltd. (Wuhan, Hubei, China). A bicinchoninic acid (BCA) kit and enhanced chemiluminescence (ECL) detection reagent was purchased from Thermo Fisher Scientific, Inc. TRAP staining was conducted using a Leukocyte Acid Phosphatase kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Cell viability was assessed using Cell Counting Kit-8 (CCK-8) (Sigma-Aldrich; Merck KGaA).

Animals

All animal experiments were performed in accordance with the principles and procedures of the National Institutes of Health (NIH) for the Care and Use of Laboratory Animals. The approval number granted by the Animal Ethics Committee of The Second Affiliated Hospital of Zhejiang University School of Medicine is 2017–052 (2017-2-10). All surgeries were performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. A total of 10 female 7-week-old C57BL/6 mice (22±2 g), and 30 male 7-weeks of age Sprague-Dawley rats (200±50 g), were purchased from the China Experimental Animal Center (Hangzhou, China). Throughout the experiment, the animals were housed in individual cages under an appropriate temperature (21±2°C), with 12-h light/dark cycles and humidity (50±5%) and fed standard laboratory food and tap water ad libitum.

Cell culture

BMMs were obtained as previously described (20). Briefly, C57BL/6 female mice were euthanized by cervical dislocation after being anesthetized with sodium pentobarbital (150 mg/kg body weight, intraperitoneally). The femora and tibiae were dissected from mice, and the ends were cut off with scissors. Then, a 1-µl syringe was used to flush the marrow cavity with α-MEM medium supplemented with 10% fetal bovine serum, 100 U/µl penicillin, 100 U/µl streptomycin, and 30 ng/µl M-CSF. The mixture was homogenized and incubated in a Petri dish at 37°C and 5% CO2 for 3 days. The adherent cells were collected as BMMs.

Osteoclast formation

BMMs were seeded into 96-well plates at a density of 1×104 cells/well in the presence of M-CSF (30 ng/µl), RANKL (50 ng/µl), and different concentrations of recombinant IL-17A (0, 0.1, 1 or 10 ng/µl). The media were changed every alternate day until multinucleated cells appeared under a Leica light microscope (Leica, Solms, Germany).

TRAP staining

When the multinucleated osteoclasts were formed, the medium was aspirated, the cells were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde at room temperature for 20 min, and stained for TRAP using a leukocyte acid phosphatase kit. After the staining, multinucleated osteoclasts which contained 3 or more nuclei, could be identified by counting the number of nuclei in an osteoclast using a Leica light microscope (Leica).

Bone resorption assay in vitro

BMMs were seeded on bone slices at a density of 1×104 cells/slice in 96-well culture plates in 3 replicates in the presence of 30 ng/µl M-CSF. After 24 h, the cells were treated with 30 ng/µl M-CSF, 50 ng/µl RANKL, and different concentrations of IL-17A (0, 0.1, 1 and 10 ng/µl). The medium was replaced every alternate day until the formation of mature osteoclasts. Then, the bone slices were removed, washed with PBS, and dried. The bone resorption pits were observed using a scanning electron microscope (TM-100; Hitachi, Ltd., Tokyo, Japan).

Detection of F-actin ring formation

After mature osteoclasts formed, the cells were fixed with 4% paraformaldehyde at room temperature for 20 min, permeabilized with 0.1% Triton X-100 at room temperature for 10 min, blocked with 1% BSA for 30 min, and incubated with TRITC-labeled phalloidin (Invitrogen; Thermo Fisher Scientific, Inc.,) for 2 h. DAPI was used for staining the cell nuclei. Subsequently, the F-actin ring formation was observed using a Leica fluorescence microscope (Leica).

Transmission electron microscopy

Cells were fixed with 2.5% glutaraldehyde for 30 min, and post-fixed in 1% buffered osmium tetroxide for 1 h at 20°C. Then, the samples were dehydrated by an increasing ethanol gradient and embedded in epoxy resin. Ultrathin sections (60–80 nm) were sliced using an ultramicrotome (Leica EM UC7; Leica), and observed under a transmission electron microscope (Tecnai G2 20 TWIN; FEI; Thermo Fisher Scientific, Inc.).

Cell viability assay

BMMs were plated in 96-well plates (1×103 cells/well) for 24 h. Then, the cells treated with IL-17 were incubated with or without 3-MA (2 nM) for 48 h. Cell viability was assessed using a CCK-8 assay. Briefly, 10 µl of CCK-8 solution was added to each well at the indicated time-points, and then the plate was incubated for 2 h in a 5% CO2 incubator. Absorbance was assessed at 450 nm with a spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

RNA extraction and real-time quantitative polymerase chain reaction

Total RNA of the cells was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed to synthesize single-stranded cDNA using PrimeScript Reverse Transcription Master Mix Kit (Takara Bio, Inc.). The expression of the target genes was quantified using a SYBR polymerase chain reaction Master Mix Kit (Takara Bio, Inc.) on a StepOne Plus real-time polymerase chain reaction system (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The relative expression level of the target genes was calculated using the relative quantitative method 2−ΔΔCq (21), and normalized to the mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. The primer sequences are listed in Table I.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Gene symbolPrimer sequence (5′-3′)
LC3F: CGGAGCTTTGAACAAAGAGTG
R: TCTCTCACTCTCGTACACTTC
Beclin-1F: AGCTCAGTACCAGCGGGAGT
R: TGGAAGGTGGCATTGAAGAC
Atg5F: TGTGCTTCGAGATGTGTGGTT
R: GTCAAATAGCTGACTCTTGGCAA
c-FosF: CGGGTTTCAACGCCGACTA
R: TTGGCACTAGAGACGGACAGA
NFATc1F: GGAGAGTCCGAGAATCGAGAT
R: TTGCAGCTAGGAAGTACGTCT
CatKF: CTCGGCGTTTAATTTGGGAGA
R: TCGAGAGGGAGGTATTCTGAGT
TRAPF: CACTCCCACCCTGAGATTTGT
R: CCCCAGAGACATGATGAAGTCA
GAPDHF: GACTTCAACAGCAACTCCCAC
R: TCCACCACCCTGTTGCTGTA

[i] F, forward; R, reverse; LC3, microtubule-associated protein 1 light chain3; NFATc1, nuclear factor of activated T cells 1; CatK, cathepsin K; TRAP, tartrate-resistant acid phosphatase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

The total protein of the cells was extracted using cell lysate buffer and quantified using a bicinchoninic acid kit (Thermo Fisher Scientific, Inc.). An equivalent of 25 µg of the total protein was resolved on a ١٢٪ gel using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Bio-Rad Laboratories, Inc.). Subsequently, the membrane was blocked with 5% skim milk at room temperature for 2 h and probed with the primary antibodies anti- LC3B (cat. no. 192890; 1:2,000) and anti-β-actin (cat. no. 8226; 1:1,000) purchased from Abcam. Incubation with the membranes was performed overnight at 4°C. Then, the membrane was washed and incubated with a horseradish peroxidase-conjugated secondary antibody (1:5,000; cat. no. BA1054; Boster Biological Technology, Ltd.) at room temperature for 1.5 h. The immunoreactive bands were visualized using an ECL kit, and the data were analyzed using ImageJ software, version 1.48 [National Institutes of Health (NIH), Bethesda, MD, USA].

Experimental periodontitis induction

Sprague-Dawley rats were randomly divided into 3 experimental groups: NC (normal control), NS (normal saline) and the IL-17 group. To induce a rat periodontitis model, as previously described (22,23), the rats were anesthetized with sodium pentobarbital (40 mg/kg body weight) via intraperitoneal injection; 3.0 cotton threads were placed bilaterally around the intraorbital portion of the rat maxillary first molar to induce experimental periodontitis in NS and IL-17 groups, while the NC group was subjected to sham treatment. In addition, 20 µl normal saline and 20 µl recombinant IL-17A (5 µg/µl) were injected into the bilateral maxillary first molars of the rats every other day in the NS and IL-17 groups under anesthesia with sodium pentobarbital (40 mg/kg body weight) via intraperitoneal injection, respectively. During the experiments, rats had no weight loss, no loss of appetite, no serious infection, and no weakness or sudden death.

Histomorphometric analysis and immunohistochemical staining

All the rats were euthanized after being anesthetized with sodium pentobarbital (150 mg/kg, intraperitoneally) at 1-month after injury induction and death was ascertained mainly based on complete cessation of a heartbeat. The maxilla was dissected carefully, immediately fixed in 4% paraformaldehyde for 1 day, and decalcified in 10% ethylenediaminetetraacetic acid buffer at room temperature for 6 weeks. The samples were embedded in paraffin, and 4-µm thick sections were obtained in the proximal mandible for hematoxylin and eosin (H&E) staining. The distance between the cementum-enamel junction (CEJ) and the alveolar callus (ABC) in the interproximal region of the maxillary first molar was observed using a Leica optical microscope (Leica). TRAP staining was performed using a leukocyte acid phosphatase kit to quantify the osteoclasts as described by the manufacturer. Multinucleated TRAP+ cells on the alveolar bone surface around the first molar were enumerated as active osteoclasts. Immunohistochemical staining was performed to detect the level of IL-17A and LC3, using the respective antibodies (1:100 dilution) according to the manufacturer's protocol. Finally, the sections were observed under a Leica light microscope and positive cells were counted using ImageJ software (NIH).

Statistical analysis

All quantitative data are presented as the mean ± standard deviation. Each experiment was performed in triplicate. Statistical analyses were performed using one-way analysis of variance (ANOVA), followed by Tukey's post hoc test with GraphPrism 7 software (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

IL-17A facilitates osteoclast differentiation and bone resorption of mouse bone marrow macrophages

To detect the effects of IL-17A on osteoclast differentiation and bone resorption, BMMs were cultured in medium with or without IL-17A. The hallmark of osteoclast differentiation is the formation of TRAP+ multinucleated cells (24). The present results revealed that the number of TRAP+ multinucleated cells was significantly increased with increasing concentration of IL-17A (Fig. 1A and D). In addition, the formation of filamentous actin (F-actin) rings is a characteristic of terminally differentiated osteoclasts, and bone resorption pits can be quantified for determining the bone loss (24). Immunofluorescence staining revealed that the circumference of the actin ring was larger as compared to the control groups, which indicated that increasing the areas of contact with the bone surface enhanced the function of bone resorption after the addition of IL-17A (Fig. 1C). In addition, the areas of the bone absorption pits were markedly promoted by IL-17A treatment (Fig. 1B and E). These results indicated increased osteoclastogenesis of BMMs in vitro after addition of IL-17A.

Figure 1.

IL-17A exerts positive effects on osteoclast formation in bone marrow macrophages in vitro. (A) The representative TRAP+ multinucleated cells/well are presented (magnification, ×10), scale bar, 200 µm. (B) The resorption pits of the bone slices were visualized with a scanning electron microscope (magnification, ×200) scale bar, 50 µm. (C) Immunofluorescence staining was performed with phalloidin (red) and DAPI (blue). Images were obtained and analyzed using a Leica fluorescence microscope (magnification, ×40) scale bar, 20 µm. (D) Quantitative analysis was implemented to assess the TRAP+ multinucleated cells/well. (E) Quantitative analysis was performed on resorption pit areas. *P<0.05, **P<0.01, ***P<0.001 compared to the control group (mean ± standard deviation). IL-17A, interleukin IL-17A; TRAP, tartrate-resistant acid phosphatase; F-actin, filamentous actin; con, control group.

Effect of IL-17A on the expression of osteoclast-related genes in vitro

To further investigate the effects of IL-17A on osteoclast differentiation, the expression of osteoclast-related genes was examined by real-time quantitative PCR. c-Fos and NFATc1 are the osteoclastogenic transcription factors required for early osteoclast differentiation, while TRAP and CatK are designated as terminal osteoclast differentiation markers (24–26). Furthermore, slightly increased expression of c-Fos and NFATc1 was observed post-IL-17A treatment (Fig. 2A and B). Moreover, IL-17A significantly increased the expression TRAP and CatK as compared to the control group (Fig. 2C and D).

Figure 2.

Effects of IL-17A on the expression of osteoclast-related genes involved in osteoclastogenesis. The mRNA expression of (A) c-Fos and (B) NFATc1 was detected on day 1 with different concentrations of IL-17A. The mRNA expression of (C) CatK and (D) TRAP was detected after 3 days of different concentrations of IL-17A. Data were normalized to GAPDH expression and presented as a fold-change relative to the control group (mean ± standard deviation). **P<0.01, ***P<0.001 compared to the control group. IL-17A, interleukin IL-17A; NFAcT1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; CatK, cathepsin K; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; con, control group.

IL-17A facilitates autophagy activity during osteoclast differentiation

The specific mechanism underlying IL-17A-facilitated osteoclast differentiation was hypothesized to be the autophagic pathway. Thus, real-time quantitative PCR was employed and it was revealed that the expression of the autophagy-related genes, LC3, Beclin1 and Atg5 was increased (Fig. 3A). Next, the expression of LC3-II protein, which is the autophagy marker in autophagosome membranes was investigated (14). Western blot analysis revealed that the expression of LC3-II was upregulated after the addition of IL-17A (Fig. 3B and C), indicating enhanced autophagosome formation. Notably, an increased number of autophagosomes with typical bilayer membrane morphology was observed by transmission electron microscopy (Fig. 3D and E). The aforementioned findings indicated that autophagy activity was enhanced in IL-17A-mediated osteoclast differentiation.

Figure 3.

IL-17A stimulates osteoclast formation by inducing autophagy. (A) The mRNA expression of autophagy-related genes was determined using real-time quantitative polymerase chain reaction with IL-17A treatment after 48 h (mean ± standard deviation). (B) The expression of LC3 protein during IL-17A-mediated osteoclastogenesis was detected using western blot analysis. (C) Densitometric analysis of LC3-II expression. (D) Assessment of autophagy activity by transmission electron microscopy. Typical observations depict autophagosomes. (E) The quantitation of the number of autophagosomes (mean ± standard deviation). *P<0.05, **P<0.01, ***P<0.001 compared to the control group. IL-17A, interleukin IL-17A; LC3, microtubule-associated protein 1 light chain 3; con, control group.

Inhibition of autophagy attenuates IL-17A-mediated osteoclastogenesis

To elucidate whether autophagy in IL-17A-treated BMMs exerted a positive effect, autophagy inhibitor 3-MA, a prominent inhibitor reducing autophagy flux in the early stages, was added. Consequently, no detrimental effect was noted on the viability of osteoclasts after the treatment with 3-MA (Fig. 4A). The data revealed that the expression of LC3-II was significantly downregulated with the treatment of 3-MA (Fig. 4B and E). Consecutively, the number of TRAP+ multinuclear cells (Fig. 4C and F), the area of pits on bone slices (Fig. 4D and G), and the mRNA level of osteoclast-related genes, CatK and TRAP (Fig. 4H and I), were decreased after the addition of 3-MA in IL-17A-treated BMMs. These results demonstrated that the autophagy inhibitor could weaken the effect on IL-17A-mediated osteoclast activity.

Figure 4.

Inhibition of autophagy abrogates IL-17A-mediated osteoclastogenesis. (A) Cell viability was measured by CCK-8 assay. BMMs were incubated with or without IL-17A (10 ng/µl) for 48 h, and 3-MA (10 nM) was added into IL-17A medium. (B) Western blot analysis was used to analyze the expression of LC3. (C) Fixed cells were stained for TRAP, and representative TRAP+ multinucleated cells/well are displayed. Magnification, ×10; Scale bar, 200 µm. (D) The resorption pits of the bone slices were visualized using a scanning electron microscope after 10 days of culture. Magnification, ×200; scale bar, 50 µm. (E) Densitometric analysis of LC3-II expression. The cells were pretreated with 3-MA (2 nM) for 2 h, and then, with RANKL (50 ng/µl) plus IL-17A (10 ng/µl) for 5 days. (F) Quantitative analysis was implemented to assess the TRAP+ multinucleated cells/well. (G) Quantitative analysis was performed on resorption pit areas. The osteoclast-related genes (H) CatK and (I) TRAP were analyzed by real-time quantitative polymerase chain reaction. Data were normalized to the GAPDH expression and presented as the fold-change relative to the control group (mean ± standard deviation). *P<0.05, **P<0.01, ***P<0.001 compared to the control group. ##P<0.01, ###P<0.001, compared to the IL-17A-treated group. IL-17A, interleukin IL-17A; 3-MA, 3-methyladenine; LC3, microtubule-associated protein 1 light chain 3; CatK, cathepsin K; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor-κB ligand; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; con, control group.

Effect of IL-17A on osteoclast activity in vivo

A rat model of experimental periodontitis was established to detect the effect of IL-17A on osteoclasts. Immunohistochemistry demonstrated that a marked level of IL-17A in the periodontal tissue was detected after IL-17A injection when compared to normal saline injection (Fig. 5A and B). H&E staining revealed that the attachments of the collagenous fibers were destroyed, and a large number of inflammatory cells were revealed in both the connective tissue and the epithelium layer in the NS and IL-17 groups when compared to the NC group. Additionally, a prominently enhanced average distance was noted between the CEJ and ABC in the IL-17 groups when compared to the NS group (Fig. 5C and D). In addition, TRAP staining exposed higher numbers of TRAP+ multinuclear cells in the IL-17 groups (Fig. 5E and F). Moreover, an increase in LC3 staining was observed on the inflammatory alveolar bone surfaces after IL-17 treatment (Fig. 5G and H). Collectively, these results revealed that IL-17A could increase osteoclastogenesis to exacerbate alveolar bone resorption in the periodontitis rat model.

Figure 5.

Effects of IL-17A on osteoclast activity in vivo. (A) Immunohistochemical staining was used to determine the level of IL-17A expression (arrows). Scale bar, 50 µm. (B) IL-17A expression was analyzed quantitatively. (C) The distance between CEJ and ABC (red line) was observed by H&E staining. Scale bar, 200 µm. (D) Quantitative analysis was performed on the distance. (E) TRAP staining was used to detect the osteoclasts (red arrows). Scale bar, 50 µm. (F) Quantitative analysis was performed on the number of TRAP+ cells. (G) Immunohistochemical staining was used to examine the level of LC3 expression (arrows). Scale bar, 50 µm. (H) Quantitative analysis was performed on LC3 level. *P<0.05, **P<0.01, ***P<0.001 compared to the NC group. #P<0.05, ##P<0.01, ###P<0.001 compared to the NS group. IL-17A, interleukin IL-17A; H&E staining, hematoxylin and eosin staining; CEJ, cementum-enamel junction; ABC, the alveolar callus; TRAP, tartrate-resistant acid phosphatase; LC3, microtubule-associated protein 1 light chain 3; NC, normal control group; NS, normal saline group; IL-17A, IL-17A group.

Discussion

In periodontitis, microbes and toxic products in bacterial plaques induce local inflammatory reactions in the periodontal tissues due to a large-scale production of inflammatory mediators, which can promote osteoclast activity and aggravate alveolar bone resorption (27). Accumulating evidence has revealed an interdisciplinary approach combing the study of bone and immune system, regarded as osteoimmunology, for the treatment of the disease (28).

Osteoclasts are exclusive bone resorbing cells that could secrete lysosomal enzymes into the extracellular space to degrade bone matrix (24). The effects of IL-17A, a pro-inflammatory cytokine, were examined on osteoclast differentiation and bone resorption in vitro. It was found that the number of TRAP+ multinucleated cells, and the formation of actin rings accompanied by the pit area of bone resorption were increased in response to increased concentrations of IL-17A, thereby indicating that IL-17A could facilitate osteoclast differentiation and bone resorption. A similar result was deduced that IL-17 exhibited a positive effect on osteoclast differentiation of human-derived bone marrow cells (29). Further study revealed that IL-17 upregulated the expression of RANK on human osteoclast precursors to enhance the sensitivity to RANKL signaling, culminating in bone resorption (30). Notably, the differentiation of osteoclasts from macrophage precursors is dependent on the presence of RANKL, and RANKL-RANK interaction is essential for the activation of various signaling cascades of osteoclastogenesis (26,31). Considering these findings, it was speculated that in the present study, the strong enhancement of osteoclast activity promoted by IL-17A of BMMs is attributed to the synergistic effect with RANKL.

However, Kitami et al (32) observed suppression of osteoclast differentiation of RAW264.7 as a result of the treatment of IL-17. IL-17 markedly suppressed the osteoclastogenesis of canine bone marrow-derived macrophages at a maximal concentration (33). Collectively, these studies contradicted the present experimental results, which may be attributed to various factors, including different experimental conditions and species. Therefore, theories on the activity of IL-17A in osteoclast differentiation are yet controversial, and thus, exploring the specific underlying mechanisms is imperative.

Osteoclast-specific genes contribute to various stages of osteoclast formation and activation (26). c-Fos is one of the key transcription factors in the AP-1 family, which is required for the early phase of osteoclast differentiation (34). NFATc1 is the hallmark of osteoclast fate, and is essential for the survival and differentiation of osteoclast precursors (35). CatK and TRAP are largely regarded as terminal osteoclast differentiation markers and highly expressed by activated osteoclasts to mediate the function of bone resorption (36,37). Moreover, mature osteoclasts exhibit bone resorption capacity by secreting protons, CatK and so forth. In the present study, the expression of c-Fos, NFATc1, CatK, and TRAP genes was increased with the treatment of IL-17A, indicating that IL-17A could promote the osteoclast differentiation in BMMs.

Autophagy, a conserved lysosomal degradation process, is essential for cell survival, differentiation, and development and is regulated by some autophagy-related genes (38). Emerging evidence has revealed that autophagy was activated in response to several pro-inflammatory cytokines, such as IL-1β and TNFα accompanied by a robust increase in osteoclast differentiation and bone resorption (18,39). The present findings supported the hypothesis that IL-17A, a pro-inflammatory cytokine, enhanced the autophagic activity including the increased expression of an autophagy-related gene, accumulation of LC3-II, as well as autophagosome formation along with osteoclast differentiation. Moreover, the addition of autophagy inhibitor 3-MA could reduce the level of osteoclast-related markers, thereby attenuating the osteoclast formation and bone resorption after the treatment with IL-17A. Thus, this result confirmed our speculation that autophagy exhibits the positive effect on osteoclast activity under IL-17 stimulation.

In addition, Ke et al (40) observed that IL-17 facilitated osteoclast precursor autophagy at a low concentration, and the activation of the RANKL/JNK pathway may be involved in IL-17-enhanced osteoclastogenesis. In the present study, it was also revealed that p-JNK and p-p38 were increased after addition of IL-17 (data not shown), which suggested that mitogen-activated protein kinase (MAPK) pathways including JNK and p38 may mediate autophagic activity of osteoclasts after addition of IL-17. However, more specific mechanisms require revealing to elucidate which pathway may exist in IL-17-enhanced autophagy and osteoclastogenesis.

It is well accepted that autophagy, as a highly conserved intracellular metabolic mechanism, has an anti-apoptotic effect. Xue et al (41), revealed that IL-17 modulated apoptosis of osteoclast precursors, RAW264.7, to influence osteoclastogenesis. However, RAW264.7 is a cell line which differs from the primary mouse bone marrow macrophages that we used (42). Therefore, whether IL-17A has an effect on the apoptosis of osteoclasts from primary bone marrow macrophages requires further study.

Notably, recent studies have demonstrated that the knockdown of Beclin1 (43) or p62 (44) using small interfering RNA (siRNA) resulted in the inhibition of osteoclastogenesis, and further deletion of Atg7 prevented the TNFα-induced bone loss in mice (45). Similar results revealed that the pharmacological or genetic inactivation of autophagy could ameliorate bone loss by inhibiting osteoclast differentiation. This phenomenon could implicate the direct translation targeting autophagy, which in turn, would provide promising therapeutic approaches in the prevention and treatment of inflammatory bone resorption.

Nonetheless, the number of osteoclasts was increased along with the exacerbation of alveolar bone resorption in response to IL-17A treatment in a rat periodontitis model. A previous study revealed that IL-17A gene transfer increased the level of osteoclasts and biomarkers of bone resorption in collagen-induced arthritis, indicating that IL-17A is crucial for pathological bone loss via direct activation of osteoclasts (46). Further studies demonstrated that blocking of IL-17 with IL-17 antibody or IL-17-deficient mice suppressed joint damage in experimental arthritis, rendering IL-17 as an intervention target for inflammatory bone resorption in rheumatoid arthritis (12,47–49). Notably, rheumatoid arthritis exhibits specific similarities with periodontitis with respect to inflammatory diseases, wherein inflammatory cytokines accelerate bone and joint destruction (50). However, although IL-17 is ascribed to joint disruption, the specific mechanism in periodontitis has not been reported yet, necessitating further investigation.

In conclusion, the present study revealed that IL-17A directly promoted osteoclast differentiation and exacerbated bone resorption in vitro and in vivo, and autophagic activity was involved in the IL-17A-mediated osteoclast differentiation of BMMs. These findings contribute to the molecular mechanism underlying IL-17A in alveolar bone destruction, and provide insight into the clinical therapeutic targets for periodontitis. However, these rudimentary studies cannot completely elucidate the complex correlation between the immune system and alveolar bone destruction. Future studies should be primarily focused on the specific mechanism of IL-17A in periodontitis in order to investigate the systemic treatment by blocking IL-17 for the prevention of periodontitis.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81771072 and 81800972), and the Natural Science Foundation of Zhejiang Province (grant nos. LY18H140002 and LY15H140003).

Availability of data and materials

The datasets used and analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

LS and JT performed the experiments, analyzed the data and wrote the manuscript. ZW cultured the cells and analyzed the data. MX performed western blotting and analyzed data. QT and YW analyzed data and revised the manuscript. LC conceived and designed the study. PD designed the study and revised the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All mice and rat experiments were performed in accordance with the principles and procedures of the National Institutes of Health (NIH) for the Care and Use of Laboratory Animals. The approval number granted by the Animal Ethics Committee of The Second Affiliated Hospital of Zhejiang University School of Medicine is 2017–052. All surgeries were performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

IL-17A

interleukin 17A

BMMs

bone marrow macrophages

3-MA

3-methyladenine

TRAP

tartrate-resistant acid phosphatase

NFATc1

nuclear factor of activated T cells 1

CatK

cathepsin K

RANKL

receptor activator of nuclear factor-κB ligand

LC3

microtubule-associated protein 1 light chain 3

M-CSF

macrophage colony-stimulating factor

References

1 

Page RC and Kornman KS: The pathogenesis of human periodontitis: An introduction. Periodontol 2000. 14:9–11. 1997. View Article : Google Scholar : PubMed/NCBI

2 

Hajishengallis G: Immunomicrobial pathogenesis of periodontitis: Keystones, pathobionts, and host response. Trends Immunol. 35:3–11. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Cochran DL: Inflammation and bone loss in periodontal disease. J Periodontol 79 (8 Suppl). S1569–S1576. 2008. View Article : Google Scholar

4 

Cheng WC, Hughes FJ and Taams LS: The presence, function and regulation of IL-17 and Th17 cells in periodontitis. J Clin Periodontol. 41:541–549. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Chen XT, Chen LL, Tan JY, Shi DH, Ke T and Lei LH: Th17 and Th1 lymphocytes are correlated with chronic periodontitis. Immunol Invest. 45:243–254. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Chen XT, Tan JY, Lei LH and Chen LL: Cytokine levels in plasma and gingival crevicular fluid in chronic periodontitis. Am J Dent. 28:9–12. 2015.PubMed/NCBI

7 

Cardoso CR, Garlet GP, Crippa GE, Rosa AL, Junior WM, Rossi MA and Silva JS: Evidence of the presence of T helper type 17 cells in chronic lesions of human periodontal disease. Oral Microbiol Immunol. 24:1–6. 2009. View Article : Google Scholar : PubMed/NCBI

8 

da Costa TA, Silva MJ, Alves PM, Chica JE, Barcelos EZ, Giani MA, Garlet GP, Silva JS, Junior VR, Rodrigues DB and Cardoso CR: Inflammation biomarkers of advanced disease in nongingival tissues of chronic periodontitis patients. Mediators Inflamm. 2015:9837822015. View Article : Google Scholar : PubMed/NCBI

9 

Hienz SA, Paliwal S and Ivanovski S: Mechanisms of bone resorption in periodontitis. J Immunol Res. 2015:6154862015. View Article : Google Scholar : PubMed/NCBI

10 

Fossiez F, Djossou O, Chomarat P, Flores-Romo L, Ait-Yahia S, Maat C, Pin JJ, Garrone P, Garcia E, Saeland S, et al: T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med. 183:2593–2603. 1996. View Article : Google Scholar : PubMed/NCBI

11 

Jovanovic DV, Di Battista JA, Martel-Pelletier J, Jolicoeur FC, He Y, Zhang M, Mineau F and Pelletier JP: IL-17 stimulates the production and expression of proinflammatory cytokines, IL-beta and TNF-alpha, by human macrophages. J Immunol. 160:3513–3521. 1998.PubMed/NCBI

12 

Lubberts E, van den Bersselaar L, Oppers-Walgreen B, Schwarzenberger P, Coenen-de Roo CJ, Kolls JK, Joosten LA and van den Berg WB: IL-17 promotes bone erosion in murine collagen-induced arthritis through loss of the receptor activator of NF-kappa B ligand/osteoprotegerin balance. J Immunol. 170:2655–2662. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Feng Y, He D, Yao Z and Klionsky DJ: The machinery of macroautophagy. Cell Res. 24:24–41. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Hale AN, Ledbetter DJ, Gawriluk TR and Rucker EB III: Autophagy: Regulation and role in development. Autophagy. 9:951–972. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Pierrefite-Carle V, Santucci-Darmanin S, Breuil V, Camuzard O and Carle GF: Autophagy in bone: Self-eating to stay in balance. Ageing Res Rev. 24:206–217. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Gelman A and Elazar Z: Autophagic factors cut to the bone. Dev Cell. 21:808–810. 2011. View Article : Google Scholar : PubMed/NCBI

17 

DeSelm CJ, Miller BC, Zou W, Beatty WL, van Meel E, Takahata Y, Klumperman J, Tooze SA, Teitelbaum SL and Virgin HW: Autophagy proteins regulate the secretory component of osteoclastic bone resorption. Dev Cell. 21:966–974. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Chung YH, Choi B, Song DH, Song Y, Kang SW, Yoon SY, Kim SW, Lee HK and Chang EJ: Interleukin-1β promotes the LC3-mediated secretory function of osteoclast precursors by stimulating the Ca2+-dependent activation of ERK. Int J Biochem Cell Biol. 54:198–207. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Lin NY, Stefanica A and Distler JH: Autophagy: A key pathway of TNF-induced inflammatory bone loss. Autophagy. 9:1253–1255. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Xing L and Boyce BF: RANKL-based osteoclastogenic assays from murine bone marrow cells. Methods Mol Biol. 1130:307–313. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Zhang Y, Xiong Y, Chen X, Chen C, Zhu Z and Li L: Therapeutic effect of bone marrow mesenchymal stem cells pretreated with acetylsalicylic acid on experimental periodontitis in rats. Int Immunopharmacol. 54:320–328. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Castro ΜL, Franco GC, Branco-de-Almeida LS, Anbinder AL, Cogo-Muller K, Cortelli SC, Duarte S, Saxena D and Rosalen PL: Downregulation of proteinase-activated receptor-2, interleukin-17, and other proinflammatory genes by subantimicrobial doxycycline dose in a rat periodontitis model. J Periodontol. 87:203–210. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Boyle WJ, Simonet WS and Lacey DL: Osteoclast differentiation and activation. Nature. 423:337–342. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Teitelbaum SL and Ross FP: Genetic regulation of osteoclast development and function. Nat Rev Genet. 4:638–649. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Asagiri M and Takayanagi H: The molecular understanding of osteoclast differentiation. Bone. 40:251–264. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Cekici A, Kantarci A, Hasturk H and Van Dyke TE: Inflammatory and immune pathways in the pathogenesis of periodontal disease. Periodontol 2000. 64:57–80. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Tompkins KA: The osteoimmunology of alveolar bone loss. Connect Tissue Res. 57:69–90. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Sprangers S, Schoenmaker T, Cao Y, Everts V and de Vries TJ: Different blood-borne human osteoclast precursors respond in distinct ways to IL-17A. J Cell Physiol. 231:1249–1260. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Adamopoulos IE, Chao CC, Geissler R, Laface D, Blumenschein W, lwakura Y, McClanahan T and Bowman EP: Interleukin-17A upregulates receptor activator of NF-kappaB on osteoclast precursors. Arthritis Res Ther. 12:R292010. View Article : Google Scholar : PubMed/NCBI

31 

Boyce BF: Advances in the regulation of osteoclasts and osteoclast functions. J Dent Res. 92:860–867. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Kitami S, Tanaka H, Kawato T, Tanabe N, Katono-Tani T, Zhang F, Suzuki N, Yonehara Y and Maeno M: IL-17A suppresses the expression of bone resorption-related proteinases and osteoclast differentiation via IL-17RA or IL-17RC receptors in RAW264.7 cells. Biochimie. 92:398–404. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Wijekoon S, Bwalya EC, Fang J, Kim S, Hosoya K and Okumura M: Chronological differential effects of pro-inflammatory cytokines on RANKL-induced osteoclast differentiation of canine bone marrow-derived macrophages. J Vet Med Sci. 79:2030–2035. 2017. View Article : Google Scholar : PubMed/NCBI

34 

Grigoriadis AE, Wang ZQ, Cecchini MG, Hofestetter W, Felix R, Fleisch HA and Wanger EF: c-Fos: A key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science. 266:443–448. 1994. View Article : Google Scholar : PubMed/NCBI

35 

Asagiri M, Sato K, Usami T, Ochi S, Nishina H, Yoshida H, Morita I, Wagner EF, Mark TW, Serfling E and Takayanagi H: Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. J Exp Med. 202:1261–1269. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Costa AG, Cusano NE, Silva BC, Cremers S and Bilezikian JP: Cathepsin K: Its skeletal actions and role as a therapeutic target in osteoporosis. Nat Rev Rheumatol. 7:447–456. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Hayman AR: Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41:218–223. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Yang Z and Klionsky DJ: Eaten alive: A history of macroautophagy. Nat Cell Biol. 12:814–822. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Lin NY, Beyer C, Giessl A, Kireva T, Scholtysek C, Uderhardt S, Munoz LE, Dees C, Distler A, Wirtz S, et al: Autophagy regulates TNFα-mediated joint destruction in experimental arthritis. Ann Rheum Dis. 72:761–768. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Ke D, Fu X, Xue Y, Wu H, Zhang Y, Chen X and Hou J: IL-17A regulates the autophagic activity of osteoclast precursors through RANKL-JNK1 signaling during osteoclastogenesis in vitro. Biochem Biophys Res Commun. 497:890–896. 2018. View Article : Google Scholar : PubMed/NCBI

41 

Xue Y, Liang Z, Fu X, Wang T, Xie Q and Ke D: IL-17A modulates osteoclast precursors' apoptosis through autophagy-TRAF3 signaling during osteoclastogenesis. Biochem Biophys Res Commun. 508:1088–1092. 2019. View Article : Google Scholar : PubMed/NCBI

42 

Ng AY, Tu C, Shen S, Xu D, Oursler MJ, Qu J and Yang S: Comparative characterization of osteoclasts derived from murine bone marrow macrophages and RAW 264.7 cells using quantitative proteomics. JBMR Plus. 2:328–340. 2018. View Article : Google Scholar : PubMed/NCBI

43 

Chung YH, Jang Y, Choi B, Song DH, Lee EJ, Kim SM, Song Y, Kang SW, Yoon SY and Chang EJ: Beclin-1 is required for RANKL-induced osteoclast differentiation. J Cell Physiol. 229:1963–1971. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Li RF, Chen G, Ren JG, Zhang W, Wu ZX, Liu B, Zhao Y and Zhao YF: The adaptor protein p62 is involved in RANKL-induced autophagy and osteoclastogenesis. J Histochem Cytochem. 62:879–888. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Lin NY, Chen CW, Kagwiria R, Liang R, Beyer C, Distler A, Luther J, Engelke K, Schett G and Distler JH: Inactivation of autophagy ameliorates glucocorticoid-induced and ovariectomy-induced bone loss. Ann Rheum Dis. 75:1203–1210. 2016. View Article : Google Scholar : PubMed/NCBI

46 

Adamopoulos IE, Suzuki E, Chao CC, Gorman D, Adda S, Maverakis E, Zarbalis K, Geissler R, Asio A, Blumenschein WM, et al: IL-17A gene transfer induces bone loss and epidermal hyperplasia associated with psoriatic arthritis. Ann Rheum Dis. 74:1284–1292. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Park MJ, Park HS, Oh HJ, Lim JY, Yoon BY, Kim HY, Cho ΜL and Cho SG: IL-17-deficient allogeneic bone marrow transplantation prevents the induction of collagen-induced arthritis in DBA/1J mice. Exp Mol Med. 44:694–705. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Koenders MI, Lubberts E, Oppers-Walgreen B, van den Bersselaar L, Helsen MM, Di Padova FE, Boots AM, Gram H, Joosten LA and van den Berg WB: Blocking of interleukin-17 during reactivation of experimental arthritis prevents joint inflammation and bone erosion by decreasing RANKL and interleukin-1. Am J Pathol. 167:141–149. 2005. View Article : Google Scholar : PubMed/NCBI

49 

Nakae S, Nambu A, Sudo K and Iwakura Y: Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice. J Immunol. 171:6173–6177. 2003. View Article : Google Scholar : PubMed/NCBI

50 

Araujo VM, Melo IM and Lima V: Relationship between periodontitis and rheumatoid arthritis: Review of the Literature. Mediators Inflamm. 2015:2590742015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Song L, Tan J, Wang Z, Ding P, Tang Q, Xia M, Wei Y and Chen L: Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages. Mol Med Rep 19: 4743-4752, 2019.
APA
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M. ... Chen, L. (2019). Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages. Molecular Medicine Reports, 19, 4743-4752. https://doi.org/10.3892/mmr.2019.10155
MLA
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M., Wei, Y., Chen, L."Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages". Molecular Medicine Reports 19.6 (2019): 4743-4752.
Chicago
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M., Wei, Y., Chen, L."Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages". Molecular Medicine Reports 19, no. 6 (2019): 4743-4752. https://doi.org/10.3892/mmr.2019.10155
Copy and paste a formatted citation
x
Spandidos Publications style
Song L, Tan J, Wang Z, Ding P, Tang Q, Xia M, Wei Y and Chen L: Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages. Mol Med Rep 19: 4743-4752, 2019.
APA
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M. ... Chen, L. (2019). Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages. Molecular Medicine Reports, 19, 4743-4752. https://doi.org/10.3892/mmr.2019.10155
MLA
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M., Wei, Y., Chen, L."Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages". Molecular Medicine Reports 19.6 (2019): 4743-4752.
Chicago
Song, L., Tan, J., Wang, Z., Ding, P., Tang, Q., Xia, M., Wei, Y., Chen, L."Interleukin‑17A facilitates osteoclast differentiation and bone resorption via activation of autophagy in mouse bone marrow macrophages". Molecular Medicine Reports 19, no. 6 (2019): 4743-4752. https://doi.org/10.3892/mmr.2019.10155
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team