Open Access

Inhibitory effect of 17β‑estradiol on triglyceride synthesis in skeletal muscle cells is dependent on ESR1 and not ESR2

  • Authors:
    • Quan Liu
    • Rui Li
    • Guanjun Chen
    • Jianming Wang
    • Bingfeng Hu
    • Chaofei Li
    • Xiaohuan Zhu
    • Yunxia Lu
  • View Affiliations

  • Published online on: April 24, 2019     https://doi.org/10.3892/mmr.2019.10189
  • Pages: 5087-5096
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The present study aimed to investigate the inhibitory effects and the mechanisms underlying 17β‑estradiol (E2) effects on triglyceride synthesis and insulin resistance in skeletal muscle tissues and cells. Ovariectomy (OVX) was performed on 6‑month‑old female rats treated with or without E2. Subsequently, various serum biochemical markers were measured. Additionally, pathological alterations of the uterus, liver and skeletal muscle were analyzed, and the content of triglycerides (TG) in muscle was detected. Differentiated myotubes formed by C2C12 cells were treated with palmitic acid (PA) or pretreated with E2, estrogen receptor (ESR) 1 agonist propylpyrazoletriol (PPT) and ESR2 agonist diarylpropionitrile (DPN). Subsequently, the mRNA or protein expression levels of ESR1/2, peroxisome proliferator activated receptor α (PPARα), CD36 molecule (CD36), fatty acid synthase (FASN), perilipin 2 (PLIN2), phosphorylated acetyl‑CoA carboxylase α (p‑ACACA), p‑AKT serine/threonine kinase (p‑AKT) and p‑mitogen‑activated protein kinase 8 (p‑MAPK8) were analyzed in skeletal muscle or in C2C12 cells by reverse transcription‑semi‑quantitative polymerase chain reaction and western blotting. The present results suggested that treatment with E2 inhibited OVX‑induced body weight gain, TG accumulation and insulin resistance. The protein or mRNA expression levels of ESR1, CD36, PPARα, p‑ACACA and p‑AKT were decreased, whereas the protein or mRNA expression levels of ESR2, PLIN2, FASN and p‑MAPK8 were increased in the OVX group. Of note, treatment with E2 restored the expression levels of the aforementioned factors. In C2C12 cells, treatment with E2 or PPT reversed the alterations induced by treatment with PA. In contrast, pretreatment with DPN did not influence the effect of PA. Collectively, E2 was able to interact with ESR1, thus activating the CD36‑PPARα pathway, decreasing the level of TG in the muscles and improving insulin resistance in skeletal muscles and C2C12 cells.

Introduction

The three principal muscle types in mammals are cardiac, smooth and skeletal muscles, with skeletal muscle being the most abundant tissues in the human body (1). Although previous studies identified sex-specific differences in the physiopathological characteristics of the cardiovascular system (2), the sex-specific physiopathological properties of skeletal muscles remain unclear. A previous study demonstrated that >3,000 genes were differentially expressed between male and female skeletal muscle (3).

In mammals, there are three principal types of estrogens: Estrone, 17β-estradiol (E2) and estriol. E2, which exhibits increased biological activity compared with other estrogens, is secreted primarily by the growing follicles in the ovaries during the ovarian cycle (4). Notably, skeletal muscles are targeted by E2 (5). During perimenopausal and postmenopausal periods, there is a significant decrease in muscle strength that may be increased by hormonal replacement therapy (HRT), suggesting that estrogens are important modulators of muscle physiology and are able to affect gene expression and mitochondrial function, thus maintaining the bioenergetic status of muscle cells (6).

In addition to the regulation of reproductive functions, estrogens may affect various physiological functions, including cellular metabolism (7,8). Decreased levels of E2 following menopause or ovariectomy (OVX) are associated with hyperphagia, obesity, hepatic steatosis and triglycerides (TG) accumulation in skeletal muscle cells (911); however the molecular mechanisms underlying E2 function remain unclear. Due to their lipophilic properties, estrogens are able to diffuse through the cellular membranes, interacting with intracellular receptors (12). In total, there are two types of estrogen receptors (ESR): ESR1 and ESR2.

Previous studies demonstrated that the effects of E2 on energy homeostasis are primarily mediated by ESR1 (10,13). Activating ESR1 using propylpyrazoletriol (PPT) may affect metabolism, insulin resistance and mitochondrial function in OVX mice with metabolic syndrome (14); however, the molecular mechanism underlying ESR1 function remains unclear.

Skeletal muscles are able to oxidize non-esterified fatty acids, or to store fatty acids (FAs) as TG, accumulating intramuscular triacylglycerol (IMTAG) (15). Although physiological levels of IMTAG do not impair the metabolic functions of skeletal muscles, the accumulation of IMTAG may be associated with promoted insulin resistance, due to increased levels of lipid intermediates and the subsequent activation of inflammatory or stress-associated pathway (16). Estrogen increases the levels of the FA transporter CD36 molecule (CD36) in the plasma membrane of cardiomyocytes, thus serving cardioprotective roles (17). Therefore, in the present study, it was hypothesized that E2 may increase CD36-mediated FA uptake, inhibiting the synthesis of FA and TG in skeletal muscle.

The transcription factor peroxisome proliferator activated receptor α (PPARα) is expressed primarily in tissues exhibiting high rates of FA oxidation, including cardiac and skeletal muscles (18). PPARα may regulate the protein expression levels of factors involved in FA catabolism. PPARα activation was identified to improve the musculoskeletal effects of exercise during estrogen deficiency (19); however, its roles in CD36-mediated FA uptake and the synthesis of acetyl-CoA carboxylase α (ACACA), fatty acid synthetase (FASN) and perilipin 2 (PLIN2) remain unclear.

Although the potential health risks and benefits of long-term HRT remain unclear, future studies using short-term HRT or specific ER agonists including PPT and diarylpropionitrile (DPN), may provide novel insights into the effects of E2 on skeletal muscles, thus benefiting postmenopausal patients (20). Therefore, it was hypothesized that short-term HRT may inhibit TG synthesis in the skeletal muscles of female rats following OVX, and this effect may be associated with the role of FA in promoting the activity of PPARα following the interaction between E2, and ESR1 or 2. To investigate this hypothesis, in vivo experiments were performed to examine the effects of E2 on weight loss and TG synthesis inhibition in female rats following OVX. Additionally, in vitro experiments were performed using ER agonists, including PPT and DPN, to activate ESR1 or ESR2, thus promoting FA transport, inhibiting TG synthesis and improving insulin resistance. Palmitic acid (PA) is the principal saturated FA in the blood, and was selected to treat myotubes formed by differentiated C2C12 cells in order to investigate the mechanisms underlying E2-mediated TG synthesis and insulin resistance.

Materials and methods

Animals

A total of 30 female Sprague-Dawley rats (age, 6 months; weight, 300–350 g) were purchased from The Experimental Animal Center at Anhui Medical University (Hefei, China). All rats had free access to food and water and were maintained in standard conditions of controlled temperature and humidity (22±1°C, 60–70%) under a 12-h light/dark cycle for one week. All animal experiments were reviewed and approved by The Ethics Committee of Anhui Medical University.

Experimental protocol

Rats were randomly divided into three groups: i) Sham surgery (SHAM; n=10); ii) rats that underwent ovariectomy without treatment (OVX; n=10); and iii) rats that underwent ovariectomy and treated with E2 (OVX + E2; n=10). All groups underwent laparotomy; however, the OVX and OVX + E2 groups underwent bilateral ovariectomy. The OVX + E2 rats were injected with E2 (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at a concentration of 0.06 mg/kg/day for 3 months following surgery. Body weight and food intake were measured every week.

Glucose tolerance test (GTT) and insulin tolerance test (ITT)

Insulin sensitivity was assessed using GTT and ITT as previously described (21). Briefly, for the GTT assay, all rats were fasted overnight and administered glucose (2 g/kg) by intraperitoneal injection. Blood samples were obtained from the tail veins at 0, 30, 60, 90 and 120 min following injection. The blood glucose was measured with a glucometer (OneTouch Ultra; Johnson & Johnson, New Brunswick, NJ, USA). ITT assays were performed by the intraperitoneal injection of neutral insulin (1 U/kg) following fasting for 4–6 h. The blood glucose was measured at 0, 30, 45, 60, 90 and 120 min. All data were plotted as blood glucose concentration over time. Subsequently, the area under curve (AUC) was calculated.

Serum lipid levels and E2 assays

After 6 months, rats were fasted for 12 h and anesthetized by intraperitoneal injection of sodium pentobarbital (60 mg/kg). Blood (~10 ml) was collected in tubes and serum was separated by centrifuging the samples at 1,000 × g for 10 min at room temperature and stored at −80°C prior to biochemical analysis. Fasting TG, total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) levels were measured using an automatic biochemical analyzer (AU640; Olympus Corporation, Tokyo, Japan). The serum levels of E2 were determined by radioimmunoassay (Beijing North Institute of Biological Technology, Beijing, China) and the serum levels of free FA (FFA) were measured using a Non-esterified Free Fatty Acids Assay kit (Nanjing Jiancheng Bio-Engineering Institute Co., Ltd., Nanjing, China) according to the manufacturer's protocol. Serum PA levels were examined by gas chromatography-mass spectrometry according to the method of Han et al (22).

IMTAG analysis

Soleus muscles were homogenized with normal saline buffer (467 mmol/l NaCl, 10 mmol/l KCl, 1 mmol/l NaH2PO4, 4 mmol/l NaHCO3, 8.4 mmol/l Na2SO4, 30 mmol/l HEPES, 10 mmol/l EDTA; pH 7.1 with KOH) to obtain 10% muscle homogenates. Subsequently, the levels of IMTAG were analyzed using the lipase glycerol kinase calorimetric method as previously described (23).

Histology analysis

Uterus, liver and soleus muscle samples were fixed in 10% formalin for 1 week at room temperature, embedded in paraffin, cut into 5-µm thick sections, and stained with 0.4% hematoxylin for 5 min and 0.5% eosin for 4 min at room temperature. All sections were imaged using a Nikon Eclipse 80i fluorescence microscope (magnification, ×100; Nikon Corporation, Tokyo, Japan).

Cell culture and drug treatment

The mouse myogenic cell line C2C12 was purchased from the American Type Culture Collection (Manassas, VA, USA), cultured in high-glucose Dulbecco's Modified Eagle's medium at 37°C with 5% CO2 in a cell incubator, and differentiated into myotubes with 2% horse serum (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) for 4 days. PA and E2 (Sigma-Aldrich; Merck KGaA) were dissolved in ethanol and added to the culture medium. The cells were divided into six groups: Untreated (CON), absolute ethyl alcohol, 0.5 mmol/l PA, 0.5 mmol/l PA + 1×10−8 mol/l E2 (PA + E2), 0.5 mmol/l PA + 1×10−8 mol/l PPT (PA + PPT; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and 0.5 mmol/l PA + 1×10−8 mol/l DPN (PA + DPN; Tokyo Chemical Industry Co., Ltd., Tokyo, Japan). E2, PPT and DPN were added to the medium 8 h prior to treatment with PA at 37°C. Cells were treated with PA for 24 h at 37°C, and cells were harvested for reverse transcription-semi-quantitative polymerase chain reaction (RT-sqPCR) and western blot analysis.

RT-sqPCR assay

Soleus muscles or myotubes formed by C2C12 cells were used to detect the expression levels of ESR1, ESR2, PPARα, ACACA, PLIN2, CD36, FASN and GAPDH with RT-sqPCR using a PCR thermocycler (Omni Controls, Inc. Tampa, FL, USA). Total RNA was extracted using TRIzol® reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and reverse transcribed with OligodT primers and Moloney murine leukemia virus reverse transcriptase (Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA) according to the manufacturer's protocols. The primers (Table I) were designed with Primer Premier 5 software (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Sangon Biotech Co., Ltd., (Shanghai, China). The reaction was performed in 25 µl using Takara Ex Taq Polymerase (Takara Biotechnology Co., Ltd., Dalian, China), with the following thermocycling conditions: Initial denaturation at 95°C for 3 min, 32 cycles of 30 sec at 95°C, 30 sec at 55°C and 30 sec at 72°C, with a final extension at 72°C for 10 min. A total of 30 cycles were conducted for GAPDH. The PCR products (6 µl in each well) were analyzed by electrophoresis on a 3% agarose gel; the dye used for visualization was ethidium bromide. Gel-Pro Analyzer 3.1 software (Media Cybernetics, Inc., Rockville, MD, USA) was used to analyze the intensity of each band, and the relative expression levels of the genes were normalized to GAPDH. Each experiment was repeated three times.

Table I.

Primers for reverse transcription-semi-quantitative polymerase chain reaction.

Table I.

Primers for reverse transcription-semi-quantitative polymerase chain reaction.

A, Rat

GenePrimer sequence (5′-3′)Product size, bp
ESR1F: CTGCCAAGGAGACTCGCTAC315
R: AAGTGCCCATTTCATTTCG
ESR2F: TTGTGCCAGCCCTGTTACTA200
R: TACGCCGGTTCTTGTCTAT
PPARαF: TGCTGTCCTCCTTGATGAAC270
R: GCTTGAGCACGTGCACAATC
ACACAF: AACCAGCACTCCCGATTC175
R: AGGCCAAACCATCCTGTAA
PLIN2F: CTCTCGGCAGGATCAAAGAC171
R: CGTAGCCGACGATTCTCTTC
FASNF: CGGCGAGTCTATGCCACTAT398
R: ACACAGGGACCGAGTAATGC
CD36F: CTCTGACATTTGCAGGTCCA214
R: CACAGGCTTTCCTTCTTTGC
GAPDHF: GCGAGATCCCGCTAACATCA178
R: CTCGTGGTTCACACCCATCA

B, Mouse

GenePrimer sequence (5′-3′)Product size, bp

ESR1F: TCCTAACTTGCTCCTGGACAGG78
R: GTAGCCAGCAACATGTCA
ESR2F: TTCTTTCTCATGTCAGGCACA123
R: CTCGAAGCGTGTGAGCATT
PPARαF: CAAGTGCCTGTCTGTCGG236
R: TCTGGTCGTTGTTGGGCG
ACACAF: CCTGGAGTGGCAGTGGTCTTCG176
R: TCCTCCTCCCTCTGAGGCCTTG
PLIN2F: CCCGCAACCTGACCCAGCAG114
R: CGCCTGCCATCACCCCCAAG
CD36F: GAGCAACTGGTGGATGGTTT204
R: GCAGAATCAAGGGAGAGCAC
FASNF: GGAGGTGGTGATAGCCGGTAT140
R: TGGGTAATCCATAGAGCCCAG
GAPDHF: CATCTTCCAGGAGCGAGACC635
R: TGAAGTCGCAGGAGACAACC

[i] F, forward; R, reverse; bp, base pairs; PLIN2, perilipin 2; CD36, CD36 molecule; ACACA, acetyl-CoA carboxylase α; FASN, fatty acid synthase; PPARα, peroxisome proliferator activated receptor α; ESR, estrogen receptor.

Western blot assay

Soleus muscles or myotubes formed by C2C12 cells were homogenized in ice-cold radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Haimen, China). The total concentration of protein in sample was determined using a bicinchoninic acid assay. In total, 30 µg protein was loaded in each lane. Proteins were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Following blocking in a solution of 1X TBS, 0.1% Tween-20 (TBST) containing 5% non-fat dry milk for 1 h at room temperature, the membranes were incubated with the following primary antibodies overnight at 4°C: PPARα (1:400; cat. no. bs-23398R; Bioss Antibodies Inc., Woburn, MA, USA), ACACA (1:500; cat. no. 21923-1-AP; ProteinTech Group, Inc., Chicago, IL, USA), phosphorylated (p-)ACACA (1:500; cat. no. 11818; Cell Signaling Technology, Inc., Danvers, MA, USA), PLIN2 (1:500; cat. no. bs-1164R; Bioss Antibodies Inc.), CD36 (1:500; cat. no. sc-7309), FASN (1:500; cat. no. sc-48357; both Santa Cruz Biotechnology, Inc.), MAPK8 (1:500; cat. no. BS3630), p-MAPK8 (1:500; cat. no. BS4763; all Biogot Technology Co., Ltd., Nanjing, China), AKT serine/threonine kinase (AKT; 1:1,000; cat. no. 9272), p-AKT (1:1,000; cat. no. 4060; both Cell Signaling Technology, Inc.) and β-actin (1:1,000; cat. no. TA-09; Beijing Zhongshan Golden Bridge Biotech, China). Then, the membranes were incubated with the secondary antibodies, horseradish peroxidase-conjugated goat anti-mouse (1:5,000; cat. no. S0002) and goat anti-rabbit (1:5,000; cat. no. S0001; both Affinity Biosciences, Cincinnati, OH, USA) for 1 h at room temperature. Detection was performed with enhanced chemiluminescence substrate (Thermo Fisher Scientific, Inc.) and quantification was performed with ImageJ software 1.48 (National Institutes of Health, Bethesda, MD, USA). The protein expression levels were normalized to β-actin. Subsequently, the ratio of phosphorylated/total protein was calculated. Each experiment was repeated three times.

Statistical analysis

Data are presented as the mean ± standard error of the mean (in tables) or standard deviation (in figures). P<0.05 was considered to indicate a statistically significant difference. Statistical analyses were performed using one-way analysis of variance followed by Fisher's Least Significant Difference (LSD) test. Statistical analyses were performed using SPSS software (version 23.0; IBM Corp., Armonk, NY, USA).

Results

Effects of E2 on body weight and serum biochemical parameters in OVX rats

Female OVX rats exhibited a significant increase in body weight compared with age-matched SHAM controls (Table II). Food intake in OVX rats was increased, suggesting that surgical removal of ovaries induced hyperphagia. OVX rats exhibited significant increases in the serum levels of TG, TC, LDL-C, FFA and PA, but significant decreases in the serum levels of HDL-C and E2. Treatment with E2 decreased body weights, decreased the serum levels of TG, TC, LDL-C, FFA and PA, and increased the serum levels of HDL-C and E2 in the OVX group.

Table II.

Effects of treatment with E2 in ovariectomized female rats.

Table II.

Effects of treatment with E2 in ovariectomized female rats.

ParametersShamOVXOVX + E2
Body weight, g299.50±22.52 406.25±30.75c 312.75±31.34f
Food intake, g19±1.23 26±2.65b 21±1.78d
Triglycerides, mmol/l0.44±0.027 0.56±0.070a 0.38±0.056f
Total cholesterol, mmol/l1.61±0.023 2.51±0.072c 2.04±0.026f
High-density lipoprotein cholesterol, mmol/l0.70±0.0058 0.54±0.071b 0.68±0.12f
Low-density lipoprotein cholesterol, mmol/l0.93±0.23 1.81±0.25c 1.27±0.23d
Estradiol, pmol/l93.5±4.65 72.5±12.71b 128.75±6.24f
Free fatty acids, mmol/l0.41±0.05 1.73±0.17a 0.84±0.11d
Palmitic acid, µg/ml210.81±2.63 655.29±18.25b 350.96±5.47e

{ label (or @symbol) needed for fn[@id='tfn2-mmr-19-06-5087'] } n=6 in each group.

a P<0.05

b P<0.01

c P<0.001 vs. sham control group

d P<0.05

e P<0.01

f P<0.001 vs. OVX group. OVX, ovariectomy; E2, 17β-estradiol.

Effects of E2 on pathological alterations following OVX

The volumes of the uterine gland and the uterus decreased in OVX rats compared with the sham control group (Fig. 1). The deposition of lipids increased in liver tissue, and infiltration of inflammatory cell into skeletal muscles were detected in the OVX group. Treatment with E2 partially reversed the size of the uterine gland, and decreased lipid deposition in the liver and aggregation of inflammatory cells in the skeletal muscles.

Effects of E2 on insulin resistance and circulating levels of IMTAG in OVX rats

GTT and ITT analyses suggested that rats in the OVX group exhibited insulin resistance compared with the SHAM group. However, rats in the OVX + E2 group exhibited a significant improvement in insulin resistance (Fig. 2A-D), in addition to a decrease in body mass (Table II). Following insulin resistance, the protein expression levels of p-AKT and p-MAPK serve as opposing markers for insulin signaling. Western blotting suggested that the p-AKT/AKT ratio was significantly decreased and the p-MAPK8/MAPK8 ratio was markedly increased in the OVX group compared with the control. However, the p-AKT/AKT and p-MAPK8/MAPK8 ratios were restored following treatment with E2, in line with the GTT and ITT results (Fig. 2E and F). The levels of TG in muscle tissues were measured, and decreased estrogen levels were identified to be associated with a significant increase in the intracellular levels of IMTAG in OVX rats compared with the control (Fig. 2G). TG deposition was not observed in the muscle tissue following H&E staining (Fig. 1). In contrast, the intracellular levels of IMTAG were significantly decreased in the OVX + E2 group compared with OVX alone (Fig. 2G). This suggested that treatment with E2 may decrease the synthesis of TG.

Effects of E2 on gene expressions in OVX rats

The results of the present study suggested that the expression levels of ESR1 significantly decreased in OVX rats compared with the control group; however, ESR2 expression was increased in OVX rats. The expression levels of ESR1 and ESR2 were significantly restored in OVX rats following treatment with E2 (Fig. 3A and B). Since treatment with E2 decreased the levels of TG (Fig. 2G), the mRNA and protein expression levels of three proteins involved in TG synthesis were examined. The mRNA expression levels of ACACA, PLIN2 and FASN increased significantly in the OVX group compared with the control group, but were decreased in the OVX + E2 group compared with OVX alone (Fig. 3A and B). The protein expression levels of PLIN2 and FASN exhibited the same trend; however, that of ACACA was markedly unaltered. Therefore, the protein expression levels of p-ACACA, the activated form of ACACA, were examined. The results of western blotting suggested that the p-ACACA/ACACA ratio was decreased in the OVX group and was significantly restored following treatment with E2 (Fig. 3C and D). Additionally, the present RT-sqPCR and western blotting results suggested that the mRNA and protein expression levels of CD36 and PPARα were decreased in OVX rats, and treatment with E2 partially reversed these effects. The alterations in the expression levels of ESR1, CD36 and PPARα were similar following OVX and treatment with E2, suggesting that these factors may be involved in the same pathway.

Effects of E2, PPT and DPN on the expression levels of metabolism-associated factors in C2C12 cells treated with PA

Treatment with PA significantly decreased the expression levels of ESR1 mRNA in differentiated C2C12 cells compared with the control. In contrast, pretreatment with E2 or PPT led to a significant increase in the expression of ESR1 compared with PA treatment alone. However, the expression level of ESR2 significantly increased following treatment with PA compared with the control, and was partially restored by pretreating C2C12 cells with E2 or PPT; although the difference between pretreated cells and non-pretreated cells was not significant (Fig. 4A and B). Similarly, the mRNA and protein expression levels of PLIN2 and FASN significantly increased following treatment with PA, and these effects were reversed by pretreating C2C12 cells with E2 or PPT, which was similarly to the mRNA expression profile of ACACA (Fig. 4A and B). Notably, the protein expression level of ACACA was markedly unaltered; however, the p-ACACA/t-ACACA ratio was increased in the PA + E2 and PA + PPT groups compared with PA treatment alone (Fig. 4C and D). Additionally, the present RT-sqPCR and western blotting results suggested that the expression levels of PPARα and CD36 were significantly decreased in the PA group compared with the control, and were increased in the PA + E2 and PA + PPT groups compared with PA treatment alone (Fig. 4A-D). However, the expression levels of the aforementioned factors were not significantly altered between the PA group and the PA + DPN group. Treatment with PA significantly decreased the p-AKT/AKT ratio and increased the p-MAPK8/MAPK ratio compared with the control. Pretreatment with E2 or PPT reversed these effects, and pretreatment with DPN restored the levels of p-MAPK8/MAPK, suggesting that ESR1 activation improved insulin resistance in differentiated C2C12 cells (Fig. 4E and F). Collectively, the present study investigated the role of E2 and PA in the metabolic alterations occurring in skeletal muscle cells (Fig. 5).

Discussion

Due to the increasing incidence of female obesity and the weight gain observed following menopause (24), the identification of novel strategies to decrease the occurrence rate of postmenopausal obesity is required. The present study suggested that treatment with E2 decreased body weight, intracellular levels of IMTAG, and serum levels of TG, TC and LDL-C following OVX. Additionally, OVX led to an increase in the expression levels of PLIN2, FASN and ACACA and a decrease in the expression levels of ESR1, CD36 and PPARα. Notably, treatment with E2 reversed these effects, suggesting that E2 may inhibit TG synthesis, thus improving insulin resistance through the ESR1-CD36-PPARα pathway in skeletal muscles.

OVX and ER-knockout mice were previously identified to develop obesity, and treatment with estrogen reversed these effects (25). The present study suggested that the body weight and the protein expression of p-MAPK8 increased following OVX, whereas the protein expression level of p-AKT increased. In addition to the phosphorylation levels of MAPK8 and AKT, the GTT and ITT results suggested the occurrence of insulin resistance following OVX. Treatment with E2 decreased the body weight in OVX rats, and insulin resistance was improved, in line with previous investigations in human (26).

In normal skeletal muscle cells, FA uptake and TG synthesis are regulated by negative feedback mechanisms, so that lipid accumulation does not severely affect cellular function (27). Impaired regulation of FA uptake and TG synthesis in skeletal muscle is involved in insulin resistance (28). Following treatment with E2, and ESR1 and ESR2 agonists, muscle lipogenesis and TG accumulation were identified to be significantly decreased (29). The present results suggested that the levels of IMTAG increased in OVX rats, whereas the levels of IMTAG decreased following treatment with E2, suggesting an involvement of de novo TG synthesis in skeletal muscle following OVX. Additionally, treatment with E2 decreased synthesis of TG, as suggested by IMTAG detection; however, no alterations in lipid deposition were observed in skeletal muscles.

The expression of PLIN2 is specific of certain types of muscle fibers, and its expression level is increased in muscle fibers containing high levels of IMTAG (30). The present results suggested that the mRNA and protein expression levels of PLIN2 were increased in skeletal muscles following OVX and in C2C12 cells treated with PA. However, treatment with E2 and activation of ESR1 decreased the expression level of PLIN2 in muscle tissues and cells, suggesting that E2 may be involved in the expression level of PLIN2 by activating ESR1.

PPARα regulates the expression levels of various genes involved in lipolysis and lipoprotein metabolism (31). Furthermore, OVX altered the expression levels of factors involved in lipogenesis, including FASN and ACACA, and in lipolysis, including PPARα. Notably, treatment with E2 and activation of ESR1 reversed the effects of OVX, in line with the previous study by Minnaard et al (32). A discrepancy between the mRNA and protein expression levels of ACACA was identified, possibly due to post-transcriptional modifications of ACACA. A limitation of the present study is that the mRNA expression levels of the genes investigated were assessed only by RT-sqPCR; however, quantitative PCR was not performed.

Previous studies using a rat model of OVX demonstrated that certain types of ER ligands may exhibit protective effects in skeletal muscle (33). In addition, it was observed that ESR1, but not ESR2, may be able to maintain mitochondrial function and metabolic homeostasis, and may exhibit a protective effect against inflammation (34,35). The present results suggested that the expression levels of ESR1, PPARα and CD36 was decreased following OVX or treatment with PA, and the levels of these factors increased following treatment with E2 or pretreatment with PPT, suggesting that these three factors may be part of the same pathway.

CD36 is broadly expressed, and it was identified to be involved in FA and lipid metabolism in pathological conditions (36). CD36 is a transporter of FA, and it may represent a molecular target to protect myocytes against lipotoxicity (36). However, the effect of ESR1 activation on the expression level of CD36 remains unclear. The present results suggested that treatment with PPT, an ESR1 agonist, increased the mRNA and protein expression levels of CD36 suggesting that the activity of ESR1 in skeletal muscle may be modulated to treat diseases associated with metabolic syndrome.

The ESR2 signaling pathway is involved in the regulation of skeletal muscle growth and regeneration by stimulating anabolic pathways, activating satellite cells, and modulating immune response (33). In the present study, the expression level of ESR2 was examined in skeletal muscle and in cells treated with PA. Notably, the expression level of ESR2 was increased following OVX compared with the control. Treatment with PA increased the expression level of ESR2; however, pretreatment with DPN did not affect the expression levels of CD36, PPARα, ACACA, PLIN2 and FASN in C2C12 cells treated with PA, suggesting that ESR2 may not be involved in the ESR1-CD36-PPARα pathway.

Collectively, the present results suggested that E2, by activating ESR1, may modulate TG synthesis in skeletal muscle during menopause, and it may represent a novel complementary therapy to treat postmenopausal obesity. Notably, ESR1 and ESR2 were identified to have distinct functions, and further loss-of-function experiments are required to examine the function of each receptor in muscle cells.

Acknowledgements

The authors would like to thank Miss Li Gui and Mr Dake Huang at the Comprehensive Laboratory, Anhui Medical University for H&E staining.

Funding

The present study was funded by The Scientific Research Foundation of Anhui Medical University (grant no. 2017XKJ027), The National Innovation and Entrepreneurship Project (grant no. 201710366019), The Natural Science Foundation of Anhui Province Education Department (grant no. KJ2017A186) and The Fund of Anhui Natural Science Foundation of China (grant no. 1808085MH233).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

YL conceived and designed the study. QL, RL and GC performed the cell culture, RT-sqPCR and western blotting experiments. JW conducted the GTT/ITT experiment, and detected serum lipid and E2. BH performed the IMTAG and histology analysis. RL analyzed the data. CL and XZ conducted the animal experiments. YL drafted the manuscript.

Ethics approval and consent to participate

All animal experiments were reviewed and approved by The Ethics Committee of Anhui Medical University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Endo K, Weng H, Naito Y, Sasaoka T, Takahashi A, Fukushima Y and Iwai N: Classification of various muscular tissues using miRNA profiling. Biomed Res. 34:289–299. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Pierdominici M, Ortona E, Franconi F, Caprio M, Straface E and Malorni W: Gender specific aspects of cell death in the cardiovascular system. Curr Pharm Des. 17:1046–1055. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Welle S, Tawil R and Thornton CA: Sex-related differences in gene expression in human skeletal muscle. PLoS One. 3:e13852008. View Article : Google Scholar : PubMed/NCBI

4 

Dewailly D, Robin G, Peigne M, Decanter C, Pigny P and Catteau-Jonard S: Interactions between androgens, FSH, anti-Müllerian hormone and estradiol during folliculogenesis in the human normal and polycystic ovary. Hum Reprod Update. 22:709–724. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Galluzzo P, Rastelli C, Bulzomi P, Acconcia F, Pallottini V and Marino M: 17beta-Estradiol regulates the first steps of skeletal muscle cell differentiation via ER-alpha-mediated signals. Am J Physiol Cell Physiol. 297:C1249–C1262. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Sipilä S, Finni T and Kovanen V: Estrogen influences on neuromuscular function in postmenopausal women. Calcif Tissue Int. 96:222–233. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Hevener AL, Clegg DJ and Mauvais-Jarvis F: Impaired estrogen receptor action in the pathogenesis of the metabolic syndrome. Mol Cell Endocrinol. 418:306–321. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Tena-Sempere M: Neuroendocrinology in 2016: Neuroendocrine control of metabolism and reproduction. Nat Rev Endocrinol. 13:67–68. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Martínez de Morentin PB, Lage R, González-García I, Ruíz-Pino F, Martins L, Fernández-Mallo D, Gallego R, Fernø J, Señarís R, Saha AK, et al: Pregnancy induces resistance to the anorectic effect of hypothalamic malonyl-CoA and the thermogenic effect of hypothalamic AMPK inhibition in female rats. Endocrinology. 156:947–960. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Mauvais-Jarvis F, Clegg DJ and Hevener AL: The role of estrogens in control of energy balance and glucose homeostasis. Endocr Rev. 34:309–338. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Moran AL, Warren GL and Lowe DA: Removal of ovarian hormones from mature mice detrimentally affects muscle contractile function and myosin structural distribution. J Appl Physiol (1985). 100:548–559. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Klinge CM: Estrogens regulate life and death in mitochondria. J Bioenerg Biomembr. 49:307–324. 2017. View Article : Google Scholar : PubMed/NCBI

13 

López M and Tena-Sempere M: Estrogens and the control of energy homeostasis: A brain perspective. Trends Endocrinol Metab. 26:411–421. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Hamilton DJ, Minze LJ, Kumar T, Cao TN, Lyon CJ, Geiger PC, Hsueh WA and Gupte AA: Estrogen receptor alpha activation enhances mitochondrial function and systemic metabolism in high-fat-fed ovariectomized mice. Physiol Rep. 4:e129132016. View Article : Google Scholar : PubMed/NCBI

15 

van Hall G: The physiological regulation of skeletal muscle fatty acid supply and oxidation during moderate-intensity exercise. Sports Med. 45 (Suppl 1):S23–S32. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Kewalramani G, Bilan PJ and Klip A: Muscle insulin resistance: Assault by lipids, cytokines and local macrophages. Curr Opin Clin Nutr Metab Care. 13:382–390. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Tepavcevic S, Koricanac G, Zakula Z, Milosavljevic T, Stojiljkovic M and Isenovic ER: Interaction between insulin and estradiol-17β in regulation of cardiac glucose and free fatty acid transporters. Horm Metab Res. 43:524–530. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Stavinoha MA, RaySpellicy JW, Essop MF, Graveleau C, Abel ED, Hart-Sailors ML, Mersmann HJ, Bray MS and Young ME: Evidence for mitochondrial thioesterase 1 as a peroxisome proliferator-activated receptor-alpha-regulated gene in cardiac and skeletal muscle. Am J Physiol Endocrinol Metab. 287:E888–E895. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Mosti MP, Ericsson M, Erben RG, Schüler C, Syversen U and Stunes AK: The PPARα agonist fenofibrate improves the musculoskeletal effects of exercise in ovariectomized rats. Endocrinology. 157:3924–3934. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Gorres BK, Bomhoff GL, Morris JK and Geiger PC: In vivo stimulation of oestrogen receptor α increases insulin-stimulated skeletal muscle glucose uptake. J Physiol. 589:2041–2054. 2011. View Article : Google Scholar : PubMed/NCBI

21 

van de Heijning BJM, Oosting A, Kegler D and van der Beek EM: An increased dietary supply of medium-chain fatty acids during early weaning in rodents prevents excessive fat accumulation in adulthood. Nutrients. 9:E6312017. View Article : Google Scholar : PubMed/NCBI

22 

Han LD, Xia JF, Liang QL, Wang Y, Wang YM, Hu P, Li P and Luo GA: Plasma esterified and non-esterified fatty acids metabolic profiling using gas-chromatography mass spectrometry and its application in the study of diabetic mellitus and diabetic nephropathy. Anal Chim Acta. 689:85–91. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Tarchalski J, Guzik P and Wysocki H: Correlation between the extent of coronary atherosclerosis and lipid profile. Mol Cell Biochem. 246:25–30. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Salpeter SR, Walsh JM, Ormiston TM, Greyber E, Buckley NS and Salpeter EE: Meta-analysis: Effect of hormone-replacement therapy on components of the metabolic syndrome in postmenopausal women. Diabetes Obes Metab. 8:538–554. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Manrique C, Lastra G, Habibi J, Mugerfeld I, Garro M and Sowers JR: Loss of estrogen receptor signaling leads to insulin resistance and obesity in young and adult female mice. Cardiorenal Med. 2:200–210. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Marchand GB, Carreau AM, Weisnagel SJ, Bergeron J, Labrie F, Lemieux S and Tchernof A: Increased body fat mass explains the positive association between circulating estradiol and insulin resistance in postmenopausal women. Am J Physiol Endocrinol Metab. 314:E448–E456. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Manco M, Mingrone G, Greco AV, Capristo E, Gniuli D, De Gaetano A and Gasbarrini G: Insulin resistance directly correlates with increased saturated fatty acids in skeletal muscle triglycerides. Metabolism. 49:220–224. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Strehlow K, Rotter S, Wassmann S, Adam O, Grohé C, Laufs K, Böhm M and Nickenig G: Modulation of antioxidant enzyme expression and function by estrogen. Circ Res. 93:170–177. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Huang L, Tepaamorndech S, Kirschke CP, Newman JW, Keyes WR, Pedersen TL and Dumnil J: Aberrant fatty acid metabolism in skeletal muscle contributes to insulin resistance in zinc transporter 7 (znt7)-knockout mice. J Biol Chem. 293:7549–7563. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Weigt C, Hertrampf T, Kluxen FM, Flenker U, Hülsemann F, Fritzemeier KH and Diel P: Molecular effects of ER alpha- and beta-selective agonists on regulation of energy homeostasis in obese female Wistar rats. Mol Cell Endocrinol. 377:147–158. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Duval C, Müller M and Kersten S: PPARalpha and dyslipidemia. Biochim Biophys Acta. 1771:961–971. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Minnaard R, Schrauwen P, Schaart G, Jorgensen JA, Lenaers E, Mensink M and Hesselink MK: Adipocyte differentiation-related protein and OXPAT in rat human skeletal muscle: Involvement in lipid accumulation and type 2 diabetes mellitus. J Clin Endocrinol Metab. 94:4077–4085. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Velders M, Schleipen B, Fritzemeier KH, Zierau O and Diel P: Selective estrogen receptor-β activation stimulates skeletal muscle growth and regeneration. FASEB J. 26:1909–1920. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Ribas V, Drew BG, Zhou Z, Phun J, Kalajian NY, Soleymani T, Daraei P, Widjaja K, Wanagat J, de Aguiar Vallim TQ, et al: Skeletal muscle action of estrogen receptor α is critical for the maintenance of mitochondrial function and metabolic homeostasis in females. Sci Transl Med. 8:334ra542016. View Article : Google Scholar : PubMed/NCBI

35 

Ribas V, Nguyen MT, Henstridge DC, Nguyen AK, Beaven SW, Watt MJ and Hevener AL: Impaired oxidative metabolism and inflammation are associated with insulin resistance in ERalpha-deficient mice. Am J Physiol Endocrinol Metab. 298:E304–E319. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Glatz JFC and Luiken JJFP: Dynamic role of the transmembrane glycoprotein CD36 (SR-B2) in cellular fatty acid uptake and utilization. J Lipid Res. 59:1084–1093. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June-2019
Volume 19 Issue 6

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu Q, Li R, Chen G, Wang J, Hu B, Li C, Zhu X and Lu Y: Inhibitory effect of 17β‑estradiol on triglyceride synthesis in skeletal muscle cells is dependent on ESR1 and not ESR2. Mol Med Rep 19: 5087-5096, 2019
APA
Liu, Q., Li, R., Chen, G., Wang, J., Hu, B., Li, C. ... Lu, Y. (2019). Inhibitory effect of 17β‑estradiol on triglyceride synthesis in skeletal muscle cells is dependent on ESR1 and not ESR2. Molecular Medicine Reports, 19, 5087-5096. https://doi.org/10.3892/mmr.2019.10189
MLA
Liu, Q., Li, R., Chen, G., Wang, J., Hu, B., Li, C., Zhu, X., Lu, Y."Inhibitory effect of 17β‑estradiol on triglyceride synthesis in skeletal muscle cells is dependent on ESR1 and not ESR2". Molecular Medicine Reports 19.6 (2019): 5087-5096.
Chicago
Liu, Q., Li, R., Chen, G., Wang, J., Hu, B., Li, C., Zhu, X., Lu, Y."Inhibitory effect of 17β‑estradiol on triglyceride synthesis in skeletal muscle cells is dependent on ESR1 and not ESR2". Molecular Medicine Reports 19, no. 6 (2019): 5087-5096. https://doi.org/10.3892/mmr.2019.10189