Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2019 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2019 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes

  • Authors:
    • Shuhui Qi
    • Bo Liu
    • Junzhen Zhang
    • Xuexian Liu
    • Changsheng Dong
    • Ruiwen Fan
  • View Affiliations / Copyright

    Affiliations: College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, Shanxi 030801, P.R. China
    Copyright: © Qi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2649-2656
    |
    Published online on: July 12, 2019
       https://doi.org/10.3892/mmr.2019.10492
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs (miRNAs) serve various roles in the regulation of melanogenesis in mammalian melanocytes that contribute to the development of hair color. The manipulation of the melanocyte action is a new target for genetic improvement. Short tandem target mimic (STTM) is a potent approach for silencing miRNAs in plants and animals. To investigate the function of miR‑143‑5p in melanogenesis, STTM was used to block the expression of miR‑143‑5p (STTM‑miR‑143‑5p). The molecular analysis and luciferase reporter assay identified myosin Va gene (MYO5A) as one of the miR‑143‑5p targets. STTM‑miR‑143‑5p overexpression resulted in an increased expression of downstream melanogenesis genes including microphthalmia‑associated transcription factor (MITF), tyrosinase family members [tyrosinase (TYR) and tyrosinase‑related protein 1 (TYRP1)], melanophilin (MLPH), and Rab27a, thereby contributing to melanocyte pigmentation by promoting total alkali‑soluble melanogenesis (ASM) and eumelanin (EM) contents; conversely, STTM‑miR‑143‑5p overexpression resulted in decreased expression of the tyrosinase‑related protein 2 (TYRP2)/dopachrome tautomerase (DCT), which is responsible for decreased pheomelanin (PM) content in mouse melanocytes. The results indicated that melanin production in melanocytes could be increased by manipulating miR‑143‑5p expression using STTM which resulted in ASM and EM production.

Introduction

The phenotype of hair color depends on the levels and ratio of two types of melanin, namely black-brown eumelanin (EM) and yellow-red-brown pheomelanin (PM), which are produced by resident skin melanocytes (1). The hair color formation includes melanin production in melanocytes and melanin transport to keratinocytes (2). Several genes and miRNAs are involved in the pathways of melanin production. microphthalmia-associated transcription factor (MITF) is an important transcription factor that activates the key limiting enzymes tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2)/DCT for the synthesis and storage of melanin in melanosomes (3,4). During melanin transportation, the tripartite complex Rab27a/melanophilin (MLPH)/myosin Va (MYO5A) plays a crucial role (5) and acts as a linker in the entire protein complex (6,7). The complex is required for connecting the melanosome to the actin cytoskeleton in order to facilitate the normal accumulation of the organelle in the dendritic tips (8). MYO5A is an actin-based molecular motor typically involved in the transport of organelles and vesicles, such as the melanosomes (9,10). MYO5A can bind to more than one type of cellular structure and its selectivity is determined by alternate spliced sequences in melanocytes (11).

Short tandem target mimics (STTMs) are based on target mimicry (TM) and aim to block the function of small RNA molecules in animals and plants (12). The expression of the microRNA-143 (miR-143) cluster is required in various types of cells. As predicted by the TargetScan analysis, miR-143-5p targets MYO5A. In the present study, the STTM method was used, which is considered a powerful technology to complement existing small RNA sequestration (12). An STTM-miR-143-5p plasmid was constructed to inhibit the function of miR-143-5p in the regulation of EM and PM production in mouse melanocytes.

Materials and methods

Construction of plasmids

An oligonucleotide containing the STTM-miR-143-5p sequence was chemically synthesized according to a previously described method (12). The oligonucleotide was inserted into the dual-luciferase vector, pmirGLO (Promega Corporation) in order to construct the expression plasmid pmirGLO-STTM-miR-143-5p, in which the CMV promoter was used to induce GFP and STTM-miR-143-5p expression. The null pmirGLO vector was used as the corresponding negative control (NC). The luciferase reporter expression plasmid was constructed by cloning the 3′-UTR sequence of the mouse MYO5A into the dual luciferase pmirGLO vector (Promega Corporation). The partial sequence of the mouse MYO5A containing the miR-143-5p binding sites was obtained by PCR with mouse melanocyte cDNA as the template and the primers that contained the XhoI and SacI sites (Table I). The PCR product was subsequently digested with XhoI and SacI and cloned into the SacI and XhoI restriction sites of the vector in order to produce the pmirGLO-MYO5A-wt plasmid. In addition, the MYO5A 3′-UTR with the miR-143-5p binding sites was mutated using a site-directed gene mutagenesis kit (Beyotime Institute of Technology) to generate the pmiGLO-MYO5A-mut plasmid. All constructs were verified by sequencing (Shenzhen Huada Gene Co., Ltd.).

Table I.

Primers used in the present study.

Table I.

Primers used in the present study.

Primer namePrimer sequence 5′-3′Application
MYO5A-F AAAATGCTGCGGTTAGGART-qPCR
MYO5A-R GCTTGGGAGGTATTGTGCRT-qPCR
MYO5A-wt-F CGAGCTCAAAATGCTGCGGTTAGGLuciferase reporter-wt
MYO5A-wt-R CCGCTCGAGCCAGTTAAAGAGTTTTGCATAGLuciferase reporter-wt
MYO5A-mut-F TACCTGCAGATGCACCTCTGCAAGTAGCAGACACTGGLuciferase reporter-mut
MYO5A-mut-R CCAGTGTCTGCTACTTGCAGAGGTGCATCTGCAGGTALuciferase reporter-mut
miR-143-5p-RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCAGAGART-qPCR
miR-143-5p-F ACACTCCAGCTGGGGGTGCAGTGCTGCATCRT-qPCR
Common-R CGAGCAGTGCAGGGTCCGAGGTRT-qPCR
U6-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATCTRT-qPCR
U6-F CTCGCTTCGGCAGCACART-qPCR
MLPH-F GGTTTCCTGCTTCTGTTCGRT-qPCR
MLPH-R CGTGGCTTATGTTTGTCCCRT-qPCR
Rab27a-F TATGGGTTTCCTGCTTCTRT-qPCR
Rab27a-R GCCTCCTCCTCTTTCACTRT-qPCR
MITF-F TGAGGAGCAGAGCAGGGCAGAGAGTRT-qPCR
MITF-R TGGGAAGGTTGGCTGGACAGGAGTTRT-qPCR
TYR-F TGAAAATCCTAACTTACTCAGCCCART-qPCR
TYR-R TCAAACTCAGACAAAATTCCACATCRT-qPCR
TYRP1-F CCATTGCTGTAGTGGCTGCGTTGTTRT-qPCR
TYRP1-R GGAGAGGCTGGTTGGCTTCATTCTTRT-qPCR
TYRP2-F TTGCTCTTGGGGTTGCTGGCTTTTCRT-qPCR
TYRP2-R TCCTCCGTGTATCTCTTGCTGCTGART-qPCR
β-actin-F TTGCTGACAGGATGCAGAAGRT-qPCR
β-actin-R ACATCTGCTGGAAGGTGGACRT-qPCR

[i] MYO5A, myosin Va; F, forward; R, reverse; wt, wild-type; mut, mutant; MLPH, melanophilin; MITF, microphthalmia-associated transcription factor; TYR, tyrosinase; TYRP1, tyrosinase-related protein 1; TYRP2, tyrosinase-related protein 2; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Melanocyte transfection

The mouse melanocytes used in the present study were established and maintained in our laboratory (13). The melanocytes were transfected with the pmirGLO-STTM-miR-143-5p plasmid and/or the pmirGLO null plasmid (NC) using the Lipofectamine 2000 assay (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The melanocytes were collected two days after, following transfection for cell lysis and total RNA preparation.

Dual luciferase reporter assay for miRNA target validation

293T cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS) and were transfected with 580 ng of pmirGLO-MYO5A-wt or pmirGLO-MYO5A-mut plasmids in the presence of 20 ng of pmirGLO-STTM-miR-143-5p or pmirGLO-NC plasmids using Lipofectamine 2000. These preparations were used for the luciferase assays two days after co-transfection. Luciferase activity was subsequently measured using the Dual-Luciferase Reporter Assay kit (Promega Corporation). The firefly luciferase activity of each test sample was normalized to that of Renilla. The data were performed in triplicate and expressed as the mean relative luciferase activity (mean ± SD).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of miRNA and mRNA expression levels

Total RNA from melanocytes was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions and treated with DNase I (Sigma-Aldrich; Merck KGaA). For quantitative mRNA expression analysis, 1 µg of total RNA was reverse-transcribed to cDNA using a cDNA synthesis kit (Takara Bio, Inc.) as described in the manufacturer's instructions. The samples were amplified by quantitative real time PCR using SYBR-Green PCR master mix (Takara Bio, Inc.). For quantitative miRNA expression analysis, cDNA was produced using a specific stem-loop RT primer pair, a common reverse primer (Table I) pair and a cDNA synthesis kit (Takara Bio, Inc.) according to a previously described method (14). SYBR-Green PCR master mix (Takara Bio, Inc.) was used for RT-qPCR reactions performed on a 7500 Fast Real-Time PCR™ system (Applied Biosystems Life Technologies; Thermo Fisher Scientific, Inc.). The relative expression levels of mRNA and miRNA were quantified using the quantification cycle (Cq) method (15) and the normalization was performed with regard to the amounts of β-actin and U6 mRNA, respectively.

Western blot analysis

The cell lysates from melanocytes were obtained using RIPA cell lysis reagent (Beyotime Institute of Biotechnology) and western blotting was conducted as previously described (16). The following primary antibodies were used: Anti-MYO5A (rabbit resource) at a 1:1,000 dilution (cat. no. 3402; RRID:AB_2148475; Cell Signaling Technology, Inc.), anti-MLPH (mouse resource) at a 1:1,000 dilution (cat. no. 66092-1-Ig; RRID:AB_11232039; ProteinTech Group), anti-RAB27A (mouse resource) at a 1:1,000 dilution (cat. no. ab55667; RRID:AB_945112), anti-MiTF (rabbit resource) at a 1:1,000 dilution (cat. no. ab20663; RRID:AB_470315), anti-TYR (rabbit resource) at a 1:1,000 dilution (cat. no. ab61294), anti-TYRP1 (rabbit resource) at a 1:1,000 dilution (cat. no. ab83774; RRID:AB_2211142), and anti-TYRP2 (rabbit resource) at a 1:1,000 dilution (cat. no. ab74073; AB_1524517; all from Abcam), and anti-GAPDH (rabbit resource) at a 1:10,000 dilution (cat. no. AP0063, Bioworld Technology, Inc.). Anti-rabbit IgG secondary antibodies (cat. no. CW0103) and anti-mouse IgG secondary antibodies (cat. no. CW0102) were commercially purchased. The immunoblots were exposed to develop the chemicals and subsequently scanned using a ChemiDOC™ XRS + imager (Bio-Rad Laboratories, Inc.). Protein expression was quantified from the band intensity which was assessed by densitometry using the Image-Pro Plus software (Olympus Corporation).

Spectrophotometric assay of melanin content

Following transfection, the harvested melanocytes were rinsed with phosphate-buffered saline (PBS). The spectrophotometric assay of the alkali-soluble melanin required melanocytes that were lysed with l ml of 1 M NaOH at 37°C. The cells were incubated for 1 h and the absorbance was measured at 475 nm spectrophotometrically. The determination of EM was achieved by melanocyte hydrolysis at 80°C in 30% hydroiodic acid and 30% hypophosphoric acid. Following cooling and the addition of 50% ethanol, the samples were centrifuged at 2,234 × g for 10 min in order to collect the insoluble eumelanic pigments that were subsequently solubilized at 80°C in hydrogen peroxide and sodium hydroxide. Following centrifugation at 10,700 × g for 1 min in a Sorvall Ultracentrifuge, the supernatant was obtained and its absorbance was measured at 350 nm. The concentration of PM was determined in transfected melanocytes that were solubilized in phosphate buffer (pH 10.5) and centrifuged at 10,700 × g for 10 min. The supernatant was obtained and the absorbance was recorded at 400 nm. The melanin contents were normalized to the total numbers of cells. All experiments were performed in triplicate.

Fontana-Masson staining

Following melanocytes transfection with STTM-miR-143-5p or pmirGLO null vector, the plasmids were washed thoroughly with PBS (pH 7.4) and the cells were fixed in 4% formaldehyde for 20 min. The cells were subsequently stained using Ammoniacal Silver solution from the Fontana-Masson stain kit (Abcam) at 55°C in the dark for 1 h, and washed with distilled water thoroughly thereafter. The cells were further stained using 0.2% gold chloride solution and 5% sodium thiosulfate solution for 2 min and counter-stained with Nuclear Fast Red solution for 5 min. The samples were washed with distilled water following every staining process. The melanin content was visualized under a light microscope.

Statistical analysis

The difference in melanin production, the levels of miRNA, mRNA and protein, and the relative luciferase activities were analyzed using ANOVA and the protected Fisher's least significant difference tests. The analysis was conducted using SPSS 11.5 software (SPSS, Inc.) and the differences were determined using a P-value threshold of 0.05 (P<0.05).

Results

STTM-miR-143 reduces the levels of miR-143 and its binding to MYO5A in melanocytes

To evaluate whether STTM-miR-143-5p affected miR-143 activity, the expression levels of miR-143 and its predicted target gene MYO5A were investigated in melanocytes transfected with pmirGLO-miR-143 by RT-qPCR. The results indicated that miR-143 expression was significantly decreased and that MYO5A expression was significantly increased following STTM-miR-143-5p treatment (Fig. 1).

Figure 1.

Effects of STTM-miR-143-5p on the expression levels of miR-143-5p and MYO5A. (A) The expression levels of miR-143-5p in mouse melanocytes transfected with the STTM-miR-143-5p expression plasmids. (B) The mRNA expression levels of MYO5A in melanocytes transfected with the STTM-miR-143-5p plasmids. (C and D) Analysis of MYO5A protein expression in mouse melanocytes transfected with the miR-143-5p expression plasmids by western blotting. The data are expressed as the mean ± SD (n=3). **P<0.01; ***P<0.001 vs. PGL0. STTM, short tandem target mimic; MYO5A, myosin Va.

To determine whether binding to conserved target sites could cause a reduction in the expression levels of MYO5A (Fig. 2A and B), the plasmids containing the 3′-UTR of MYO5A were co-transfected into melanocytes with pmirGLO-STTM-miR-143 or the corresponding pmirGLO null vector. Co-transfection of the pmirGLO-STTM-miR-143 and the pmirGLO-MYO5A-wt plasmids or of the empty vector and the pmirGLO-MYO5A-wt plasmids into the cells indicated that pmirGLO-STTM-miR-143 significantly increased the luciferase activity of wild-type of MYO5A. Furthermore, luciferase reporter assays indicated that point mutations in the sequences of pmirGLO-MYO5A-mut abolished the effects of endogenous miR-143 by reducing complementarity between miR-143 and the target sites of MYO5A (Fig. 2C and D). These data indicated that miR-143 could bind to the 3′-UTR of MYO5A and significantly inhibit its expression.

Figure 2.

The 3′-UTR of MYO5A transcript is a target for miR-143-5p. (A) The miR-143-5p binding sites in the 3′-UTR of MYO5A were predicted. (B) The alignment of the MYO5A sequences around the miR-143-5p binding sites (seed region is indicated by the box). (C and D) Luciferase reporter assays in 293T cells co-transfected with the wild-type 3′-UTR of MYO5A (pmirGLO-MYO5A-wt/mut) and the miR-143-5p or the NC plasmids. The data from dual luciferase assays are expressed as the mean relative luciferase activities ± SD (n=3). **P<0.01 vs. MYO5A-PGL0. MYO5A, myosin Va.

Effect of STTM-miR-143 overexpression on the melanogenic gene expression

The melanocytes that were transfected with the pmirGLO-STTM-miR-143 and negative control plasmids were harvested in order to examine the levels of the melanogenic genes, namely TYR, TYRP1 and TYRP2. In addition, the levels of the transcription factor MITF, and of the melanin transport genes MLPH, and Rab27a were examined. RT-qPCR and western blotting analyses demonstrated that overexpression of pmirGLO-STTM-miR-143 in melanocytes significantly increased the mRNA and protein levels of MLPH, Rab27a, MITF, TYRP1 and TYR. Conversely, overexpression of pmirGLO-STTM-miR-143 in melanocytes significantly decreased the mRNA and protein levels of Tyrp2 (Fig. 3).

Figure 3.

Effects of STTM-miR-143-5p on the expression of the melanogenic genes in melanocytes (A) mRNA expression of the genes MLPH, Rab27a, MITF, TYR, TYRP1, and TYRP2 in mouse melanocytes transfected with the STTM-miR-143-5p expression plasmid. (B and C) Analysis of MLPH, Rab27a, MITF, TYR, TYRP1, and TYRP2 protein expression in melanocytes transfected with the STTM-miR-143-5p expression plasmids. The data were normalized to β-actin levels and expressed as the relative fold change. The data are expressed as the mean ± SD (n=3). *P<0.05; **P<0.01; ***P<0.001 vs. respective PGL0. STTM, short tandem target mimic; MLPH, melanophilin; MITF, microphthalmia-associated transcription factor; TYR, tyrosinase; TYRP1, tyrosinase-related protein 1; TYRP2, tyrosinase-related protein 2.

Effects of STTM-miR-143 overexpression on melanin production

To determine whether pmirGLO-STTM-miR-143 overexpression could affect melanin production, melanocytes transfected with pmirGLO-STTM-miR-143 plasmid were harvested and total alkali-soluble melanogenesis (ASM), pheomelanogenesis (PM), and eumelanogenesis (EM) were measured. The results indicated that pmirGLO-STTM-miR-143 overexpression in mouse melanocytes increased ASM and PM by 30% (P<0.01; Fig. 4A and C), while it decreased EM by approximately 20% (P<0.01; Fig. 4B). Fontana-Masson staining confirmed the localization of melanin in the melanocytes. Overexpression of the pmirGLO-STTM-miR-143-5p plasmids in melanocytes significantly increased the melanin content and distribution compared with those noted in the negative control (Fig. 4D).

Figure 4.

Effects of STTM-miR-143-5p on melanin production in melanocytes. Production of (A) ATM, (B) EM and (C) PM in mouse melanocytes overexpressing STTM-miR-143-5p expression plasmids. (D) Distribution of melanin in mouse melanocytes and keratinocytes by transfection of STTM-miR-143-5p or the negative control plasmids followed by Fontana-Masson staining. Scale bar, 200 µm. The data are expressed as the mean ± SD (n=3). *P<0.05; **P<01 vs. PGL0. STTM, short tandem target mimic; ATM, alkali total melanin; EM, eumelanin; PM, pheomelanin.

Discussion

Genomic analysis has been previously used to investigate several aspects of pigment cell biology, including melanocyte- and melanosome-associated functions, pigment disorders, normal pigmentation variation and even melanoma (17). miRNAs are regulators of cellular events, such as differentiation, proliferation, and reprogramming (18), and have often been implicated in the regulation of melanogenesis for the determination of hair color (19). Our previous study identified miR-143 as a negative regulator of proliferation, migration and melanogenesis in mouse melanocytes by direct targeting of the TGF-β-activated kinase 1 (TAK1) (20). However, the effects of miR-143 knockdown on melanogenesis have not been previously identified. STTM is a powerful technology used to block miRNA function in animals (12). Our previous studies utilized STTM technology in order to inhibit miRNA-508-3p and demonstrated its efficacy in upregulating melanogenesis (21). In the present study, the same methodology was used to inhibit miR-143 expression in melanocytes.

Melanocytes located in the skin are derived directly from the neural crest cells and the embryonic cells that are present in the skin by the dorsolateral migration pathway (22). They are under the modulation of intrinsic factors and are controlled by extracellular signals (22). miR-143 plays a key role in embryonic stem cell (ESC) pluripotency (23), by targeting the sex-determining region Y-box 2 (SOX2), the Krüppel-like factor 4 (KLF4), and the octamer binding transcription factor 4 (OCT4) (20). These functions indicate that miR-143 promotes ESC differentiation into different cell lineages, such as neural crest cells (20). In mammalian skin, melanocytes produce melanin and form mature melanosomes that complete their pigmentation through their transfer to adjacent keratinocytes. These structures can also grow hair shafts at the hair bulb following transportation from the Golgi region to the dendrite tips (24,25). Melanocytes respond to environmental stimuli from surrounding keratinocytes to control differentiation and pigmentation, thereby determining hair and skin colors (26).

MITF is one of the key regulators of melanogenesis-limiting enzymes of the tyrosinase family, which include TYR, TYRP1, and TYRP2/DCT (27), The expression of MITF is modulated at the transcriptional level by specific transcription factors or at the post-transcriptional level by miRNAs (28). miR-143-5p can regulate MITF levels by targeting TAK1 (20). In the present study, it was demonstrated that MITF was upregulated in the presence of STTM-miR-143 in mouse melanocytes. MITF functions via a ‘lineage addiction’ mechanism to control specific aspects of the phenotypic expression of the melanocytic lineage and facilitate the transition of cells to a non-invasive stage. TYR and TYRP1 levels were decreased following miR-143 knockdown by STTM. However, DCT levels were increased following STTM-miR-143 overexpression. Therefore, it was hypothesized that MITF was not the only transcription factor involved in the regulation of TYRP2. In addition, the data were in agreement with those from a similar study demonstrating that TYR and TYRP1 levels were markedly decreased (27). The present study further demonstrated that TYRP2 expression was increased in MITF-knockdown melanocytes (MITF-KD) (27). Furthermore, TYRP2 expression levels were not regulated by the content of cellular melanin or by the levels of other regulatory enzymes in the melanogenic pathway (29). The mechanism of TYRP2 regulation has not been investigated to date. However, although MITF has been reported to be essential, it is not sufficient to induce the expression of melanogenic enzymes (30). In addition, it is a critical suppressor of innate immunity and can cause innate immune dysregulation of pigmentation, with implications in vitiligo, which is an autoimmune depigmentation disease (31).

During melanin transportation, melanosomes are transported across actin filaments via the association of the motor protein myosin Va with RAB27a and MLPH (32). RAB27a is a member of the Rab family of small GTPases, which are important regulators of membrane transport (33). Myosin Va requires simultaneous interaction with multiple components of a complex containing RAB27a and MLPH on the melanosomes (34). The C-terminus of MLPH can directly interact with actin, which is important for proper transportation and distribution of the melanosome to the dendrite tips (35). A positive correlation has been noted between the ability of MLPH to recruit MYO5A to melanosomes and the promotion of melanosomes in the peripheral retention (25). The accumulation of the pigment around the nucleus of the melanocytes and the abnormal transfer of melanin from melanocyte dendrites to keratinocytes can lead to albinism (36). miR-143 has been revealed to target MYO5A, and the present study demonstrated that STTM-miR-143 increased MYO5A levels and consequently MLPH and Rab27a levels, thus suggesting a stable interaction among MLPH, Rab27a and MYO5A. The absence of any one of these components may result in the failure of MYO5A to bind to melanosomes (34). In summary, STTM-miR-143 is an artificial biological tool used to control the melanogenesis by decreasing the expression of miR-143. This process regulates the levels of MYO5A, and in turn affects melanin secretion in melanocytes or in melanoma cells.

Acknowledgements

Not applicable.

Funding

The present study was supported by The Shanxi Scholarship Council of China (2017–072) and The Young Sanjin Scholars Distinguished Professor Program (RF).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

SQ and BL performed plasmid construction, cell culture and transfection, and gene expression experiments. JZ and XL performed melanin production, and analyzed and interpreted the data. CD and RF contributed to the conception and design of the experiments, and critically revised the manuscript for important intellectual content. SQ contributed to drafting the manuscript. All authors have read and approved the final manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Ito S and Wakamatsu K: Chemistry of mixed melanogenesis-pivotal roles of dopaquinone. Photochem Photobiol. 84:582–592. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Vachtenheim J and Borovansky J: ‘Transcription physiology’ of pigment formation in melanocytes: Central role of MITF. Exp Dermatol. 19:617–627. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Levy C, Khaled M and Fisher DE: MITF: Master regulator of melanocyte development and melanoma oncogene. Trends Mol Med. 12:406–414. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Bertolotto C, Busca R, Abbe P, Bille K, Aberdam E, Ortonne JP and Ballotti R: Different cis-acting elements are involved in the regulation of TRP1 and TRP2 promoter activities by cyclic AMP: Pivotal role of M boxes (GTCATGTGCT) and of microphthalmia. Mol Cell Biol. 18:694–702. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Hume AN and Seabra MC: Melanosomes on the move: A model to understand organelle dynamics. Biochem Soc Trans. 39:1191–1196. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Matesic L, Yip R, Reuss AE, Swing DA, O'Sullivan TN, Fletcher CF, Copeland NG and Jenkins NA: Mutations in Mlph, encoding a member of the Rab effector family, cause the melanosome transport defects observed in leaden mice. Proc Natl Acad Sci USA. 98:10238–10243. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Kuroda TS, Ariga H and Fukuda M: The actin-binding domain of Slac2-a/melanophilin is required for melanosome distribution in melanocytes. Mol Cell Biol. 23:5245–5255. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Wu X, Sakamoto T, Zhang F, Sell JR and Hammer JA III: In vitro reconstitution of a transport complex containing Rab27a, melanophilin and myosin Va. FEBS Lett. 580:5863–5868. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Rudolf R, Bittins CM and Gerdes HH: The role of myosin V in exocytosis and synaptic plasticity. J Neurochem. 116:177–191. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Alves CP, Yokoyama S, Goedert L, Pontes CLS, Sousa JF, Fisher DE and Espreafico EM: MYO5A gene is a target of MITF in melanocytes. J Invest Dermatol. 137:985–989. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Au SY and Huang JD: A tissue-specific exon of myosin Va is responsible for selective cargo binding in melanocytes. Cell Motility Cytoskeleton. 53:89–102. 2002. View Article : Google Scholar

12 

Tang G, Yan J, Gu Y, Qiao M, Fan R, Mao Y and Tang X: Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs. Methods. 58:118–125. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Bai R, Sen A, Yu Z, Yang G, Wang H, Fan R, Lv L, Lee KB, Smith GW and Dong C: Validation of methods for isolation and culture of alpaca melanocytes: A novel tool for in vitro studies of mechanisms controlling coat color. Asian Austral J Anim. 23:430–436. 2010. View Article : Google Scholar

14 

Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, et al: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33:e1792005. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Dong C, Wang H, Xue L, Dong Y, Yang L, Fan R, Yu X, Tian X, Ma S and Smith GW: Coat color determination by miR-137 mediated down-regulation ofmicrophthalmia-associated transcription factor in a mouse model. RNA. 18:1679–1686. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Loftus SK: The next generation of melanocyte data: Genetic, epigenetic, and transcriptional resource datasets and analysis tools. Pigment Cell Melanoma Res. 31:442–447. 2018. View Article : Google Scholar : PubMed/NCBI

18 

Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, Lee TH, Miano JM, Ivey KN and Srivastava D: miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. Nature. 460:705–710. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Kim KH, Lee TR and Cho EG: SH3BP4, a novel pigmentation gene, is inversely regulated by miR-125b and MITF. Exp Mol Med. 49:e3672017. View Article : Google Scholar : PubMed/NCBI

20 

Ji K, Zhang P, Zhang J, Fan R, Liu Y, Yang S, Hu S, Liu X and Dong C: MicroRNA 143-5p regulates alpaca melanocyte migration, proliferation, and melanogenesis. Exp Dermatol. 27:166–171. 2018. View Article : Google Scholar : PubMed/NCBI

21 

Liu B, Zhang J, Yang S, Ji K, Liu X, Du B, Jia Q, Qi S, Li X and Fan R: Effect of silencing microrna-508 by STTM on melanogenesis in alpaca (Vicugna pacos). Gene. 678:343–348. 2018. View Article : Google Scholar : PubMed/NCBI

22 

Sommer L: Generation of melanocytes from neural crest cells. Pigment Cell Melanoma Res. 24:411–421. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Tian X, Jiang J, Fan R, Wang H, Meng X, He X, He J, Li H, Geng J, Yu X, et al: Identification and characterization of microRNAs in white and brown alpaca skin. BMC Genomics. 13:5552012. View Article : Google Scholar : PubMed/NCBI

24 

Jackson IJ: Molecular and developmental genetics of mouse coat color. Annu Rev Genet. 28:189–217. 1994. View Article : Google Scholar : PubMed/NCBI

25 

Hume AN, Tarafder AK, Ramalho JS, Sviderskaya EV and Seabra MC: A coiled-coil domain of melanophilin is essential for Myosin Va recruitment and melanosome transport in melanocytes. Mol Biol Cell. 17:4720–4735. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Cichorek M, Wachulska M, Stasiewicz A and Tymińska A: Skin melanocytes: Biology and development. Postepy Dermatol Alergol. 30:30–41. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Wang P, Li Y, Hong W, Zhen J, Ren J, Li Z and Xu A: The changes of microRNA expression profiles and tyrosinase related proteins in MITF knocked down melanocytes. Mol Biosyst. 8:2924–2931. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Hartman ML and Czyz M: MITF in melanoma: Mechanisms behind its expression and activity. Cell Mol Life Sci. 72:1249–1260. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Pak BJ, Li Q, Kerbel RS and Ben-David Y: TYRP2-mediated resistance to cis-diamminedichloroplatinum (II) in human melanoma cells is independent of tyrosinase and TYRP1 expression and melanin content. Melanoma Res. 10:499–505. 2000. View Article : Google Scholar : PubMed/NCBI

30 

Gaggioli C, Buscà R, Abbe P, Ortonne JP and Ballotti R: Microphthalmia-associated transcription factor (MITF) is required but is not sufficient to induce the expression of melanogenic genes. Pigment Cell Res. 16:374–382. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Harris ML, Fufa TD, Palmer JW, Joshi SS, Larson DM, Incao A, Gildea DE, Trivedi NS, Lee AN, Day CP, et al: A direct link between MITF, innate immunity, and hair graying. PLoS Biol. 16:e20036482018. View Article : Google Scholar : PubMed/NCBI

32 

Chang H, Choi H, Joo KM, Kim D and Lee TR: Manassantin B inhibits melanosome transport in melanocytes by disrupting the melanophilin-myosin Va interaction. Pigment Cell Melanoma Res. 25:765–772. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Zerial M and McBride H: Rab proteins as membrane organizers. Nat Rev Mol Cell Biol. 2:107–117. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Hume AN, Collinson LM, Hopkins CR, Strom M, Barral DC, Bossi G, Griffiths GM and Seabra MC: The leaden gene product is required with Rab27a to recruit myosin Va to melanosomes in melanocytes. Traffic. 3:193–202. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Kuroda TS, Itoh T and Fukuda M: Functional analysis of slac2-a/melanophilin as a linker protein between Rab27A and myosin Va in melanosome transport. Methods Enzymol. 403:419–431. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Marks MS and Seabra MC: The melanosome: Membrane dynamics in black and white. Nat Rev Mol Cell Biol. 2:738–748. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qi S, Liu B, Zhang J, Liu X, Dong C and Fan R: Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes. Mol Med Rep 20: 2649-2656, 2019.
APA
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., & Fan, R. (2019). Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes. Molecular Medicine Reports, 20, 2649-2656. https://doi.org/10.3892/mmr.2019.10492
MLA
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., Fan, R."Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes". Molecular Medicine Reports 20.3 (2019): 2649-2656.
Chicago
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., Fan, R."Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes". Molecular Medicine Reports 20, no. 3 (2019): 2649-2656. https://doi.org/10.3892/mmr.2019.10492
Copy and paste a formatted citation
x
Spandidos Publications style
Qi S, Liu B, Zhang J, Liu X, Dong C and Fan R: Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes. Mol Med Rep 20: 2649-2656, 2019.
APA
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., & Fan, R. (2019). Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes. Molecular Medicine Reports, 20, 2649-2656. https://doi.org/10.3892/mmr.2019.10492
MLA
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., Fan, R."Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes". Molecular Medicine Reports 20.3 (2019): 2649-2656.
Chicago
Qi, S., Liu, B., Zhang, J., Liu, X., Dong , C., Fan, R."Knockdown of microRNA‑143‑5p by STTM technology affects eumelanin and pheomelanin production in melanocytes". Molecular Medicine Reports 20, no. 3 (2019): 2649-2656. https://doi.org/10.3892/mmr.2019.10492
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team