International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Epstein Barr-virus (EBV) is a highly prevalent γ herpes virus in humans, and was also the first identified human tumor-associated virus (1). EBV is frequently implicated in the etiology of a number of malignancies, including nasopharyngeal carcinoma (NPC) (1). NPC, particularly poorly differentiated or undifferentiated NPC, is closely associated with EBV. Latent membrane protein 1 (LMP1) is known to be a oncogenic protein encoded by the EBV genome, as it has an important role in EBV-mediated B-cell proliferation and immortalization (2); however, the mechanism of LMP1-mediated epithelial cell transformation remains unclear. LMP1 is a 386 amino acid transmembrane glycoprotein, which consists of a short cytoplasmic N-terminal domain (residues 1–23), six transmembrane domains (residues 24–186), and a long cytoplasmic C-terminal domain (residues 187–386), which is known as the carboxyl terminal activation region (CTAR) (3). Currently, three CTARs have been reported, CTAR1 (residues 194–232), CTAR2 (residues 351–386) and CTAR3 (residues 275–330) (4). CTAR1 engages tumor necrosis factor receptor-associated factors to induce low-level nuclear factor-κB (NF-κB) activation (5). CTAR2 interacts with TRA death domain protein to mediate high-level NF-κB activation and also induces c-Jun N-terminal kinases/activator protein-1 (AP-1) activation (6). Gires et al (7) first reported the CTAR3 of LMP1 and confirmed the region was associated with the JAK3/signal transducer and activator of transcription (STAT) signaling pathway; however, its function in epithelial cells requires further analysis.
NF-κB luciferase (LUC) reporter and β-galactosidase plasmids were received from Dr David Goeddel (Tularik, Inc., San Francisco, CA, USA). AP-1 LUC reporter (with four AP-1 sites) was received from Dr Zhi-Gang Dong (University of Minnesota, Austin, MN, USA). pLNSX retroviral vector, pLNSX-LMP1WT retroviral vector (wild type with the full-length LMP1 gene) and pGL2 plasmids were received from Dr Liang Cao (University of Hong Kong, Hong Kong SAR, China).
The SV40-immortalized nasopharyngeal epithelial cell line NP69 was a generous gift from Dr Sai Wah Tsao (University of Hong Kong). NP69 cells were cultured in serum-free keratinocyte medium (K-SFM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in humidified 5% (v/v) CO2 atmosphere at 37°C. Retrovirus packaging cell line PA317, immortalized lymphocyte cells and 293 cells were obtained from the American Type Culture Collection (Manassas, VA, USA), and routinely maintained in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) with 15% fetal calf serum (Gibco; Thermo Fisher Scientific, Inc.).
The mouse anti-human monoclonal antibody S12 for LMP1 (1:50) obtained from a hybridoma was a generous gift from Dr Liang Cao (University of Hong Kong, SAR, China). Immobilized pH gradient (IPG) strisp (pH 3-10NL, 24 cm) were obtained from GE Healthcare (Chicago, IL, USA). Polymerase chain reaction (PCR) primers (Table I) were designed using Primer5 software (version 5.00; Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Invitrogen (Thermo Fisher Scientific, Inc.).
Table I.Primer sequences used in fluorescent reverse transcription-quantitative polymerase chain reaction. |
To construct an pLNSX-LMP1Δ232-351 plasmid expressing a product with deleted amino acid residues at positions 232 to 351 in the CTAR3 region, plasmid pLNSX-LMP1WT with full-length LMP1WT gene as a template and four primers (p1, 5′CTCGGCCTCTGAGCTATTCC3′; p2, 5′GCCGCCATGGGCTCCACTCACTCACGAGCAG3′; p3, 5′AGTGGAGCCCATGGCGGCGGTGACCCA3′ and p4, 5′CGAGAAGCGAACTGATTGGT3′) were put into the PCR instrument (Eppendorf, Hamburg, Germany). The 50 µl PCR reaction was carried out using a PCR amplification kit (Promega (Beijing) Biotech Co., Ltd, Beijing, China) according to the manufacturer's protocol. PCR was performed for 30 cycles and consisted of denaturation at 94°C for one minute, annealing at 58°C for 1 min and extension at 72°C for 1 min. The PCR product and the pLNSX retroviral vector containing XbaI and HindIII sites were mixed in 10 µl PCR reaction system at 1:1 ratio. The connection reaction was run overnight at 16°C. The pLNSX-LMP1Δ232-351 was confirmed by DNA sequencing. In addition, to construct the JAK3 LUC reporter plasmid, genomic DNA of immortalized lymphocyte cells was used as the PCR template with upstream primer (5′CCGCTCGAGGTGCCCAACTCACACATGCTACAGAT3′, the XhoI site denoted by bold font) and downstream primer (5′CCCAAGCTTAGAGGAAAGTCCCACTCGGCTCCTT3′, the HindIII site denoted by bold font). PCR was performed for 35 cycles consisting of denaturation at 94°C for one minute, annealing at 63°C for 1 min and extension at 72°C for 30 sec. Subsequently, the PCR product was digested with HindIII and XhoI and cloned into the luciferase reporter plasmid pGL2. The pGL2/JAK3-LUC plasmid was obtained and confirmed by DNA sequencing.
PA317 cells were transfected with pLNSX-LMP1WT and pLNSX-LMP1Δ232-351 at 300 ng/well, to produce amphotropic retroviruses at a density of 5×104 cells per well in 6-well plates. After 24 h of transfection, the transfected PA317 cells were selected with G418 (500 mg/ml, Invitrogen; Thermo Fisher Scientific, Inc.). After 2–3 weeks, the resistant cells were collected and cultured as the virus-producing cell lines. NP69 cells, which were inoculated onto 6-well plates in triplicate at 5×104 cells/well, were transduced with Rv-LMP1WT, Rv-LNSX-LMP1Δ232-351 retroviruses (MOI=30). After 48 h, the successfully infected cells were selected by G418 (400 µg/ml) for 2 weeks, and the resistant clones were pooled and designated as NP69-LMP1WT and NP69-LMP1Δ232-351 cells. The stable expression of LMP1 in the resistant clones was determined by western blotting and immunofluorescence assay with LMP1 antibody S12.
Cell slides were prepared, fixed with methanol and acetone (1:1) at 4°C for 30 min, washed, dried, and labeled with anti-LMP1 monoclonal antibody S12 (1:50) for 1 h at 37°C. After washing, the cells were incubated with a FITC-labeled goat anti-mouse secondary antibody (1:500; cat. no. A-11029; Zymed; Thermo Fisher Scientific, Inc.) for 1 h at 37°C, washed and then oil sealed and observed under a fluorescence microscope at 778 nm (EVOS® FL Auto; Thermo Fisher Scientific, Inc.).
For growth curve analysis, transduced NP69 cells were seeded onto 96-well plates in triplicate wells at 1×104 cells/well at 24 h after viral infection. The number of viable cells was determined every 48 h using the MTT method. After incubation with MTT in a humidified 5% (v/v) CO2 atmosphere at 37°C incubator for 4 h, the cell culture supernatant was removed, 150 µl of DMSO was added to fully dissolve the crystals and the OD value of each well was measured at a wavelength of 490 nm using an ELX800 microplate reader (BioTek China, Beijing, China). Growth curves were produced by plotting the mean and standard deviation of three independent experiments.
To determine the anchorage-independence ability of NP69 cells, LMP1 cells that had been transduced for 24 h were seeded into semisolid agar K-SFM medium [base layer, 0.6% (w/v); upper layer, 0.3% (w/v)] at a density of 5×104 cells per well in 6-well plates. Three independent experiments with duplicate wells for each cell line were performed. After 3–4 weeks of incubation at 37°C with 5% (v/v) CO2, the number and size of colonies (≥50 cells was classed as one colony) were observed under an inverted microscope (TS100; Nikon Corporation, Tokyo, Japan), and 10 low power fields (×4) were randomly selected for each group. The experiments were conducted in triplicate.
Harvested cells were washed twice with ice-cold PBS, and lysed in lysis buffer [7 mol/l urea, 2 mol/l thiourea, 2% (v/v) NP-40, 1% (v/v) Triton X-100, 100 mmol/l dithiothreitol (DTT), 5 mmol/l PMSF, 4% (w/v) CHAPS, 0.5 mmol/l EDTA, 40 mmol/l Tris, 1 mg/ml DNase I]. The cell lysates were incubated at 4°C for 30 min and then centrifuged at 4°C and 21,130 × g for 10 min. The supernatant constituted the total protein solution. The concentration of the total proteins was assayed with a 2D Quantification kit (GE Healthcare).
IPG-2D PAGE was performed according to the manufacturer's protocols (GE Healthcare). Protein samples (1.0 mg) were diluted to 450 µl with rehydration solution [8 mol/l urea, 2% (w/v) CHAPS, 0.5% (v/v) pH 3–10 IPG buffer and trace bromophenol blue], and applied for isoelectric focusing (IEF) using Immobiline IPG strips (pH 3–10; L 240×3×0.5 mm). The strips were rehydrated at 30 V for 14 h and proteins were focused successively for 1 h at 500 V, 1 h at 1,000 V and 8.5 h at 8,000 V to produce a total of 69,920 Vh on an IPGphor (Amersham Biosciences, Uppsala, Sweden). Following IEF, the IPG strips were equilibrated for 15 min at room temperature in a buffer containing 50 mM Tris-HCl (pH 8.8), 30% (v/v) glycerol, 6 M urea, 2% (w/v) SDS and 1% (w/v) DTT, followed by further treatment in a similar buffer [containing 2.5% (w/v) iodoacetamide instead of DTT] for 15 min, and then directly applied on to 12.5% (w/v) homogeneous SDS-PAGE gels for electrophoresis using a the Ettan DALT II system (Amersham Biosciences, Uppsala, Sweden) according to the manufacturer's protocols. The separated proteins were visualized after 13 h Coomassie Brilliant Blue G-250 staining at room temperature. The stained 2D gels were scanned with MagicScan software (version 6.0; Kenxen Limited, Hong Kong, SAR, China) on an Imagescanner (Amersham Biosciences, Uppsala, Sweden) with 300 DPI resolution. The scanned data were then analyzed using PDQuest 2D gel analysis software (version 7.1; Bio-Rad Laboratories, Inc., Hercules, CA, USA). To ensure experiment reproducibility, the 2D gel of each cell line was repeated in triplicate. The gel spot pattern of each gel was summarized in a standard following spot matching. Thus, one standard gel for each cell line was established. The criteria to determine differential protein spots were that spot intensity increased or decreased more than two-fold between the comparison groups. Statistical analysis was performed using SPSS, version 18.0 (SPSS, Inc. Chicago, IL, USA).
A total of 39 differential protein spots were excised from preparative 2D gels using biopsy punches and transferred to a 1.5 ml siliconized Eppendorf tube. Each spot was first washed with 50 µl deionized water 3 times, each time for 2 min. A further 50 µl of decolorizing solution (100 mmol/l NH4HCO3, 30% CAN; 1:1) was added at 37°C for 30 min. The spot was then repeatedly rinsed with deionized water until the color had completely faded. A 300 µl volume of 100% CAN was added to dehydrate the sample before it was drained. A 5 µl volume of trypsin working solution (0.02 µg/µl) was added to each tube to digest the sample at 4°C for 45 min. After the solution had been completely absorbed by micelles, 30 µl of NH4HCO3 (40 mmol/l) was added and the sample was incubated at 37°C overnight. The supernatant was transferred to a new tube, and 30 µl extraction liquid (60% CAN, 5% TFA; 1:1) was added to the original tube, the extraction was repeated twice at 37°C for 60 min. After extraction and enzymolysis the supernatants were combined and lyophilized to prepare the protein sample. The protein samples were analyzed by Applied Biosystems Voyager System 4307 MALDI-TOF mass spectrometer (Applied Biosystems; Thermo Fisher Scientific, Inc.). The parameters were set up as follows: Positive ion-reflector mode, accelerating voltage 20 kV, grid voltage 64.5%, mirror voltage ratio 1.12, N2 laser wavelength 337 nm, pulse width 3 nsec, the number of laser shots 50, acquisition mass range 1,000–3,000 Da, delay 100 nsec and vacuum degree 4×10−7 Torr. A trypsin-fragment peak served as internal standard for mass calibration. A list of the corrected mass peaks was termed the peptide mass fingerprint (PMF). Proteins were identified from PMF data by searching the UniProt database (http://www.uniprot.org/uniprot) using the software MASCOT (version 2.5.1, Matrix Science, Ltd., London, UK). Subcellular location and function information was derived from the NCBI database (http://www.ncbi.nlm.nih.gov).
Cells were extracted in lysis buffer (0.5% Nonidet P-40, 5% sodium deoxycholate, 50 µM NaCl, 10 µM Tris-HCl, pH 7.5, 1% bovine serum albumin) and centrifuged at 4°C and 18,407 × g for 15 min. The supernatant was mixed with 2X loading buffer and boiled for 5 min, and then the samples were separated via 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% fat-free milk at room temperature for 1 h, incubated at 4°C overnight with antibodies S12 for LMP1 (1:50), anti-β-actin (1:10,000; cat. no. A1978; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), anti-G protein (1:500; cat. no. 371818; Sigma-Aldrich; Merck KGaA) and anti-heterogeneous nuclear ribonucleoprotein A/B (1:500; cat. no. sc-376411; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), washed, and then incubated with peroxidase-conjugated secondary antibody (1:2,000; cat. no. sc-11001; Santa Cruz Biotechnology, Inc.). Immune complexes were detected using an Amersham ECL Western Blotting Detection kit (Amersham Pharmacia Biotech, Little Chalfont, UK) and gel imaging analysis (Cool Imager; Viagene Biotech, Inc). To confirm the expression levels of each protein examined in LMP1-transfected cells, western blotting for each protein was performed in triplicate.
The gene expression of the differential proteins was quantitated by RT-qPCR using Roche Light Cycler system (Roche Diagnostics GmbH, Mannheim, Germany) and SYBR premix Ex Taq kit (Takara Bio, Inc., Otsu, Japan). The expression levels of β-actin served as an internal control. Total cellular RNA was isolated from NP69-LMPlWT and NP69-LMPlΔ232-351 cells using TRIzol® (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA integrity was observed by electrophoresis with 1% agarose gel containing ethidium bromide. A total of 2 µg DNase-treated RNA underwent RT to produce cDNA and 1 µl RT product was used to amplify gene fragments. First-strand cDNA was synthesized from DNase-treated total RNA with oligo-dT primer and Super-Script II reverse transcriptase (Takara Bio, Inc.) for 60 min at 42°C and 10 min at 72°C, followed by qPCR amplification using the corresponding specific primers (Table I). The qPCR cycling conditions were as follows: 95°C for 3 min followed by 50 cycles of 95°C for 30 sec, 62°C (ribosomal protein P0 and isocitrate dehydrogenase 3) or 65°C (annexin A2, heterogeneous nuclear ribonucleoprotein A/B and G protein) for 30 sec, and then 72°C for 30–40 sec. The relative fold change method (8) was used to determine the relative quantitative gene expression for each gene studied compared with the β-actin control. The relative fold change or relative gene expression value 2−ΔΔCq, where ΔΔCq=[(CqTarget[LMPWT 1] - Cqβ-actin [LMP1WT]) - (CqTarget[LMP1Δ232-351] - Cqβ-actin [LMP1Δ232-351])]. CqTarget [LMPWT] = quantification cycle of the target gene examined in the LMP1-expressing cells; Cqβ-actin[LMPWT] = quantification cycle of the β-actin gene in the LMP1-expressing cells; CqTarget [LMP1Δ232-351] = quantification cycle of the target gene examined in the LMP1Δ232-351-expressing cells; and Cqβ-actin [LMP1Δ232-351] = quantification cycle of the β-actin gene in the LMP1Δ232-351-expressing cells. RT-qPCR analyses independently were performed in triplicate.
For each transfection, 293 cells were seeded into 6-well dishes at 1×105 cells/well. The indicated amounts (500, 150, 300, 450 or 600 ng/well) of pLNSX, pLNSX-LMP1 or pLNSX-LMP1Δ232-351 plasmids were co-transfected with β-gal (200 ng/well) and reporter plasmids (200 ng/well) of NF-κB, AP-1 or JAK3, respectively. Vector pLNSX was supplemented to a total amount of 1 µg DNA for every well. Transfection was conducted with transfection reagent Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Cell lysates were collected 24 h later and were examined with a luciferase assay system (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol, to obtain the relative activities of the promoter. Relative LUC values were calculated as the ratio of LUC vs. β-galactosidase activity. A total of three independent experiments were performed, and each experiment was performed in triplicate.
Data are presented as the mean ± standard deviation for ≥3 separate experiments. Statistical analyses were carried out with SPSS (version 10.01; SPSS, Inc., Chicago, IL, USA). Statistical analysis was performed using a Student's t-test or one-way analysis of variance followed by the Tukey multiple comparison test. P<0.05 was considered to indicate a statistically significant difference.
To investigate the role of the CTAR3 binding site in LMP1-mediated JAK3 signaling, mutant LMP1Δ232-351, LMP1 with amino acid residue deletion from 232 to 351, was constructed as described, and a JAK3 promoter reporter system was generated using qPCR. The construction of these plasmids was confirmed by enzyme digestion and agarose gel electrophoresis (Fig. 1). The resultant sequence was fully verified by sequencing (data not shown).
In the present study, the two cell lines, NP69-LMP1WT and NP69-LMP1Δ232-351 (Fig. 2A) were established. Then, the expression levels of LMP1 in NP69-LMP1WT and NP69-LMP1Δ232-351 cells were detected by immunofluorescence with antibody against LMP1 S12 (Fig. 2B). In addition, the growth curves of NP69-LMP1WT and NP69-LMP1Δ232-351 (n=3, P<0.05; Fig. 2C) were examined. NP69-LMP1WT cells exhibited a relatively faster growth rate with ~7–8 population doublings by day 8 compared with in control (NP69-pLNSX) cells. Conversely, NP69-LMP1Δ232-351 cells only exhibited a growth rate of ~4–5 population doublings by day 8 (P<0.05 vs. NP69-LMP1WT). The anchorage-independent growth ability of NP69-LMP1WT and NP69-LMP1Δ232-351 cells was also compared. LMP1WT and LMP1Δ232-351 expression induced anchorage-independent growth in NP69 cells; however, the cloning efficiency of NP69-LMP1WT cells (256±14 clones) was ~3-fold higher than that of the NP69-LMP1Δ232-351 cells (88±7 clones; n=3, P<0.05; Table II). In addition to the difference in cloning efficiency, there was a marked difference in size and morphology of the soft agar clones between NP69-LMP1WT and NP69-LMP1Δ232-351 cells. The NP69-LMP1WT soft agar clones were larger, less compact in organization and more irregular in shape, while the NP69-LMP1Δ232-351 clones were smaller, closely packed and round in shape (Fig. 2D). These results suggested that the CTAR3 of LMP1 has an important role on the proliferation and growth of NP69 cells.
In the present study, two reproducible 2D gels for each transduced NP69 cell line were obtained. In the pH range 3–10, there were 1,088±43 and 1,142±46 protein spots observed in NP69-LMP1WT and NP69-LMP1Δ232-351, respectively. For the matched counter-spots, the same position of spots was identified in the two images, which greatly facilitated the following comparison, as presented in magnified views of the 2D gel map. These differential protein spots were marked with arrows (Fig. 3A). Magnified regions of the gels revealed differential expression proteins (Fig. 3B). The quantification of the protein spots, analyzed by PDQuest software, revealed that some protein spots exhibited variable expression levels in the two cell lines, as indicated by staining intensities. A total of 17 protein spots exhibited >2-fold change in NP69-LMP1Δ232-351-expressing cells compared with NP69-LMP1WT-transduced cells.
Following spot excising and tryptic digestion, identification of the protein of interest was performed using MALDI-TOF MS. The expectation value for proteins was determined via PMF by using the MASCOT program. The 17 differential protein spots between NP69-LMP1WT and NP69-LMP1Δ232-351 were identified with details summarized in Table III; 8 upregulated and 9 downregulated proteins were associated with structural proteins, metabolic enzymes, repair of DNA damage, energy and electron transport, transcription and translation, molecular chaperone, immunoregulation and calcium-binding, according to UNIPROT and NCBI database.
Table III.Identified differential protein spots between NP69-LMP1Δ232-351 and NP69-LMP1WT cell lines. |
The mRNA expression levels of differentially expressed proteins were confirmed by RT-qPCR analysis (data not shown). The results of RT-qPCR analysis coincided with the data of the 2D gel. Within NP69-LMP1WT-transduced cells, the mRNA expression levels of ribosomal protein P0 and heterogeneous nuclear ribonucleoprotein A/B were increased by 5.31- and 6.45-fold, respectively (Table IV), compared with NP69-LMP1Δ232-351. Two proteins, heterogeneous nuclear ribonucleoprotein A/B (greatest fold change increase) and G protein (2.07-fold change) were selected from the list of differentially expressed proteins for validation by western blotting, which reflected a similar pattern of expression to those observed in the IPG-2D gel analysis. Compared with NP69-LMP1Δ232-351, NP69-LMP1WT exhibited a significant increase in heterogeneous nuclear ribonucleoprotein A/B and decrease of G protein (n=3; P<0.05; Fig. 4). These results validated the expression pattern of proteins identified from the 2D gel analysis.
Table IV.Relative mRNA expression level in cancer-associated proteins differentially expressed between NP69-LMP1WT and NP69-LMP1Δ232-351 cell lines. |
To investigate the mechanism by which LMP1 may regulate the JAK3 signaling pathway, the NF-κB, AP-1 or JAK3 luciferase reporters were co-transfected with wild type LMP1 or mutant LMP1Δ232-351 plasmid into 293 cells. The results demonstrated that the ability of mutant LMP1Δ232-351 in inducing transcriptional activity of NF-κB or AP-1 LUC reporter plasmids was similar to wild type LMP1 (Fig. 5A and B). Additionally, the transcriptional activity of the JAK3 promoter was upregulated by wild type LMP1, and the extent of upregulation was associated with the concentration of wild type LMP1; however, mutant LMP1Δ232-351 was almost defective in activation of JAK3 reporter transcription (Fig. 5C). The results of the present study suggested that LMP1 may participate in the activation of the JAK3 signaling pathway, associated with JAK3 promoter activation via LMP1. Therefore, the results indicated that the CTAR3 of LMP1 may be a key domain required for activating the JAK3 promoter.
EBV is a highly prevalent g herpes virus associated with NPC and Burkett's lymphoma, and LMP1 was known generally for critical oncogenic protein coded by EBV genome (1,9,10). The studies that verified the expression of LMP1 in the majority of NPC tissues suggested that LMP1 may be closely associated with NPC genesis and invasion; however, further investigation is required (11,12). Tsao et al and Lo et al established the NP69 normal immortalization nasopharyngeal epithelium cell line in vitro, and reported that the cell generated a serial malignant phenotype when a LMP1 eukaryotic expression vector was introduced into the NP69 cell line (13,14). Gires et al (7) first reported the CTAR3 of LMP1 and confirmed the region was associated with the JAK3/signal transducer and activator of transcription (STAT) signaling pathway; however, its function in epithelial cells requires further analysis. To further investigate the functional activity of LMP1-CTAR3, a retrovirus was used to establish an NP69 cell line with stable expression of mutant LMP1Δ232-351 and wild type LMP1WT, respectively named NP69-LMP1Δ232-351 and NP69-LMP1WT cells in the present study. Subsequently, the biological properties of transfected NP69 cells were observed. Collectively, the results of the present study supported the findings of Tsao et al (13), which demonstrated that LMP1 promoted NP69 cell proliferation and transformation, increased cell growth velocity and increased multiple clone formation.
Previously, numerous studies reported the role of LMP1 transforming animal, human fibroblasts and some immortalization epithelial cells (14–16). In the present study, the results further supported the hypothesis that LMP1 may be associated with several malignancies of epithelium origin, such as NPC. In the current study, the ability of mutant LMP1Δ232-351 to promote proliferation was notably reduced compared with LMP1WT. These results suggested that CTAR3 may participate in the regulation of LMP1 associated with cell proliferation; however, whether CTAR3 is involved in JAK3/STAT3 signaling pathway requires further investigation. It has been reported that the phosphorylation of JAK3 mediates the regulation of cell proliferation (17). Therefore, LMP1-CTAR3 may activate the JAK3/STAT signaling pathway in nasopharynx epithelial cells.
Studies have reported on the role of LMP1 in the promotion of cell transformation (18,19), however to elucidate the underlying mechanism will require further research. In addition, the signaling pathway of interest, in particular the function and feature of CTAR3, lacked unified recognition and conclusion. In the present study, the protein molecule network associated with wild type LMP1WT and mutant LMP1Δ232-351 transformed NP69 cells were investigated by proteomic analysis. The results of the present study revealed that 17 proteins were variably expressed in NP69-LMP1Δ232-351-transduced cells compared with NP69-LMP1WT-transduced cells. These results may provide notable information and insight for further research. Additionally, these differential proteins were associated with cellular metabolism, signal conduction, molecular chaperones, cellular structure, immunoregulation, transcription and translation, energy and electron, molecular chaperone, as reported in the present study. Furthermore, proteins were mainly located in the endochylema, cytochondriome, endoplasmic reticulum, nucleus and cell membrane. To investigate the expression levels of differential proteins, several proteins were analyzed by western blotting and RT-qPCR. The results were similar with outcomes identified by proteomics methods in the present study (Table III and IV).
G protein, namely guanosine 5′-triphosphate-binding protein, is an important protein associated with the regulation of cellular signal transduction. Zhou et al (20) demonstrated that G protein phosphorylation and modification accelerated cellular apoptosis. In the present study, compared with NP69-LMP1WT, the expression levels of G protein were significantly increased within NP69-LMP1Δ232-351 cells. Therefore, LMP1 may downregulate the expression of G proteins to induce minor activating proteins involved in apoptosis of NP69-LMP1WT cells. Hence, LMP1 may mediate cell proliferation associated with the expression of G proteins.
Heterogeneous nuclear ribonucleoprotein (hnRNP) was first described as a family of proteins that bind RNA polymerase II and is transcribed to form hnRNP particles. The hnRNP A/B proteins are among the most abundant RNA-binding proteins, forming the core of the ribonucleoprotein complex that connects with nascent transcripts in eukaryotic cells. They also recruit regulatory proteins connected with pathways related to DNA and RNA metabolism (21). He et al (22). have shown that hnRNP A/B proteins are dysregulated in a large number of epithelial cancer cells In the present study, compared with NP69-LMP1WT, the expression levels of G protein were significantly decreased within NP69-LMP1Δ232-351 cells. This suggests that LMP1 may upregulate the expression of G proteins to induce activation of proteins involved in the proliferation of NP69-LMP1WT cells.
Isocitrate dehydrogenase is a rate-limiting enzyme of the tricarboxylic acid cycle and a key enzyme of cell energy metabolism, cell growth and proliferation (23). In the present study, the expression of isocitrate dehydrogenase was higher in NP69-LMP1WT than that in NP69-LMP1Δ232-351. The cell growth and proliferation of NP69-LMP1WT was faster than NP69-LMP1Δ232-351. The results of the present study suggest that LMP1-CTAR3 may mediate the regulation of isocitrate dehydrogenase expression, and affect cell metabolism and synthesis, which serves an important role in promoting cell proliferation and transformation (24).
Collectively, the findings of the present study suggested that LMP1 serves an important role in the transformation and proliferation of nasopharyngeal epithelial cells. The data of differential proteins was reported and 17 differential proteins were identified between NP69-LMP1WT and NP69-LMP1Δ232-351-transduced cells. These differential proteins, associated with LMP1 and the domain of CTAR3, may be involved in the regulation of cell proliferation and transformation of nasopharynx epithelial cells. The findings provide novel insight for further NPC research and may be valuable for investigating the mechanism of LMP1-associated tumors. However, how LMPI and its CTAR3 active region regulate the expression of these differential proteins, as well as the mechanisms by which these differentially expressed proteins promote epithelial cell growth, proliferation and transformation, requires further investigation.
The authors would like to thank Dr Sai Wah Tsao (University of Hong Kong, Hong Kong, SAR, China) for NP69 cell lines.
The present study was supported by the Hunan Provincial Innovation Foundation For Postgraduate (grant no. CX2016B478), National Natural Science Foundation of China (grant no. 30470668) and Health Department Scientific Research Foundation of Hunan Province (grant no. B2006-100).
All data generated or analyzed during this study are included in this published article.
ZWZ and HLZ performed the majority of the experiments in this work. YHY, ZCC and YMO performed research and analyzed the data. ZWZ, HLZ and ZMH wrote the manuscript. XSH and ZMH conceived the experimental design, were responsible for financial support and wrote the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Thompson MP and Kurzrock R: Epstein-Barr virus and cancer. Clin Cancer Res. 10:803–821. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Ma SD, Tsai MH, Romero-Masters JC, Ranheim EA, Huebner SM, Bristol JA, Delecluse HJ and Kenney SC: Latent membrane protein 1 (LMP1) and LMP2A collaborate to promote Epstein-Barr virus-induced B cell lymphomas in a cord blood-humanized mouse model but are not essential. J Virol. 91:e01928–16. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Pandya J and Walling DM: Oncogenic activity of Epstein-Barr virus latent membrane protein 1 (LMP-1) is down-regulated by lytic LMP-1. J Virol. 80:8038–8046. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Lavorgna A and Harhaj EW: EBV LMP1: New and shared pathways to NF-kB activation. Proc Natl Acad Sci USA. 109:2188–2189. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Ikeda O, Miyasaka Y, Yoshida R, Mizushima A, Oritani K, Sekine Y, Kuroda M, Yasui T, Fujimuro M, Muromoto R, et al: BS69 cooperates with TRAF3 in the regulation of Epstein-Barr virus-derived LMP1/CTAR1-induced NF-kappaB activation. FEBS Lett. 584:865–872. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Shkoda A, Town JA, Griese J, Romio M, Sarioglu H, Knöfel T, Giehler F and Kieser A: The germinal center kinase TNIK is required for canonical NF-κB and JNK signaling in B-cells by the EBV oncoprotein LMP1 and the CD40 receptor. PLoS Biol. 10:e10013762012. View Article : Google Scholar : PubMed/NCBI | |
|
Gires O, Kohlhuber F, Kilger E, Baumann M, Kieser A, Kaiser C, Zeidler R, Scheffer B, Ueffing M and Hammerschmidt W: Latent membrane protein 1 of Epstein-Barr virus interacts with JAK3 and activates STAT proteins. EMBO J. 18:3064–3073. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Farrell PJ: Epstein-Barr virus and cancer. Annu Rev Pathol. 14:29–53. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Kilger E, Kieser A, Baumann M and Hammerschmidt W: Epstein-Barr virus-mediated B-cell proliferation is dependent upon latent membrane protein 1, which simulates an activated CD40 receptor. EMBO J. 17:1700–1709. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Shair KH, Schnegg CI and Raab-Traub N: EBV latent membrane protein 1 effects on plakoglobin, cell growth, and migration. Cancer Res. 68:6997–7005. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Tu C, Zeng Z, Qi P, Li X, Guo C, Xiong F, Xiang B, Zhou M, Liao Q, Yu J, et al: Identification of genomic alterations in nasopharyngeal carcinoma and nasopharyngeal carcinoma-derived Epstein-Barr virus by whole-genome sequencing. Carcinogenesis. 39:1517–1528. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Tsao SW, Wang X, Liu Y, Cheung YC, Feng H, Zheng Z, Wong N, Yuen PW, Lo AK, Wong YC and Huang DP: Establishment of two immortalized nasopharyngeal epithelial cell lines using SV40 large T and HPV16E6/E7 viral oncogenes. Biochim Biophys Acta. 1590:150–158. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Lo AK, Liu Y, Wang XH, Huang DP, Yuen PW, Wong YC and Tsao GS: Alterations of biologic properties and gene expression in nasopharyngeal epithelial cells by the Epstein-Barr virus-encoded latent membrane protein 1. Lab Invest. 83:697–709. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Ahsan N, Kanda T, Nagashima K and Takada K: Epstein-Barr virus transforming protein LMP1 plays a critical role in virus production. J Virol. 79:4415–4424. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Xin B, He Z, Yang X, Chan CP, Ng MH and Cao L: TRADD domain of Epstein-Barr virus transforming protein LMP1 is essential for inducing immortalization and suppressing senescence of primary rodent fibroblasts. J Virol. 75:3010–3015. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Gallardo-Vera F, Diaz D, Tapia-Rodriguez M, Fortoul van der Goes T, Masso F, Rendon-Huerta E and Montaño LF: Vanadium pentoxide prevents NK-92MI cell proliferation and IFNg secretion through sustained JAK3 phosphorylation. J Immunotoxicol. 13:27–37. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Smirnova KV, Diduk SV, Senyuta NB and Gurtsevitch VE: Molecular biological properties of the Epstein-Barr virus LMP1 gene: Structure, function and polymorphism. Vopr Virusol. 60:5–13. 2015.(In Russian). PubMed/NCBI | |
|
Uchida J, Yasui T, Takaoka-Shichijo Y, Muraoka M, Kulwichit W, Raab-Traub N and Kikutani H: Mimicry of CD40 signals by Epstein-Barr virus LMP1 in B lymphocyte responses. Science. 286:300–303. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou C, Dai X, Chen Y, Shen Y, Lei S, Xiao T, Bartfai T, Ding J and Wang MW: G protein-coupled receptor GPR160 is associated with apoptosis and cell cycle arrest of prostate cancer cells. Oncotarget. 7:12823–12839. 2016.PubMed/NCBI | |
|
He Y and Smith R: Nuclear functions of heterogeneous nuclear ribonucleoproteins A/B. Cell Mol Life Sci. 66:1239–1256. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
He Y, Brown MA, Rothnagel JA, Saunders NA and Smith R: Roles of heterogeneous nuclear ribonucleoproteins A and B in cell proliferation. J Cell Sci. 118:3173–3183. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Lu HC, Ma J, Zhuang Z, Qiu F, Cheng HL and Shi JX: Exploring the regulatory role of isocitrate dehydrogenase mutant protein on glioma stem cell proliferation. Eur Rev Med Pharmacol Sci. 20:3378–3384. 2016.PubMed/NCBI | |
|
Bentz GL, Whitehurst CB and Pagano JS: Epstein-Barr virus latent membrane protein 1 (LMP1) C-terminal-activating region 3 contributes to LMP1-mediated cellular migration via its interaction with Ubc9. J Virol. 85:10144–10153. 2011. View Article : Google Scholar : PubMed/NCBI |