Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2020 Volume 21 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2020 Volume 21 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels

Retraction in: /10.3892/mmr.2023.13045
  • Authors:
    • Fei Guo
    • Jun Xue
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The First Affiliated Hospital of Hebei North University, Zhangjiakou, Hebei 075061, P.R. China
    Copyright: © Guo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1481-1490
    |
    Published online on: January 16, 2020
       https://doi.org/10.3892/mmr.2020.10945
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNA (miR)‑628‑5p serves as an antitumor gene in a variety of cancers; however, the role of miR‑628‑5p in colorectal cancer remains largely unclear. The purpose of this study was to investigate the role and mechanism of miR‑628‑5p in colorectal cancer. Reverse transcription‑quantitative PCR (RT‑qPCR), colony formation assays and flow cytometric analysis were used to determine the expression levels of miR‑628‑5p in colorectal cancer tissues and cell lines, and the proliferative ability of colorectal cancer cells. TargetScan version 7.2 and dual‑luciferase reporter assay were performed to predict and confirm miR‑628‑5p target genes. The expression levels of cyclin D1 (CCND1) and related genes were determined using RT‑qPCR or/and western blotting analysis. miR‑628‑5p mimics and CCND1 plasmids were used to overexpress miR‑628‑5p and CCND1; it was demonstrated that the expression levels of miR‑628‑5p were significantly downregulated in colorectal cancer tissues and cell lines. miR‑628‑5p mimic‑transfected cells inhibited the proliferation and induced apoptosis of HT‑29 cells. CCND1, a downstream effector of miR‑628‑5p, promoted the proliferation and suppressed apoptosis of HT‑29 cells, and the effects were reversed by miR‑628‑5p mimics. In conclusion, the present study suggested that colorectal cancer progression may be regulated through the miR‑628‑5p/CCND1 axis, and miR‑628‑5p could be used as a potential diagnostic and prognostic biomarker for colorectal cancer.

Introduction

Colorectal cancer is a digestive tract tumor that occurs in the colon, and its incidence is gradually increasing: In 2015, colorectal cancer was one of the most frequent tumors diagnosed in China, which severely impacted the health of Chinese patients (1). Colorectal cancer is the third most frequent cancer in men, and is the second most frequent cancer in women after breast cancer; it represents approximately 9% of deaths by cancer (2). There are many risk factors for colorectal cancer, including smoking, physical inactivity, being overweight and obesity, dietary patterns, drinking alcohol excessively and genetic and epigenetic factors (3–6). Earlystage colorectal cancer is confined to the mucosal layer or submucosa, and has a high curability rate, with >80% patients demonstrating a 5-year survival rate; however, a lower 5-year survival rate of <50% occurs in patients with later-stage colorectal cancer due to local lymph node metastasis and distant organ invasion (7). For patients with advanced colorectal cancer, tumor resection is not feasible, and chemotherapy and biotherapy have become the only treatment strategies (8). However, due to the development of chemotherapeutic resistance in cancer patients, these treatments are mostly ineffective.

MicroRNAs (miRNAs) are small-molecule, non-coding single-stranded RNAs of ~22 nucleotides in length that are encoded by an endogenous gene, and are mainly involved in the post-transcriptional regulation of gene expression (9). miRNAs directly bind to target genes through recognizing a complementary sequence in the 3′-untranslated region (3′-UTR) end of the target gene to downregulate the expression of the target gene and regulate the related signaling pathways (10). Previous studies have demonstrated that miRNAs serve an important role in the development of tumors; the aberrant overexpression or downregulation of multiple miRNAs are often detected in a variety of tumors, suggesting that miRNAs have different roles in different processes, such as tumor occurrence, development and metastasis (11,12). Previous studies have reported the abnormal expression of miRNA (miR)-628 in numerous malignant tumor tissues (13,14); however, there are few studies observing the effects of miR-628 in colorectal cancer.

Cyclins are widely distributed in eukaryotic cells and, among them, CCND1, encoding cyclin D1, is a highly conserved cell cycle family protein (15,16). Through responding to growth factor signaling, cyclin D1 promotes the cell cycle transition from the G1 to S phase, thus regulating cell cycle progression (17–19). In addition, having been identified as a proto-oncogene, the abnormal expression of cyclin D1 promotes cell colonization through regulating the cell cycle and arresting cells during synthesis (20). In colorectal cancer, bladder cancer, reproductive system tumors, gastric cancer and lung cancer, the expression levels of CCND1 were significantly higher compared with adjacent normal tissues, and were related to the pathological type and clinical stage of the tumor (21–24). In addition, previous studies demonstrated that the overexpression of CCND1 promoted cell invasion and migration in multiple tumors, such as breast cancer and gastric cancer, leading to a poor prognosis (25,26). A number of studies have reported that PAC and RAC1 may be involved in the development of colon cancer by targeting or regulating the expression of cyclin D1 (27,28). It has been reported that miR-365 inhibited cell cycle progression and promoted apoptosis of colon cancer cells by targeting cyclin D1 and Bcl-2 (29). Diospyros kaki Thunb (persimmon) may downregulate cyclin D1 as one of the potential anticancer targets via inducing proteasomal degradation and transcriptional inhibition in human colorectal cancer cells (30). A study reported that miR-519d reduces the 5-fluorouracil resistance in colorectal cancer cells by downregulating the expression of CCND1 (31).

The present study aimed to investigate the miR-628-5p expression profile in colorectal cancer and the regulatory mechanisms of miR-628-5p underlying colorectal cancer progression to help provide novel, effective treatment options for patients with colorectal cancer.

Materials and methods

Patient studies

The present study was approved by The First Affiliated Hospital of Hebei North University Ethics Committee (Zhangjiakou, China). Informed, written consent for the use of tissue for clinical research was obtained from all patients. A total of 30 patients with colorectal cancer (16 males, 14 females; age range, 28–64 years old) were recruited in The First Affiliated Hospital of Hebei North University between August 2017 to February 2018 for inclusion in the current study. Then, 30 surgically resected tissue specimens of primary colorectal cancer, confirmed by pathological examination, and corresponding paracancerous tissues (>5 cm obtained from the edge of the lump) were collected from The First Affiliated Hospital of Hebei North University. None of the patients received radiotherapy or chemotherapy prior to surgery.

Cell culture and reagents

Normal human colonic epithelial cells (FHC cells) and human colorectal cancer cell lines (SW480, SW620, HT-29, NCI-H508 and HCT15) were purchased from the American Type Culture Collection. Cells were cultured in DMEM (GE Healthcare BioSciences), supplemented with 10% FBS (GE Healthcare Bio-Sciences) and 1% streptomycin, the cells were incubated in a humidified 5% CO2 atmosphere at 37°C in an incubator for 72 h.

Cell transfection

A total of 40 pmol miR-628-5p mimic (Shanghai GenePharma Co., Ltd., 5′-AUGCUGACAUAUUUACUAGAGG-3′), mimic control (Shanghai GenePharma Co., Ltd., 5′-UUUGUACUACACAAAAGUACUG-3′), overexpressed CCND1 (Shanghai GeneChem Co., Ltd., 5′-AAAACAUAGAAAAAUUCAGCAA-3′) and their respective negative controls (NC; Shanghai GenePharma Co., Ltd., 5′-CAUGUGGUCUGUCGCAUAAUA-3′) were mixed in 50 µl serum-free medium, and 2 µl Lipofectamine® 3000 reagent (Thermo Fisher Scientific, Inc.) was used to transfect HT-29 cells (2×105 cells/well), according to the manufacturer's protocol. Cells were subsequently incubated at room temperature for 15 min. The lipid compounds were diluted in 300 µl serum-free medium and 600 µl medium containing FBS to produce a 1 ml mixture, and incubated with the cells in a humidified atmosphere at 37°C and 5% CO2 for subsequent experiments.

Cell Counting Kit (CCK)-8 assay

CCK-8 (Beyotime Institute of Biotechnology, C0038) was used to measure the cell viability according to the manufacturer's protocol. A total of 2×104 HT-29 cells/well in the exponential growth phase were plated into 96-well plates. Following 24, 48 or 72 h of transfection, 10 µl CCK-8 solution was added to each well, and cells were subsequently cultured at 37°C for 2 h. The optical density was measured at 450 nm using a Tecan Infinite M200 microplate reader to determine cell viability.

Colony formation assay

Following 24 h of transfection, a total of 800 HT-29 cells were plated into 6-well plates, with 3 replicate wells/treatment group. The cells were cultured in an incubator at 37°C with 5% CO2 for 2 weeks; the culture solution was changed every two days. Subsequently, the medium was aspirated and cells were fixed through the addition of 500 µl/well methanol solution for 15 min at room temperature. Methanol was discarded, and 1 ml 0.1% crystal violet dye solution (cat. no. C0121; Beyotime Institute of Biotechnology) was added to each well to stain the cells for 20 min at room temperature. Stained cells were visualized using an enzyme-linked spot image automatic analyzer (magnification, ×1).

Flow cytometric analysis of apoptosis

HT-29 cells (2×104 cells/well) were digested with 0.25% trypsin without EDTA (Gibco; Thermo Fisher Scientific, Inc.) and neutralized with 2% BSA solution (Sigma-Aldrich; Merck KGaA), and a total of 2×105 cells were collected into a 1.5 ml Eppendorf tube. Cells were collected by centrifugation (2,000 × g; 4°C) for 10 min and the supernatant was discarded. Cells were washed twice with pre-cooled PBS. The cells were subsequently stained with Annexin V-FITC and propidium iodide (PI) using the Annexin V-FITC Apoptosis Detection kit (cat. no K201-100; BioVision, Inc.), according to the manufacturer's protocol. Briefly, 500 µl 1X binding buffer and 5 µl Annexin V-FITC were added to the cell suspension and cells were incubated at 4°C for 30 min in the dark. PI (5 µl) was added and incubated at room temperature for 5 min. Apoptotic cells were subsequently analyzed using a flow cytometry and FlowJo software (version 10.0; FlowJo LLC).

Bioinformatics

TargetScan 7.2 software (http://www.targetscan.org/vert_72/) was used to predict target genes and potential binding sites for miRNAs.

Dual-luciferase reporter assay

Wild-type CCND1 3′-untranslated region (3′-UTR; CCND1-WT) and mutated CCND1 3′-UTR (CCND1-mut) were cloned into the pMIR-REPORT luciferase vector (Ambion; Thermo Fisher Scientific, Inc.). 293T cells (2×105 cells/well) were seeded in 6-well plates and transfected with cyclin D1-WT or cyclin D1-Mut using Lipofectamine® 3000 reagent (Thermo Fisher Scientific, Inc.) for 24 h. Following incubation, cells were collected and luciferase activity was detected using a Dual-Luciferase Reporter 1000 assay system (Promega Corporation), according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from HT-29 cells (2×105 cells/well in 6-well plates) using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The concentration and purity of RNA was determined using a NanoDrop™ 2000 spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). A total of 1 µg RNA was reverse-transcribed into cDNA using an RT cDNA kit (Thermo Fisher Scientific, Inc.) at 42°C for 60 min and 70°C for 5 min, and was subsequently maintained at 4°C. qPCR was subsequently performed using the SYBR® Green PCR Master mix (Roche Diagnostics) and the ABI 7500 RT-PCR Detection system (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The primer pairs used for the qPCR are presented in Table I. The following thermocycling conditions were used for the qPCR: Initial denaturation at 95°C for 10 min, followed by 40 cycles at 94°C for 15 sec (denaturation), 60°C for 1 min (annealing), and 60°C for 1 min (elongation), with a final extension at 72°C for 10 min, followed by being maintained at 4°C. Expression levels were quantified using the 2ΔΔCq method (32), and mRNA expression was normalized to the internal reference gene GAPDH, whereas miR-628-5p expression was normalized to U6.

Table I.

Primers for reverse transcriptionquantitative PCR.

Table I.

Primers for reverse transcriptionquantitative PCR.

GenePrimer sequence (5′→3′)
microRNA26a5pF: GGGGGATGCTGACATATTTAC
R: CAGTGCGTGTCGTGGAGT
CCND1F: TATTGCGCTGCTACCGTTGA
R: CCAATAGCAGCAAACAATGTGAAA
GAPDHF: AGAAGGCTGGGGCTCATTTG
R: AGGGGCCATCCACAGTCTTC
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT

[i] F, forward; R, reverse; CCND1, cyclin D1.

Western blotting

HT-29 cells (2×106 cells) were washed three times with pre-cooled PBS, suspended in 1 ml PBS and transferred to a 1.5 ml Eppendorf tube. Cells were subsequently centrifuged (1,000 × g; 4°C; 5 min), the supernatant was discarded, and total protein was extracted using 200 µl RIPA assay buffer (Beyotime Institute of Biotechnology). Cells were centrifuged (4°C; 5 min), total protein was quantified using a bicinchoninic acid assay kit (Pierce; Thermo Fisher Scientific, Inc.), and 30 µg protein/lane was separated via SDS-PAGE on a 10% gel. The separated proteins were subsequently transferred onto a PVDF membrane and blocked for 1 h at 37°C with 5% BSA solution (Sigma-Aldrich; Merck KGaA). The membranes were incubated with the following primary antibodies in 5% BSA overnight at 4°C: Rabbit anti-cyclin D1 (34 kDa; 1:1,000; cat. no. ab134175; Abcam), rabbit anti-Ki67 (359 kDa; 1:1,000; cat. no. ab16667; Abcam), rabbit anti-cleaved-caspase-3 (17 kDa; 1:1,000; cat. no. ab2302; Abcam), rabbit anti-Bax (21 kDa; 1:1,000; cat. no. ab32503; Abcam), rabbit anti-Bcl-2 (26 kDa; 1:1,000; cat. no. ab32124; Abcam) and mouse anti-β-actin antibody (42 kDa; 1:1,000; cat. no. ab8226; Abcam). Following the primary antibody incubation, membranes were incubated at room temperature for 2 h with a horseradish peroxidase (HRP)-conjugated secondary antibodies (mouse anti-rabbit IgG-HRP, 1:5,000; cat. nos. sc-516102/sc-2357; Santa Cruz Biotechnology, Inc.) diluted in 5% BSA. Protein bands were visualized by adding ECL coloring solution to the PVDF membrane and captured using ImageJ software (version 1.46; National Institutes of Health). Protein expression was quantified using Quantity One software (version 4.62; Bio-Rad Laboratories, Inc.), with β-actin as the loading control.

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 7.0 software (GraphPad Software, Inc.) and all data are presented as the mean ± SD from three independent experimental repeats. Statistical differences between groups were determined using one-way ANOVA followed by the Bonferroni's correction post hoc test for multiple comparisons. The Student's t-test was used to compare the difference between two groups (Fig. 1A). P<0.05 was considered to indicate a statistically significant difference.

Figure 1.

miR-6285-p expression levels are decreased in colorectal cancer in vivo and in vitro. (A and B) The expression levels of miR-628-5p were detected using reverse transcription-quantitative PCR in (A) colorectal cancer tissues and (B) colorectal cancer cell lines. **P<0.01 vs. adjacent tissue or FHC group. miR, microRNA.

Results

miR-628-5p expression levels are decreased in colorectal cancer in vivo and in vitro

To determine the role of miR-628-5p in human colorectal cancer, the expression levels of miR-628-5p in patients with colorectal cancer and common colorectal cancer cell lines were determined compared with adjacent benign tissue samples and normal colorectal cells, respectively. miR-628-5p expression levels were significantly decreased in the colorectal cancer samples compared with the normal colorectal tissue samples (P<0.01; Fig. 1A). Similarly, miR-628-5p expression levels were significantly decreased in all colorectal cancer cell lines (SW480, SW620, HT-29, NCI-H508 and HCT15) compared with the normal cell line, FHC (P<0.01; Fig. 1B). Due to miR-628-5p expression being the most significantly reduced in HT-29 cells, HT-29 cells were used in the subsequent experiments.

Overexpression of miR-628-5p suppresses proliferation and induces apoptosis of HT-29 cells

HT-29 cells were stably transfected with miR-628-5p mimics or mimic controls and the viability, proliferative and apoptotic abilities of HT-29 cells were determined using the CCK-8 assay, colony formation assay and flow cytometric analysis. HT-29 cells were successfully transfected with the miR-628-5p mimic; miR-628-5p mimic-transfected cells demonstrated significantly increased miR-628-5p expression levels compared with the mimic control and control group (P<0.01; Fig. 2A). Cell viability was significantly reduced in HT-29 cells transfected with miR-628-5p mimics compared with the mimic control and control group at 24, 48 and 72 h (Fig. 2B). Similar results were obtained in the colony formation assay: The proliferation of HT-29 cells was significantly suppressed when transfected with the miR-628-5p mimic compared with the mimic control and control group (P<0.01; Fig. 2C and D). Moreover, flow cytometric analysis revealed that HT-29 cells transfected with miR-628-5p mimics demonstrated significantly higher rates of apoptosis compared with the mimic control and control groups (P<0.01; Fig. 2E and F).

Figure 2.

miR-628-5p mimics suppress the proliferation and induce apoptosis of HT-29 cells. (A) Transfection efficiency of miR-628-5p mimics and its mimic control were confirmed using reverse transcriptionquantitative PCR. U6 served as an internal reference gene for miR-628-5p expression. (B) HT-29 cell viability was determined using the Cell Counting kit-8 in HT-29 cells transfected with miR-628-5p mimics or its mimic control. (C and D) HT-29 cell proliferation following transfection with miR-628-5p mimics or mimic control was (C) analyzed and (D) semi-quantified using a colony formation assay (magnification, ×1). (E and F) Apoptosis of HT-29 cells following transfection with miR-628-5p mimics or mimic control was (E) analyzed and (F) semi-quantified using flow cytometric analysis. *P<0.05, **P<0.01 vs. control group, #P<0.05, ##P<0.01 vs. mimic control group. miR, microRNA; PI, propidium iodide.

CCND1 is a bona fide target gene of miR-628-5p

The TargetScan database was used to identify potential direct targets for miR-628-5p according to the binding sites in the 3′-UTR. TargetScan-predicting algorithms identified that an area at positions 453–459 within the 3′-UTR of CCND1 was a potential target for miR-628-5p binding (Fig. 3A). To further determine whether CCND1 is a direct target for miR-628-5p, a wild-type and mutant dual-luciferase UTR vector in the miR-628-5p binding sites of the 3′-UTR of CCND1 were constructed. miR-628-5p significantly suppressed the luciferase reporter activity of the wild-type vector compared with the control and mutant vector; however, no significant difference in the luciferase activity of the mutant vector was observed compared with the control vector (P<0.01; Fig. 3B).

Figure 3.

CCND1 is a bona fide target gene for miR-628-5p. (A) CCND1 was identified as a downstream effector of miR-628-5p using TargetScan version 7.2 software. (B) Dual-reporter luciferase assay was used to confirm the binding of miR-628-5p to CCND1 in WT and mut vectors. **P<0.01 vs. control + CCND1, ##P<0.01 vs. miR-628-5p + CCND1-mut. miR/miRNA, microRNA; WT, wild-type; mut, mutant; CCND1, cyclin D1.

CCND1 expression levels are negatively correlated with miR-628-5p expression

The mRNA and protein expression levels of miR-628-5p and CCND1 were analyzed in HT-29 cells with miR-628-5p mimic and/or CCND1 overexpression. The expression levels of miR-628-5p were observed to be significantly increased in CCND-1overexpressed plus miR-628-5p mimic-transfected cells compared with cells overexpressing CCND1, while no significant difference between the miR-628-5p mimic group and CCND1+mimic group were observed (Fig. 4A). Transfection of the CCND1 vector significantly increased CCND1 expression levels compared with the control and NC groups, although this increase was significantly inhibited by cells transfected with the miR-628-5p mimic at both the mRNA (Fig. 4B) and the protein (Fig. 4C and D) expression levels (P<0.01). In addition, the mRNA and protein expression in the mimic group was obviously decreased than that in CCND1+mimic group (P<0.01; Fig. 4B-D).

Figure 4.

Cyclin D1 expression levels are negatively associated with miR-628-5p expression levels. mRNA expression level of (A) miR-628-5p and (B) CCND1 were detected using reverse transcriptionquantitative PCR in HT-29 cells transfected with cyclin D1 overexpression, miR-628-5p mimics, both or their respective NC. Protein expression levels of cyclin D1 were (C) detected and (D) semi-quantified using western blotting in HT-29 cells transfected with CCD1 overexpression, miR-628-5p mimics, both or their respective NC. Expression of each protein was normalized to the control protein, β-actin. **P<0.01 vs. control group, ##P<0.01 vs. NC, ^^P<0.01 vs. CCND1, ΔΔP<0.01 vs. CCND1 + mimic, CCND1, cyclin D1.

CCND1 is required for the proliferation and apoptosis of HT-29 cells and is regulated by the miR-628-5p mimic

The interaction between miR-628-5p and CCND1 was explored through co-transfecting the miR-628-5p mimic and the CCND1 vector into HT-29 cells. CCND1 overexpression in HT-29 cells significantly increased the cell viability compared with the control and NC group (Fig. 5A); cells transfected with the miR-628-5p mimic reduced this ability of CCND1 (P<0.01; Fig. 5A). Moreover, cells co-transfected with the miR-628-5p mimic and CCND1 overexpression demonstrated significantly reduced proliferative activity compared with the CCND1-overexpressed cells, although proliferation remained significantly higher compared with cells only transfected with miR-628-5p mimic (Fig. 5A). Similarly, the colony formation assay demonstrated that the significantly enhanced proliferative ability of CCND1-overexpressed cells compared with control and NC cells could be significantly reversed by the CCND1 plus mimic-transfected cells, and even further reduced by the miR-628-5p mimic-transfected HT-29 cells (P<0.01; Fig. 5B and C). The ability of HT-29 cells to undergo apoptosis was significantly higher in the CCND1-overexpressed plus miR-628-5p mimic co-transfected group compared to the overexpressed CCND1 group, and the apoptotic cells were significantly higher in the miR-628-5p mimic group compared with the CCND1-overexpressed plus miR-628-5p mimic co-transfected group. (P<0.01; Fig. 5D and E). Furthermore, CCND1 overexpression significantly increased the expression levels of Ki67 and Bcl-2 compared with the Control and NC groups, whereas the expression levels of cleaved-caspase-3 and Bax were significantly decreased (P<0.01; Fig. 6A-C). Meanwhile, CCND1 in combination with the miR-628-5p mimic partially reversed the effects of the CCND1 on the decreased expression levels of cleaved-caspase-3 (P<0.01) and Bax, and on the increased expression levels of Ki67 and Bcl-2 (P<0.01; Fig. 6A-C).

Figure 5.

CCND1 is required for the miR-628-5p mimic to inhibit the proliferation of HT-29 cells. (A) HT-29 cell proliferation following transfection with CCND1 overexpression, miR-628-5p mimics, both or their respective NCs were determined through Cell Counting kit-8 assays. (B and C) HT-29 cell proliferation following transfection with CCND1 overexpression, miR-628-5p mimics, both or their respective NC was (B) analyzed and (C) semi-quantified using colony formation assays (magnification, ×1). (D and E) HT-29 cell apoptosis following transfection with CCND1 overexpression, miR-628-5p mimics, both or their respective NC was (D) detected and (E) semi-quantified using flow cytometric analysis. *P<0.05, **P<0.01 vs. control group, #P<0.05, ##P<0.01 vs. NC, ^P<0.05, ^^P<0.01 vs. CCND1, ΔP<0.05, ΔΔP<0.01 vs. CCND1 + mimic. miR, microRNA; NC, negative control; PI, propidium iodide; CCND1, cyclin D1.

Figure 6.

CCND1 partially reverses the effects of miR-628-5p mimics on regulating proliferation- and apoptosis-associated proteins in HT-29 cells. (A) Protein expression levels of Ki67, cleaved-caspase-3, Bax and Bcl-2 were detected by western blotting in HT-29 cells transfected with CCND1 overexpression, miR-628-5p mimics, both or their respective NC. (B and C) Expression levels of each protein in (A) were semi-quantified and normalized to the loading control protein, β-actin. *P<0.05 and **P<0.01 vs. control group, #P<0.05 and ##P<0.01 vs. NC, ^P<0.05, ^^P<0.01 vs. CCND1, ΔΔP<0.01 vs. CCND1 + mimic. miR, microRNA; NC, negative control; CCND1, cyclin D1.

Discussion

Colorectal cancer is one of the most frequently occurring malignant tumors, and it is associated with a significantly high mortality rate (33); the American cancer society estimates that colorectal cancer accounted for about 9% of cancer mortalities in 2017 (34). However, the mechanism underlying the development of colorectal cancer is largely unclear, which poses great difficulty in designing treatments and improving prognosis (35). Despite an abundance of basic and clinical research conducted on colorectal cancer, the diagnosis and treatment of the disease remains within the scope of surgical chemotherapy and radiotherapy, the recurrence rate after surgery is high (36). Therefore, it is of great importance to discover novel colorectal cancer treatment targets and more effective treatment strategies.

Numerous aberrantly expressed miRNAs have been reported in colorectal cancer tissues (37). Some miRNAs are highly expressed in colorectal cancer tissues, and induce the development of sputum tumors through regulating its downstream target mRNA; for example, miR-21 was observed to induce the proliferation, invasion and metastasis of colorectal cancer cells (38), overexpression of miR-671-5p indicated a poor prognosis in colon cancer and accelerated proliferation, migration, and invasion of colorectal cancer cells (39). Some miRNAs also exhibit low expression levels in colorectal cancer tissues; the significant downregulation of miR-4262 expression levels in colorectal cancer tissue promotes apoptosis and inhibits the proliferation of colorectal cancer cells (40). In addition, low expression levels of miRNAs in colorectal cancer tissues have also been detected (41); in one study, miR-144 expression levels were significantly lower in colon cancer in vivo and in vitro (42), whereas in another, miR-143-3p expression levels were observed to be decreased in colorectal cancer (43). The present study revealed that the expression level of miR-628-5p was significantly decreased in colorectal cancer tissues and cell lines compared with primary tissues and normal cells. Therefore, it was hypothesized that miR-628-5p is a tumor suppressor for colorectal cancer. miR-628-5p decreased the tumorigenicity of epithelial ovarian cancer cells (44), and miRNA-628 inhibited the proliferation of acute myeloid leukemia cells (14). In addition, miR-628 was reported to suppress nonsmall cell lung cancer proliferation, migration and invasion (45). Similarly, the present study demonstrated that overexpressed miRNA-628-5p significantly inhibited colorectal cancer cell proliferation and promoted cell apoptosis. These data indicated that miR-628-5p may act as a biomarker for the diagnosis of patients with colorectal cancer.

Previous research has demonstrated that CCND1 serves an important role in promoting the development and progress of multiple types of human cancer, such as lung adenocarcinoma, glioma and renal cell cancer (46–49). A previous study indicated that miR-374a inactivated the phosphoinositide 3-kinase (PI3K)/AKT signaling axis through inhibiting CCND1 and suppressing the progression of colon cancer (49). Transmembrane protease, serine 4 (TMPRSS4) modulated both the invasion and proliferation of prostate cancer cells through targeting Slug and CCND1 (50). Notably, the present study identified CCND1 as a direct target for miR-628-5p binding. Through functional experiments, CCND1 overexpression markedly rescued the effects of overexpressed miR-628-5p on HT-29 cell proliferation and apoptosis. Moreover, a negative association was observed between CCND1 and miRNA-628-5p expression levels in HT-29 cells. Based on these findings, it is suggested that the miRNA-628-5p-induced suppression over colorectal cancer progression may be related to the downregulation of CCND1 expression.

The present study also examined the effect of miR-628-5p and CCND1 on cell proliferation and apoptosis related-protein. Ki67 is a nuclear antigen, which is expressed in proliferating cells from G1 to M-phase of the cell cycle (51). Several studies have shown Ki67 to be predictive of a variety of human malignancies, such as prostate cancer and breast cancer (52,53). Bcl-2 and Bax belong to the Bcl-2 gene family; Bcl-2 members are localized in the mitochondria and have either pro-apoptotic (Bax, Bak, Bid and Bim) or anti-apoptotic (Bcl-2, Bcl-xL and Bcl-W) functions (54). Activated Bax can induce the release of pro-apoptotic factors and cytochrome c (55). Caspase-3 is a member of the cysteine-aspartic acid protease family and plays a central role in cell apoptosis (56,57). The results of the present study indicated that CCND1 promoted the expression of Ki67 and Bcl-2, and inhibited Bax and Cleaved caspase-3, while miR-628-5p partially reversed the effect of CCND1 on these genes. It also indicated that miR-628-5p inhibited proliferation and induced apoptosis of colorectal cancer cell via regulating CCND1 expression.

Nevertheless, the present study has several limitations that hinder the interpretation of the results; for example, the function of overexpressed miR-628-5p in inhibiting colorectal cancer development through reducing proliferation and inducing apoptosis was only supported by in vitro studies. Additionally, the observed regulatory mechanism between miR-628-5p and CCND1 in colorectal cancer remains unclear, and it will require further investigations In conclusion, the results of the present study indicated that miR-628-5p may serve as a tumor suppressor, and could potentially be used as a promising biomarker for the prognosis of patients with colorectal cancer. In addition, miR-628-5p may serve as a potential therapeutic target for colorectal cancer treatment.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

FG conceived and designed the study, drafted the article and critically revised it for intellectual content; JX performed and analyzed the data, and interpreted the results. The final approval of the version to be published and agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of the work were appropriately investigated and resolved was approved by all authors.

Ethics approval and consent to participate

The present study was approved by The First Affiliated Hospital of Hebei North University Ethics Committee (Zhangjiakou, China). Informed, written consent for the use of tissue for clinical research was obtained from all patients. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Chen W: Cancer statistics: Updated cancer burden in China. Chin J Cancer Res. 27:12015. View Article : Google Scholar : PubMed/NCBI

2 

Tarraga Lopez PJ, Albero JS and Rodriguez-Montes JA: Primary and secondary prevention of colorectal cancer. Clin Med Insights Gastroenterol. 7:33–46. 2014.PubMed/NCBI

3 

Center MM, Jemal A and Ward E: International trends in colorectal cancer incidence rates. Cancer Epidemiol Biomarkers Prev. 18:1688–1694. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Ferrari P, Jenab M, Norat T, Moskal A, Slimani N, Olsen A, Tjonneland A, Overvad K, Jensen MK, Boutron-Ruault MC, et al: Lifetime and baseline alcohol intake and risk of colon and rectal cancers in the European prospective investigation into cancer and nutrition (EPIC). Int J Cancer. 121:2065–2072. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Hooker CM, Gallicchio L, Genkinger JM, Comstock GW and Alberg AJ: A prospective cohort study of rectal cancer risk in relation to active cigarette smoking and passive smoke exposure. Ann Epidemiol. 18:28–35. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Zoratto F, Rossi L, Verrico M, Papa A, Basso E, Zullo A, Tomao L, Romiti A, Lo Russo G and Tomao S: Focus on genetic and epigenetic events of colorectal cancer pathogenesis: Implications for molecular diagnosis. Tumour Biol. 35:6195–6206. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Brenner H, Kloor M and Pox CP: Colorectal cancer. Lancet. 383:1490–1502. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Huang G, Chen X, Cai Y, Wang X and Xing C: miR-20a-directed regulation of BID is associated with the TRAIL sensitivity in colorectal cancer. Oncol Rep. 37:571–578. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Gulyaeva LF and Kushlinskiy NE: Regulatory mechanisms of microRNA expression. J Transl Med. 14:1432016. View Article : Google Scholar : PubMed/NCBI

10 

Ryan BM: microRNAs in cancer susceptibility. Adv Cancer Res. 135:151–171. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Yang W, Ma J, Zhou W, Cao B, Zhou X, Zhang H, Zhao Q, Hong L and Fan D: Reciprocal regulations between miRNAs and HIF-1α in human cancers. Cell Mol Life Sci. 76:453–471. 2019. View Article : Google Scholar : PubMed/NCBI

12 

Zhang B: MicroRNA: A new target for improving plant tolerance to abiotic stress. J Exp Bot. 66:1749–1761. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Lin C, Gao B, Yan X, Lei Z, Chen K, Li Y, Zeng Q, Chen Z and Li H: MicroRNA 628 suppresses migration and invasion of breast cancer stem cells through targeting SOS1. Onco Targets Ther. 11:5419–5428. 2018. View Article : Google Scholar : PubMed/NCBI

14 

Chen L, Jiang X, Chen H, Han Q, Liu C and Sun M: microRNA-628 inhibits the proliferation of acute myeloid leukemia cells by directly targeting IGF-1R. Onco Targets Ther. 12:907–919. 2019. View Article : Google Scholar : PubMed/NCBI

15 

Ichihara A and Tanaka K: Roles of proteasomes in cell growth. Mol Biol Rep. 21:49–52. 1995. View Article : Google Scholar : PubMed/NCBI

16 

Yuan C, Zhu X, Han Y, Song C, Liu C, Lu S, Zhang M, Yu F, Peng Z and Zhou C: Elevated HOXA1 expression correlates with accelerated tumor cell proliferation and poor prognosis in gastric cancer partly via cyclin D1. J Exp Clin Cancer Res. 35:152016. View Article : Google Scholar : PubMed/NCBI

17 

Li Y, Shen L, Xu H, Pang Y, Xu Y, Ling M, Zhou J, Wang X and Liu Q: Up-regulation of cyclin D1 by JNK1/c-Jun is involved in tumorigenesis of human embryo lung fibroblast cells induced by a low concentration of arsenite. Toxicol Lett. 206:113–120. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Wang Z, Wang Y, Wang S, Meng X, Song F, Huo W, Zhang S, Chang J, Li J, Zheng B, et al: Coxsackievirus A6 induces cell cycle arrest in G0/G1 phase for viral production. Front Cell Infect Microbiol. 8:2792018. View Article : Google Scholar : PubMed/NCBI

19 

Por E, Byun HJ, Lee EJ, Lim JH, Jung SY, Park I, Kim YM, Jeoung DI and Lee H: The cancer/testis antigen CAGE with oncogenic potential stimulates cell proliferation by up-regulating cyclins D1 and E in an AP-1- and E2F-dependent manner. J Biol Chem. 285:14475–14485. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Chen JY, Lin JR, Tsai FC and Meyer T: Dosage of Dyrk1a shifts cells within a p21-cyclin D1 signaling map to control the decision to enter the cell cycle. Mol Cell. 52:87–100. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Xie M, Zhao F, Zou X, Jin S and Xiong S: The association between CCND1 G870A polymorphism and colorectal cancer risk: A meta-analysis. Medicine (Baltimore). 96:e82692017. View Article : Google Scholar : PubMed/NCBI

22 

Chen Z, Chen X, Xie R, Huang M, Dong W, Han J, Zhang J, Zhou Q, Li H, Huang J and Lin T: DANCR promotes metastasis and proliferation in bladder cancer cells by enhancing IL-11-STAT3 signaling and CCND1 expression. Mol Ther. 27:326–341. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Portari EA, Russomano FB, de Camargo MJ, Machado Gayer CR, da Rocha Guillobel HC, Santos-Reboucas CB and Brito Macedo JM: Immunohistochemical expression of cyclin D1, p16Ink4a, p21WAF1, and Ki-67 correlates with the severity of cervical neoplasia. Int J Gynecol Pathol. 32:501–508. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Jiang D, Li H, Xiang H, Gao M, Yin C, Wang H, Sun Y and Xiong M: Long Chain non-coding RNA (lncRNA) HOTAIR knockdown increases miR-454-3p to suppress gastric cancer growth by targeting STAT3/Cyclin D1. Med Sci Monit. 25:1537–1548. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Dai M, Al-Odaini AA, Fils-Aime N, Villatoro MA, Guo J, Arakelian A, Rabbani SA, Ali S and Lebrun JJ: Cyclin D1 cooperates with p21 to regulate TGFβ-mediated breast cancer cell migration and tumor local invasion. Breast Cancer Res. 15:R492013. View Article : Google Scholar : PubMed/NCBI

26 

Tong WW, Tong GH, Chen XX, Zheng HC and Wang YZ: HIF2α is associated with poor prognosis and affects the expression levels of survivin and cyclin D1 in gastric carcinoma. Int J Oncol. 46:233–242. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Huang YS, Jie N, Zhang YX, Zou KJ and Weng Y: shRNA-induced silencing of Ras-related C3 botulinum toxin substrate 1 inhibits the proliferation of colon cancer cells through upregulation of BAD and downregulation of cyclin D1. Int J Mol Med. 41:1397–1408. 2018.PubMed/NCBI

28 

Al-Qasem A, Al-Howail HA, Al-Swailem M, Al-Mazrou A, Al-Otaibi B, Al-Jammaz I, Al-Khalaf HH and Aboussekhra A: PAC exhibits potent anti-colon cancer properties through targeting cyclin D1 and suppressing epithelial-to-mesenchymal transition. Mol Carcinog. 55:233–244. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Nie J, Liu L, Zheng W, Chen L, Wu X, Xu Y, Du X and Han W: microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting Cyclin D1 and Bcl-2. Carcinogenesis. 33:220–225. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Park SB, Park GH, Song HM, Son HJ, Um Y, Kim HS and Jeong JB: Anticancer activity of calyx of Diospyros kaki Thunb. Through downregulation of cyclin D1 via inducing proteasomal degradation and transcriptional inhibition in human colorectal cancer cells. BMC Complement Altern Med. 17:4452017. View Article : Google Scholar : PubMed/NCBI

31 

Huang R, Lin JY and Chi YJ: miR-519d reduces the 5-fluorouracil resistance in colorectal cancer cells by down-regulating the expression of CCND1. Eur Rev Med Pharmacol Sci. 22:2869–2875. 2018.PubMed/NCBI

32 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Jemal A, Siegel R, Xu J and Ward E: Cancer statistics, 2010. CA Cancer J Clin. 60:277–300. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

35 

Arvelo F, Sojo F and Cotte C: Biology of colorectal cancer. Ecancermedicalscience. 9:5202015. View Article : Google Scholar : PubMed/NCBI

36 

Asano H, Kojima K, Ogino N, Fukano H, Ohara Y and Shinozuka N: Postoperative recurrence and risk factors of colorectal cancer perforation. Int J Colorectal Dis. 32:419–424. 2017. View Article : Google Scholar : PubMed/NCBI

37 

Huang Z, Huang S, Wang Q, Liang L, Ni S, Wang L, Sheng W, He X and Du X: MicroRNA-95 promotes cell proliferation and targets sorting Nexin 1 in human colorectal carcinoma. Cancer Res. 71:2582–2589. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Sayed D, Rane S, Lypowy J, He M, Chen IY, Vashistha H, Yan L, Malhotra A, Vatner D and Abdellatif M: MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths. Mol Biol Cell. 19:3272–3282. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Jin W, Shi J and Liu M: Overexpression of miR-671-5p indicates a poor prognosis in colon cancer and accelerates proliferation, migration, and invasion of colon cancer cells. Onco Targets Ther. 12:6865–6873. 2019. View Article : Google Scholar : PubMed/NCBI

40 

Weng L, Ma J, Jia YP, Wu SQ, Liu BY, Cao Y, Yin X, Shang MY and Mao AW: miR-4262 promotes cell apoptosis and inhibits proliferation of colon cancer cells: Involvement of GALNT4. Am J Transl Res. 10:3969–3977. 2018.PubMed/NCBI

41 

Wang Q, Huang Z, Guo W, Ni S, Xiao X, Wang L, Huang D, Tan C, Xu Q, Zha R, et al: microRNA-202-3p inhibits cell proliferation by targeting ADP-ribosylation factor-like 5A in human colorectal carcinoma. Clin Cancer Res. 20:1146–1157. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Sheng S, Xie L, Wu Y, Ding M, Zhang T and Wang X: miR-144 inhibits growth and metastasis in colon cancer by down-regulating SMAD4. Biosci Rep. 39(pii): BSR201818952019. View Article : Google Scholar : PubMed/NCBI

43 

Guo L, Fu J, Sun S, Zhu M, Zhang L, Niu H, Chen Z, Zhang Y, Guo L and Wang S: MicroRNA-143-3p inhibits colorectal cancer metastases by targeting ITGA6 and ASAP3. Cancer Sci. 110:805–816. 2019. View Article : Google Scholar : PubMed/NCBI

44 

Li M, Qian Z, Ma X, Lin X, You Y, Li Y, Chen T and Jiang H: miR-628-5p decreases the tumorigenicity of epithelial ovarian cancer cells by targeting at FGFR2. Biochem Biophys Res Commun. 495:2085–2091. 2018. View Article : Google Scholar : PubMed/NCBI

45 

Jiang M, Zhou LY, Xu N and An Q: Down-regulation of miR-500 and miR-628 suppress non-small cell lung cancer proliferation, migration and invasion by targeting ING1. Biomed Pharmacother. 108:1628–1639. 2018. View Article : Google Scholar : PubMed/NCBI

46 

Yao Y, Luo J, Sun Q, Xu T, Sun S, Chen M, Lin X, Qian Q, Zhang Y, Cao L, et al: HOXC13 promotes proliferation of lung adenocarcinoma via modulation of CCND1 and CCNE1. Am J Cancer Res. 7:1820–1834. 2017.PubMed/NCBI

47 

Chen DG, Zhu B, Lv SQ, Zhu H, Tang J, Huang C, Li Q, Zhou P, Wang DL and Li GH: Inhibition of EGR1 inhibits glioma proliferation by targeting CCND1 promoter. J Exp Clin Cancer Res. 36:1862017. View Article : Google Scholar : PubMed/NCBI

48 

Xue J, Qin Z, Li X, Zhang J, Zheng Y, Xu W, Cao Q and Wang Z: Genetic polymorphisms in cyclin D1 are associated with risk of renal cell cancer in the Chinese population. Oncotarget. 8:80889–80899. 2017. View Article : Google Scholar : PubMed/NCBI

49 

Chen Y, Jiang J, Zhao M, Luo X, Liang Z, Zhen Y, Fu Q, Deng X, Lin X, Li L, et al: microRNA-374a suppresses colon cancer progression by directly reducing CCND1 to inactivate the PI3K/AKT pathway. Oncotarget. 7:41306–41319. 2016.PubMed/NCBI

50 

Lee Y, Ko D, Min HJ, Kim SB, Ahn HM, Lee Y and Kim S: TMPRSS4 induces invasion and proliferation of prostate cancer cells through induction of Slug and cyclin D1. Oncotarget. 7:50315–50332. 2016.PubMed/NCBI

51 

Melling N, Kowitz CM, Simon R, Bokemeyer C, Terracciano L, Sauter G, Izbicki JR and Marx AH: High Ki67 expression is an independent good prognostic marker in colorectal cancer. J Clin Pathol. 69:209–214. 2016. View Article : Google Scholar : PubMed/NCBI

52 

de Azambuja E, Cardoso F, de Castro G Jr, Colozza M, Mano MS, Durbecq V, Sotiriou C, Larsimont D, Piccart-Gebhart MJ and Paesmans M: Ki-67 as prognostic marker in early breast cancer: A meta-analysis of published studies involving 12,155 patients. Br J Cancer. 96:1504–1513. 2007. View Article : Google Scholar : PubMed/NCBI

53 

Pollack A, DeSilvio M, Khor LY, Li R, Al-Saleem TI, Hammond ME, Venkatesan V, Lawton CA, Roach M III, Shipley WU, et al: Ki-67 staining is a strong predictor of distant metastasis and mortality for men with prostate cancer treated with radiotherapy plus androgen deprivation: Radiation Therapy Oncology Group Trial 92-02. J Clin Oncol. 22:2133–2140. 2004. View Article : Google Scholar : PubMed/NCBI

54 

Hassan M, Watari H, AbuAlmaaty A, Ohba Y and Sakuragi N: Apoptosis and molecular targeting therapy in cancer. Biomed Res Int. 2014:1508452014. View Article : Google Scholar : PubMed/NCBI

55 

Weng C, Li Y, Xu D, Shi Y and Tang H: Specific cleavage of Mcl-1 by caspase-3 in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in Jurkat leukemia T cells. J Biol Chem. 280:10491–10500. 2005. View Article : Google Scholar : PubMed/NCBI

56 

Porter AG and Janicke RU: Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 6:99–104. 1999. View Article : Google Scholar : PubMed/NCBI

57 

Du J, Leng J, Zhang L, Bai G, Yang D, Lin H and Qin J: Angiotensin II-induced apoptosis of human umbilical vein endothelial cells was inhibited by blueberry anthocyanin through Bax- and caspase 3-dependent pathways. Med Sci Moni. 22:3223–3228. 2016. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo F and Xue J: MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045. Mol Med Rep 21: 1481-1490, 2020.
APA
Guo, F., & Xue, J. (2020). MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045. Molecular Medicine Reports, 21, 1481-1490. https://doi.org/10.3892/mmr.2020.10945
MLA
Guo, F., Xue, J."MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045". Molecular Medicine Reports 21.3 (2020): 1481-1490.
Chicago
Guo, F., Xue, J."MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045". Molecular Medicine Reports 21, no. 3 (2020): 1481-1490. https://doi.org/10.3892/mmr.2020.10945
Copy and paste a formatted citation
x
Spandidos Publications style
Guo F and Xue J: MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045. Mol Med Rep 21: 1481-1490, 2020.
APA
Guo, F., & Xue, J. (2020). MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045. Molecular Medicine Reports, 21, 1481-1490. https://doi.org/10.3892/mmr.2020.10945
MLA
Guo, F., Xue, J."MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045". Molecular Medicine Reports 21.3 (2020): 1481-1490.
Chicago
Guo, F., Xue, J."MicroRNA‑628‑5p inhibits cell proliferation and induces apoptosis in colorectal cancer through downregulating CCND1 expression levels Retraction in /10.3892/mmr.2023.13045". Molecular Medicine Reports 21, no. 3 (2020): 1481-1490. https://doi.org/10.3892/mmr.2020.10945
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team