International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Nasopharyngeal carcinoma (NPC) is a type of head and neck cancer endemic in Southeast Asia, and is closely related to Epstein-Barr virus (EBV) infection (1). Despite the improvement in local tumor control achieved by more precise imaging modalities and radiotherapy, the 5-year survival rate of patients with NPC remain unsatisfactory, primarily due to distant metastasis (2). Therefore, there is a requirement for the elucidation of the molecular mechanisms underlying the pathogenesis of NPC as well as the development of novel therapeutic strategies.
MicroRNAs (miRNA/miR) are a class of small, non-protein-coding RNAs that function in RNA silencing and post-transcriptional regulation of gene expression (3). miRNAs are also known to play key roles in cancer, where they serve as oncomirs or tumor suppressors (4). miRNAs have been found to regulate genes involved in multiple cellular processes, including development, differentiation, proliferation and apoptosis (5). The modulation of miRNAs, based on two major approaches (miRNA mimics and miRNA antagonists/inhibitors), is currently being investigated for the clinical development of therapeutic miRNAs (6,7).
miR-19b, also termed miR-19b-1 or miR-19b-1-5p, is upregulated in several types of cancer and has been reported to serve as an oncomir (8). miR-19b serves as a prognostic biomarker for breast cancer and promotes tumor progression through the PI3K/AKT signaling pathway (9). A previous study reported that miR-19b decreases apoptosis, promotes proliferation and induces tumorigenicity in multiple myeloma cells by targeting phosphatase and tensin homolog (10). The miR-17-92 cluster, which includes miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1, was reported to be upregulated in NPC (11). However, the role of miR-19b in NPC has not been fully elucidated. Therefore, the present study investigated the function of miR-19b, as well as the therapeutic effect of miR-19b inhibitors, in NPC cells.
EBV-positive cells C666-1 and HK1-EBV were kindly provided by Professor Sai Wah Tsao (The University of Hong Kong, Hong Kong, China) (12). 5-8F, SUNE1 and SXSW-1489 were kindly provided by Professor Xiao Dong (Southern Medical University, Guangzhou, China) (13) and Professor Weiyi Fang (Southern Medical University) (14). NPC cell lines (C666-1, HK1-EBV, 5-8F, SUNE1) and the immortalized nasopharyngeal epithelial cell line (SXSW-1489) were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). C666-1 cells were cultured with the addition of 10 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The cells lines were maintained in a humidified atmosphere at 37°C and 5% CO2.
Total RNA from cultured (C666-1, HK1-EBV, 5-8F, SUNE1, SXSW-1489) cells and lenses was extracted using TRIzol® reagent (cat. no. 15596026, Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Genomic DNA was subsequently removed using DNase I. cDNA was synthesized using the Mir-X miRNA First-Strand Synthesis kit (Clontech Laboratories, Inc.) and the following primers: U6, AACGCTTCACGAATTTGCGT; and miR-19b, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGT. The expression levels of miR-19b and the internal control U6 were quantified by qPCR using a SYBR Premix Ex Taq II kit (Takara Bio, Inc.) and an ABI Prism 7,000 sequence detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following primer pairs were used: U6 forward, CTCGCTTCGGCAGCACA and reverse, AACGCTTCACGAATTTGCGT; and mir-19b forward, TGTGCAAATCCATGCAAA and reverse, GTGCAGGGTCCGAGGTATTC. miRNA levels were quantified using the 2−ΔΔCq method and normalized to the internal control U6.
The miRCURY LNA™ miRNA Inhibitor [consisting of an miR-19b inhibitor and a negative control (NC)] was obtained from Qiagen, Inc. The sequences of the miRNA are proprietary information. The miRNAs were transiently transfected into C666-1 cells at a working concentration of 15 µM using X-tremeGENE siRNA Transfection Reagent (Roche Diagnostics) following the manufacturer's protocol.
A total of 2×103 C666-1 cells per well were seeded in a 96-well plate in a final volume of 100 µl and transfected with miRNAs. The effect of the miR-19b inhibitor on cell proliferation was subsequently determined using the CCK-8 assay at 6, 12, 24 and 48 h post-transfection. A total of 10 µl CCK-8 solution (Dojindo Molecular Technologies, Inc.) was added to each well and incubated for 4 h at 37°C. The optical densities of the resultant purple solutions were measured at a wavelength of 450 nm (15).
Transwell chambers (24-well insert; Corning, Inc.) were used to analyze cell migration. At 48 h post-transfection, a total of 2×104 C666-1 cells in serum-free RPMI-1640 medium were seeded into the upper chamber of the insert. RPMI-1640 medium containing 10% FBS was added to the lower chamber to serve as a chemo-attractant. Cells were allowed to migrate for 24 h. The cells on the upper membrane surface were removed using a cotton bud and the cells on the lower membrane surface were fixed with 4% formaldehyde. The cells were subsequently stained with 0.1% crystal violet (Amresco, LLC) and the migrated cells were counted in three random-selected fields. The result of migrated cells was observed and photographed under light microscope (Olympus, Japan).
C666-1 cells were harvested 48 h post-transfection by trypsin digestion without EDTA and stained using the APC-Annexin V/7-AAD Dual Staining Cell Apoptosis Detection kit (BD Biosciences) according to the manufacturer's instructions. The cells were subsequently analyzed with a flow cytometer. The cells in Q2 (late-stage apoptosis) and Q4 (early-stage apoptosis) were considered to be apoptotic cells.
At 48 h post-transfection, cell lysates were harvested. The lysis buffer used RIPA buffer and PMSF (cat. no. R0020, 1:100, Beijing Solarbio Science & Technology, Inc.). Proteins were separated by 10% SDS-PAGE separating gel and 5% SDS-PAGE stacking gel, and then electrophoretically transferred onto a polyvinylidene difluoride membrane. The membrane was subsequently incubated with primary antibodies against β-actin (cat. no. TA-09; 1:5,000; OriGene Technologies, Inc.), STAT3 (cat. no. sc-8019; 1:2,000; Santa Cruz Biotechnology, Inc.), suppressor of cytokine signaling (SOCS) 1 (cat. no. PA5-27239; 1:2,000; Thermo Fisher Scientific, Inc.), p-STAT3 (Tyr705; cat. no. G.374.10; 1:2,000; Thermo Fisher Scientific, Inc.), p-STAT3 (Ser727; cat. no. PS727.2; 1:2,000; Thermo Fisher Scientific, Inc.), cyclin D1 (cat. no. OTI1F7; 1:1,000; OriGene Technologies, Inc.), Bcl-2 (cat. no. OTI2E5; 1:1,000; ZSGB-BIO), myeloid leukemia protein 1 (Mcl-1; cat. no. OTI3A12; 1:1,000; OriGene Technologies, Inc.) overnight at 4°C in Primary Antibodies Dilution Buffer (cat. no. P0023A; Beyotime Institute of Biotechnology). Following primary antibody incubation, the membrane was incubated with peroxidase-conjugated goat anti-mouse IgG (H+L; cat. no. ZB-2305; 1:5,000; ZSGB-BIO) and peroxidase-conjugated goat anti-rabbit IgG (H+L; cat. no. ZB-2301; 1:5,000; OriGene Technologies, Inc.) secondary antibodies for 1 h at room temperature. The protein bands were visualized using the ECL Western Blot Kit detection system (Thermo Fisher Scientific, Inc.). Protein expression was quantified with β-actin as the loading control at least three times and analyzed by Image-J (version1.50i, National Institutes of Health).
Data are presented as the mean ± SEM of three independent experiments. One-way ANOVA test was used to analyze the groups. Multiple comparisons were made using the Tukey's post hoc test. Statistical analysis was performed using SPSS software (version 20; IBM Corp). P<0.05 were considered to indicate a statistically significant difference.
RT-qPCR revealed that miR-19b was upregulated NPC cells (C666-1, 5-8F and SUNE1) compared with the nasopharyngeal epithelial cell line SXSW-1489. However, no statistical difference in miR-19b expression was observed between HK1-EBV and SXSW-1489 cells (Fig. 1). As C666-1 is the only NPC cell line consistently harboring EBV during in vitro propagation (16), this cell line was selected for subsequent miR-19b interference.
The miR-19b inhibitor or NC were transiently transfected into C666-1 cells and the effect on proliferation was subsequently investigated. As shown in Fig. 2, the miR-19b inhibitor inhibited the proliferation of C666-1 cells compared with the NC.
The miR-19b inhibitor or NC were transiently transfected into C666-1 cells and the effect on apoptosis was subsequently investigated. As shown in Fig. 3, flow cytometry revealed that the miR-19b inhibitor promoted the apoptosis of C666-1 cells compared with the NC.
The effect on the migration of C666-1 cells was investigated 48 h post-transfection using a Transwell assay. As shown in Fig. 4, the migration of C666-1 cells was significantly inhibited following transfection with the miR-19b inhibitor, compared with the NC group.
Western blotting revealed that the expression levels of pSTAT3-Tyr705 and pSTAT3-Ser727 in C666-1 cells decreased following transfection with the miR-19b inhibitor compared with the NC. Furthermore, the expression level of SOCS1, an endogenous inhibitor of STAT3 phosphorylation (17), increased following transfection with the miR-19b inhibitor compared with the NC (Fig. 5). Collectively, these results suggested that the miR-19b inhibitor specifically targeted the STAT3 signaling pathway.
To explore the effect of the miR-19b inhibitor on the expression of the downstream effector genes of the STAT3 signaling pathway, the expression levels of the proliferation-associated gene cyclin D1 and the apoptosis-associated genes Mcl-1 and Bcl-2 were detected by western blotting. These three proteins were downregulated following transfection with the miR-19b inhibitor compared with the NC (Fig. 6), further suggesting that the STAT3 signaling pathway was impaired. Furthermore, the change in malignant biological behaviors such as proliferation, apoptosis and migration may have been mediated by the downstream effectors of the STAT3 signaling pathway.
miR-19b, as a member of the miR-17-92 cluster, has been revealed to serve as an oncomir in several types of tumors (18,19). miR-19b promotes cell proliferation, migration and angiogenesis and inhibits cell apoptosis in several malignancies (20,21). The miR-17-92 cluster has been reported to be upregulated in NPC tissues and cell lines (22). Furthermore, the miR-17-92 cluster facilitates malignant biological processes and modulates cancer-related pathways in NPC (11,21,22).
The results of the present study indicated that miR-19b was upregulated in the majority of the NPC cell lines investigated compared with the nasopharyngeal epithelial cell line SXSW-1489. However, the role of miR-19b in NPC remains largely unknown. Therefore, in order to elucidate the functions of miR-19b in NPC cells, an miR-19b inhibitor was introduced into the NPC cell line C666-1. This decreased the proliferation, increased apoptosis and inhibited migration of C666-1 cells compared with the NC. These data are consistent with studies in several other malignancies (8,9,22).
STAT3 is a member of the STAT protein family. STAT3 is phosphorylated by receptor-associated Janus kinases (JAK) when stimulated by cytokines and growth factors and forms homodimers or heterodimers, which are translocated into the cell nucleus where they act as transcriptional activators (23). STAT3 mediates the expression of a variety of genes in response to extracellular or intracellular stimuli (24), and thus plays a key role in cell growth, apoptosis, invasion and metastasis, immune escape and angiogenesis (25). The STAT3 signaling pathway was revealed to be constitutively activated in NPC (26). The involvement of STAT3 in cancer cell growth and invasion has been previously documented in NPC (27). Furthermore, STAT3 has been identified as a therapeutic target in NPC (27).
SOCS1 is a member of the STAT-induced STAT inhibitor (SSI) family, also known as the SOCS family (28). SSI family members are cytokine-inducible negative regulators of cytokine signaling (29). SOCS1 takes part in a negative feedback loop that involves the JAK/STAT3 signaling pathway to attenuate cytokine signaling (30). Additionally, SOCS1 is reported to be a target of miR-19b (31). The aforementioned studies suggest that miR-19b positively modulates the STAT3 signaling pathway by inhibiting SOCS1 expression. The results obtained in the present study showed that SOCS1 expression was upregulated following miR-19b inhibition in C666-1 cells. In addition, upregulation of SOCS1 was accompanied by the downregulation of pSTAT3, including both pSTAT3-Tyr705 and pSTAT3-Ser727, in C666-1 cells. The data implied that miR-19b plays a key role in STAT3 activation in NPC. STAT3 is activated through phosphorylation of Tyr705 in response to a number of factors, including interleukin-6 (32), platelet derived growth factor (10) and epidermal growth factor (33). STAT3 Ser727 is phosphorylated by various kinases (34). Phosphorylation at Tyr-705 leads to an increase in the transcriptional activity of STAT3. Serine phosphorylation is important for the formation of stable DNA-binding STAT3 homodimers and maximal transcriptional activity (35).
Phosphorylated STAT3 increases the expression of multiple downstream genes, which include cyclin D1, Bcl-2 and Mcl-1 (36). Cyclin D1 is proto-oncogene since it serves as a cell cycle regulator and is involved in the G1/S transition (37). Bcl-2 encodes an integral outer mitochondrial membrane protein that prevents apoptosis (38). Mcl-1 is a member of the Bcl-2 family, and is involved in the regulation of apoptosis and cell survival (39). In the present study, the expression of cyclin D1, Bcl-2 and Mcl-1 was downregulated in C666-1 cells following transfection with the miR-19b inhibitor. However, the downstream target genes of the STAT3 signaling pathway requires further investigation.
In conclusion, the present study revealed that inhibition of miR-19b attenuates the STAT3 signaling pathway and decreases the malignant biological behavior of the NPC cell line C666-1. Therefore, miR-19b may serve as potential therapeutic target for patients with NPC.
Not applicable.
The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 81560441 and 81760491 to S.J. Xiao), the Natural Science Foundation of Guangxi Province of China (grant no. 2015GXNSFAA139131 to S.J. Xiao), and Innovation Project of Guangxi Graduate Education (grant no. YCSW2017211 to L.H. Bian).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
SX and XZ contributed to the conception and design of the study. LB, XZ and SX drafted this manuscript. LB, JD, CZ, GS, XW, YY and XZ performed the experiments and analyzed the data. SX and XZ were involved in revising the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Chua MLK, Wee JTS, Hui EP and Chan ATC: Nasopharyngeal carcinoma. Lancet. 387:1012–1024. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Prawira A, Oosting SF, Chen TW, Delos Santos KA, Saluja R, Wang L, Siu LL, Chan KKW and Hansen AR: Systemic therapies for recurrent or metastatic nasopharyngeal carcinoma: A systematic review. Br J Cancer. 117:1743–1752. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Jansson MD and Lund AH: MicroRNA and cancer. Mol Oncol. 6:590–610. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Chen HC, Chen GH, Chen YH, Liao WL, Liu CY, Chang KP, Chang YS and Chen SJ: MicroRNA deregulation and pathway alterations in nasopharyngeal carcinoma. Br J Cancer. 100:1002–1011. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Chen Y, Gao DY and Huang L: In vivo delivery of miRNAs for cancer therapy: Challenges and strategies. Adv Drug Deliv Rev. 81:128–141. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Braicu C, Calin GA and Berindan-Neagoe I: MicroRNAs and cancer therapy-from bystanders to major players. Curr Med Chem. 20:3561–3573. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Li J, Yang S, Yan W, Yang J, Qin YJ, Lin XL, Xie RY, Wang SC, Jin W, Gao F, et al: MicroRNA-19 triggers epithelial-mesenchymal transition of lung cancer cells accompanied by growth inhibition. Lab Invest. 95:1056–1070. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Li C, Zhang J, Ma Z, Zhang F and Yu W: miR-19b serves as a prognostic biomarker of breast cancer and promotes tumor progression through PI3K/AKT signaling pathway. Onco Targets Ther. 11:4087–4095. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Vij N, Sharma A, Thakkar M, Sinha S and Mohan RR: PDGF-driven proliferation, migration, and IL8 chemokine secretion in human corneal fibroblasts involve JAK2-STAT3 signaling pathway. Mol Vis. 14:1020–1027. 2008.PubMed/NCBI | |
|
Ma F, Wang Z, Wang J, Liu X and Hu C: MicroRNA-19a promotes nasopharyngeal carcinoma by targeting transforming growth factor β receptor 2. Exp Ther Med. 14:1419–1426. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Hsu CY, Yi YH, Chang KP, Chang YS, Chen SJ and Chen HC: The epstein-barr virus-encoded MicroRNA MiR-BART9 Promotes Tumor Metastasis by Targeting E-Cadherin in nasopharyngeal carcinoma. PLoS Pathog. 10:e10039742014. View Article : Google Scholar : PubMed/NCBI | |
|
Lin TY, Chen Y, Jia JS, Zhou C, Lian M, Wen YT, Li XY, Chen HW, Lin XL, Zhang XL, et al: Loss of Cirbp expression is correlated with the malignant progression and poor prognosis in nasopharyngeal carcinoma. Cancer Manag Res. 11:6959–6969. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao M, Luo R, Liu Y, Gao L, Fu Z, Fu Q, Luo X, Chen Y, Deng X, Liang Z, et al: MiR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 7:11309–11322. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Zhao Z, Zhang X, Yang S, Lin X, Yang X, Lin X, Shi J, Wang S, Zhao W, et al: Klf4 reduces stemness phenotype, triggers mesenchymal-epithelial transition (MET)-like molecular changes, and prevents tumor progression in nasopharygeal carcinoma. Oncotarget. 8:93924–93941. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Xiao K, Yu Z, Li X, Li X, Tang K, Tu C, Qi P, Liao Q, Chen P, Zeng Z, et al: Genome-wide analysis of epstein-barr virus (EBV) integration and strain in C666-1 and raji cells. J Cancer. 7:214–224. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Davey GM, Heath WR and Starr R: SOCS1: A potent and multifaceted regulator of cytokines and cell-mediated inflammation. Tissue Antigens. 67:1–9. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Liu M, Yang R, Urrehman U, Ye C, Yan X, Cui S, Hong Y, Gu Y, Liu Y, Zhao C, et al: MiR-19b suppresses PTPRG to promote breast tumorigenesis. Oncotarget. 7:64100–64108. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Wang H, Xiong M, Hu Y, Sun Y and Ma Q: MicroRNA-19b inhibits proliferation of gastric cancer cells by targeting B-cell CLL/lymphoma 3. Oncol Rep. 36:2079–2086. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Wang FS, Wu ZY, Lin JL, Lan WB and Lin JH: MicroRNA-19b targets Mfn1 to inhibit Mfn1-induced apoptosis in osteosarcoma cells. Neoplasma. 61:265–273. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Fan Y, Yin S, Hao Y, Yang J, Zhang H, Sun C, Ma M, Chang Q and Xi JJ: miR-19b promotes tumor growth and metastasis via targeting TP53. RNA. 20:765–772. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Luo Z, Dai Y, Zhang L, Jiang C, Li Z, Yang J, McCarthy JB, She X, Zhang W, Ma J, et al: MiR-18a promotes malignant progression by impairing microRNA biogenesis in nasopharyngeal carcinoma. Carcinogenesis. 34:415–425. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Cheng GZ, Zhang W, Sun M, Wang Q, Coppola D, Mansour M, Xu LM, Costanzo C, Cheng JQ and Wang LH: Twist is transcriptionally induced by activation of STAT3 and mediates STAT3 oncogenic function. J Biol Chem. 283:14665–14673. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Ferguson SD, Srinivasan VM and Heimberger AB: The role of STAT3 in tumor-mediated immune suppression. J Neurooncol. 123:385–394. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Teng Y, Ross JL and Cowell JK: The involvement of JAK-STAT3 in cell motility, invasion, and metastasis. JAKSTAT. 3:e280862014.PubMed/NCBI | |
|
Lo AK, Lo KW, Tsao SW, Wong HL, Hui JW, To KF, Hayward DS, Chui YL, Lau YL, Takada K and Huang DP: Epstein-barr virus infection alters cellular signal cascades in human nasopharyngeal epithelial cells. Neoplasia. 8:173–180. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Ho Y, Tsao SW, Zeng M and Lui VW: STAT3 as a therapeutic target for Epstein-Barr virus (EBV): Associated nasopharyngeal carcinoma. Cancer Lett. 330:141–149. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A, Nishimoto N, Kajita T, Taga T, Yoshizaki K, et al: Structure and functionof a new STAT-induced STAT inhibitor. Nature. 387:924–929. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Hamanaka I, Saito Y, Yasukawa H, Kishimoto I, Kuwahara K, Miyamoto Y, Harada M, Ogawa E, Kajiyama N, Takahashi N, et al: Induction of JAB/SOCS-1/SSI-1 and CIS3/SOCS-3/SSI-3 is involved in gp130 resistance in cardiovascular system in rat treated with cardiotrophin-1 in vivo. Circ Res. 88:727–732. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Ben-Zvi T, Yayon A, Gertler A and Monsonego-Ornan E: Suppressors of cytokine signaling (SOCS) 1 and SOCS3 interact with and modulate fibroblast growth factor receptor signaling. J Cell Sci. 2:380–387. 2006. View Article : Google Scholar | |
|
Mignacca L, Saint-Germain E, Benoit A, Bourdeau V, Moro A and Ferbeyre G: Sponges against miR-19 and miR-155 reactivate the p53-Socs1 axis in hematopoietic cancers. Cytokine. 82:80–86. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Huang TQ, Willis MS and Meissner G: IL-6/STAT3 signaling in mice with dysfunctional type-2 ryanodine receptor. JAKSTAT. 4:e11583792016.PubMed/NCBI | |
|
Wang Y, van Boxel-Dezaire AH, Cheon H, Yang J and Stark GR: STAT3 activation in response to IL-6 is prolonged by the binding of IL-6 receptor to EGF receptor. Proc Natl Acad Sci USA. 110:16975–16980. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Parys JB: The multifaceted STAT3: How a transcription factor regulates Ca2+ signaling via a degradative pathway. Cell Calcium. 76:137–139. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Yokogami K, Wakisaka S, Avruch J and Reeves SA: Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol. 10:47–50. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Banerjee K and Resat H: Constitutive activation of STAT3 in breast cancer cells: A review. Int J Cancer. 138:2570–2578. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Pardee AB: G1 events and regulation of cell proliferation. Science. 246:603–608. 1989. View Article : Google Scholar : PubMed/NCBI | |
|
Lam M, Dubyak G, Chen L, Nuñez G, Miesfeld RL and Distelhorst CW: Evidence that BCL-2 represses apoptosis by regulating endoplasmic reticulum-associated Ca2+ fluxes. Proc Natl Acad Sci USA. 91:6569–6573. 1994. View Article : Google Scholar : PubMed/NCBI | |
|
Liu Q and Gehring K: Heterodimerization of BAK and MCL-1 Activated by Detergent Micelles. J Biol Chem. 285:41202–41210. 2010. View Article : Google Scholar : PubMed/NCBI |