Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2020 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2020 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway

  • Authors:
    • Xiaoqiao Shi
    • Zhiwen Liu
    • Junwei Li
  • View Affiliations / Copyright

    Affiliations: Department of Anesthesiology, The Second Affiliated Hospital of University of South China, Hengyang, Hunan 421001, P.R. China, Department of Anesthesiology, The Second Affiliated Hospital of Hunan University of Traditional Chinese Medicine, Changsha, Hunan 410005, P.R. China
    Copyright: © Shi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3307-3315
    |
    Published online on: August 19, 2020
       https://doi.org/10.3892/mmr.2020.11442
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hypoxia/reoxygenation (H/R) injury in myocardial cells occurs frequently during cardiac surgery and affects the prognosis of patients. The present study aimed to investigate the protective effects of dexmedetomidine (Dex) on H/R injury and its association with the C/EBP‑homologous protein (CHOP) signaling pathway. An H/R model was constructed in H9C2 cells to investigate the effects of Dex on H/R injury. Cell viability, apoptosis and lactate dehydrogenase (LDH) levels were determined by MTT, flow cytometry and 2,4‑dinitrophenylhydrazine colorimetric assays, respectively. The expression levels of inflammatory factors were measured by reverse transcription‑quantitative PCR (RT‑qPCR), and CHOP and glucose‑regulated protein‑78 (Grp78) expression levels were detected by RT‑qPCR and western blotting. CHOP was overexpressed or knocked down to detect the cell viability, apoptosis, LDH level and the expression levels of inflammatory factors and Grp78. The results demonstrated that in the H/R group, cell viability was lower and apoptosis was higher, and that higher levels of LDH and inflammatory factors were present compared with those in the Dex+H/R group. Silencing of CHOP significantly reversed the H/R‑reduced cell viability, high apoptotic rate and LDH levels, as well as the elevated expression levels of inflammatory factors and Grp78 caused by H/R injury, whereas the overexpression of CHOP inhibited cell viability and promoted apoptosis, elevated LDH level and expression of inflammatory factors and Grp78 compared with the negative control. Additionally, pretreatment with Dex significantly alleviated the H/R injury; thus, Dex may protect H9C2 cells against H/R induced cell injury, possibly by suppressing the CHOP signaling pathway.

Introduction

Ischemic reperfusion (I/R) commonly occurs after shock therapy, artery bypass and cardiopulmonary cerebral resuscitation (1–3). The functions of tissues and organs normally recover after I/R; however, I/R injury may aggravate and cause severe complications, including stroke (4). The outcome of myocardial surgery I/R is closely associated with the occurrence of myocardial ischemic reperfusion injury (MIRI). Previous studies have reported that oxygen free radical injury (5), energy metabolism disorder in cardiomyocytes (6), calcium overload (7), apoptosis of cardiomyocytes and other inflammatory diseases (8–10) serve important roles in MIRI. During reperfusion, a large amount of inflammatory factors is produced to promote tissue infiltration of inflammatory cells, thus affecting cell structures and functions (11). Hypoxia/reoxygenation (H/R) in cells is a major characteristic of I/R, and is frequently used to simulate the activity of I/R (12,13). Low cell viability, high apoptosis and inflammatory responses occur after cell injury induced by H/R (14).

Dexmedetomidine (Dex) is a new α2-adrenergic receptor agonist with high selectivity that and exerts analgesic (15), anti-stress (16) and anti-inflammatory (17) effects. Chen et al (18) have demonstrated that Dex exerts protective effects on postoperative cognitive dysfunction by downregulating the expression levels of inflammatory factors interleukin (IL)-1β, tumor necrosis factor (TNF)-α and NF-κB in rats. Wang et al (19) have investigated the mechanism of lidocaine-induced cytotoxicity and reported that the anti-inflammatory effect of Dex may be achieved by suppressing the mitogen-activated protein kinase (MAPK) signaling pathway to affect the expression of caspase-3 and Bcl-2 and reduce apoptosis. Additionally, Dex has been reported to reduce the expression of macrophage inflammatory protein-2 and other cytokines (TNF-α, IL-6 and IL-1β) in rat lung cells (20). Through regulating the peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α signaling pathway, Dex alleviates encephala edema and apoptosis in the presence of PGC-1α expression, thus protecting neurons from oxidative stress (21). In addition, Liu et al (22) explored the effects of Dex on injury caused by ischemia in neuronal cells, and the results demonstrated that Dex promoted neuronal cell viability and reduced apoptosis, as well as the ratio of Bax/Bcl-2 expression levels. In the present study, an H/R-induced H9C2 cell model was constructed and pretreated with Dex to investigate the protective effects of Dex on H/R injury in cardiomyocytes and its mechanism in the C/EBP-homologous protein (CHOP) signaling pathway.

Materials and methods

Cell culture and grouping

The H9C2 (2–1) cell line was obtained from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (cat. no. GNR 5). The cells were incubated in 90% DMEM (GIBCO; Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin and 0.1 mg/ml streptomycin (Sigma-Aldrich; Merck KGaA) with 5% CO2 at 37°C. The cells were divided into control, Dex, H/R, and Dex+H/R groups. The control group was normally cultured; Dex group was pretreated with 1 µM Dex (Beijing Huamaike Biotechnology Co., Ltd.) for 1 h and cultured normally; the H/R group was deoxidized using 4 mM sodium dithionite for 1 h and reoxidized for 12 h; the Dex+H/R group was pretreated with 1 µM Dex followed by H/R treatment.

Cell transfection

Cell transfection was performed as previously described (23). Small interfering (si)RNA targeting CHOP (siCHOP; cat. no. siB078266608-1-5; Guangzhou RiboBio Co.), si-negative control (NC; siNC; cat. no. siN0000002-1-5), pCMV6-XL5-CHOP (cat. no. SC117581; Origene Technologies, Inc.) and its NC overexpression vector (pCMV6-XL5; cat. no. PCMV6XL5; Origene Technologies, Inc.) were dissolved in 50 μl DMEM (HyClone; GE Healthcare Life Sciences) and used to overexpress or knock down the expression of CHOP. Prior to cell transfection, the cells were digested, thoroughly mixed, seeded into a 6-well plate (1×106 cells/ml) and evenly distributed in an orifice plate. After culturing overnight until the cells reached 60–70% confluency, the cells were transfected with 20 pmol siCHOP, CHOP siNC and NC in DMEM using Lipofectamine® 2000 transfection reagent (Thermo Fisher Scientific, Inc.) for 48 h at 37°C. At 24 h post-transfection, reverse transcription-quantitative PCR (RT-qPCR) and western blotting were used to detect the transfection efficiency. After the transfection, the H9C2 cells were divided into control, H/R, Dex+H/R, siNC+Dex+H/R and siCHOP+Dex+H/R groups to detect the effects of silencing CHOP on H/R injury to the cells, whereas those in the H/R, Dex+H/R, NC+Dex+H/R, CHOP+Dex+H/R groups were used to explore the effects of CHOP overexpression in H9C2 cells.

MTT assay

H9C2 cells were seeded (2×104 cells/well) into 96-well plates. MTT (10 µl; Amresco) was added to each well and cultured for 4 h at room temperature. Subsequently, 100 µl DMSO (Sigma-Aldrich; Merck KGaA) was added into each well and gently agitated for 10 min at room temperature. The optical density (OD) was detected using a microplate reader at 490 nm.

2,4-dinitrophenylhydrazine colorimetric assay

The cells were collected and centrifuged at 255 × g for 2 min at room temperature to obtain the supernatant. The lactate dehydrogenase (LDH) levels were determined by 2,4-dinitrophenylhydrazine colorimetric assay (cat. no. A020-1-2; Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions. The OD value was determined using a microplate reader at 440 nm.

Flow cytometry

Early and late apoptosis were detected by flow cytometry to explore the effects of Dex, overexpression or knockdown of CHOP on H9C2 cells using the FITC/propidium iodide (PI) Apoptosis Detection Kit [cat. no. 70-AP101-100; Multisciences (Lianke) Biotech Co., Ltd.]. The cells were centrifuged at 1,000 × g at 4°C for 5 min to collect the sediments, blocked with 70% ethanol for 2 h at 4°C and dyed with Annexin V-fluorescein isothiocyanate and PI. Finally, the cells were analyzed by flow cytometry (BD FACScanto II; BD Biosciences) and FlowJo software (version 7.6.1; FlowJo LLC).

RT-qPCR

The relative mRNA expression levels of TNF-α, IL-1β, IL-6, CHOP and 78 kDa glucose-regulated protein (Grp78) in H9C2 cells were determined by RT-qPCR. Total RNAs were extracted from H9C2 cells using QIAshredder and an RNeasy Kit (Qiagen GmbH), and the RNA concentration was detected. A total of 1.0 µg RNA was reverse transcribed into cDNA using SuperScirpt™ II Reverse Transcriptase (Thermo Fisher Scientific, Inc.) with 5 µl First-Strand Buffer, 1 µl dNTP mix and 100 ng primers at 37°C for 60 min and 4°C for 5 min. Subsequently, qPCR was performed using SYBR Fast qPCR Mix (Invitrogen; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 15 min; denaturation 95°C for 10 sec; 40 cycles at 60°C for 30 sec (annealing) and at 72°C for 30 sec (extension); and final extension at 72°C for 7 min. The expression levels of RT-qPCR products were determined by the 2−ΔΔCq method (24). GADPH served as the internal reference, and the primer sequences are presented in Table I.

Table I.

Primer sequences used for RT-qPCR.

Table I.

Primer sequences used for RT-qPCR.

PrimerSequences (5′→3′)
TNF-αForward: ATGGGCTCCCTCTCATCAGT
Reverse: GCTTGGTGGTTTGCTACGAC
IL-1βForward: TCCTCGTGACTCGTGGGAT
Reverse: GGTGTGCAGATGCCGGTTCAG
IL-6Forward: CCAGTTGCCTTCTTGGGACT
Reverse: GGTCTGTTGTGGGTGGTATCC
Grp78Forward: GGTGCAGCAGGACATCAAGTT
Reverse: CCCACCTCCAATATCAACTTGA
CHOPForward: CTGGAAGCCTGGTATGAGGAT
Reverse: CAGGGTCAAGAGTAGTGAAGGT
GAPDHForward: AGAAGGCTGG GGCTCATTTG
Reverse: AGGGGCCATC CACAGTCTTC

[i] TNF, tumor necrosis factor; IL, interleukin; Grp78, glucose-regulated protein-78; CHOP, C/EBP-homologous protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blotting

The protein expression levels of CHOP and Grp78 were measured by western blotting. The total proteins of H9C2 cells were harvested by radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology), and the protein concentration was measured by a bicinchoninic acid protein assay (Bio-Rad Laboratories, Inc.). The proteins (20 µg/lane) were separated by SDS-PAGE and electrotransferred to PVDF membranes, which were blocked with 5% skimmed milk at room temperature for 1 h. The membranes were then incubated with CHOP (1:200; cat. no. ab11419; Abcam), Grp78 (1:100; cat. no. ab21685; Abcam) and GAPDH (1:10,000; cat. no. ab181602; Abcam) primary antibodies at 4°C overnight. The membranes were rinsed with TBST (0.05% Tween-20) and incubated with the specific horseradish peroxide-conjugated secondary antibodies for CHOP (goat anti-mouse; 1:2,000; cat. no. ab205719; Abcam), Grp78 (goat anti-rabbit; 1:5,000; cat. no. ab205718; Abcam) and GAPDH (goat anti-rabbit; 1:1,000; cat. no. ab6721; Abcam) for 2 h at room temperature. The protein bands were visualized by enhanced chemiluminescence reagent (Thermo Fisher Scientific, Inc.). Protein expression was quantified using Quantity One software (version 4.4; Bio-Rad Laboratories, Inc.).

ELISA

The cells were treated and suspended, the culture supernatants were collected into a 1-ml centrifuge tube and centrifuged at 3,000 × g for 10 min at room temperature, and the supernatant was collected. The levels of superoxide dismutase (SOD), nitric oxide (NO) and malondialdelyde (MDA) were measured using ELISA kits (SOD, cat. no. 19160; Sigma-Aldrich; Merck KGaA; NO, cat. no. S0021; Beyotime Institute of Biotechnology; MDA, cat. no. MAK085c; Sigma-Aldrich; Merck KGaA) according to the manufacturers' instructions. The absorbance was measured at 450 nm using an Infinite M200 PRO microplate reader (Tecan Group, Ltd.).

Statistical analysis

SPSS 17.0 (SPSS, Inc.) software was used for data analysis. The data are presented as the mean ± standard deviation from three independent experiments. One-way ANOVA with Tukey's post hoc test was used for multiple group analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of Dex on cell viability, LDH level, apoptosis and expression of inflammatory factors in H9C2 cells

The H9C2 cells were induced by H/R, and cell viability was detected by MTT assay. The results demonstrated that H9C2 cell viability was significantly lower in the H/R group compared with that in the control group, and that the Dex+H/R group exhibited significantly higher cell viability compared with that in the H/R group (Fig. 1A). Additionally, LDH levels were significantly higher in the H/R group compared with the control and Dex+H/R groups (Fig. 1B). The results also demonstrated a higher apoptotic rate in the H/R group compared with that in the control group, and the apoptotic rate was significantly lower in the Dex+H/R group compared with the H/R group (Fig. 1C and D). In the H/R group, the expression levels of TNF-α, IL-1β and IL-6 were significantly higher compared with those in the control group, whereas the levels of TNF-α, IL-1β and IL-6 were significantly lower in the Dex+H/R group compared with those in the H/R group (Fig. 2A).

Figure 1.

Effects of H/R and Dex on cell viability, LDH level and apoptosis in H9C2 cells. (A) Cell viability of H9C2 cells was determined by MTT assay at 24 h. (B) LDH levels of H9C2 cells were determined by 2,4-dinitrophenylhydrazine colorimetric assay. (C and D) Apoptotic rates of H9C2 cells were determined by flow cytometry. **P<0.001 vs. control; ##P<0.001 vs. H/R. H/R, hypoxia/reoxygenation; Dex, dexmedetomidine; LDH, lactate dehydrogenase; OD, optical density; PI, propidium iodide.

Figure 2.

Expression levels of inflammatory factors and the CHOP signaling pathway in H9C2 cells. (A) Expression levels of TNF-α, IL-1β and IL-6 in H9C2 cells determined by RT-qPCR. (B-D) Expression levels of CHOP and Grp78 in H9C2 cells were determined by (B and C) western blotting and (D) RT-qPCR. **P<0.001 vs. control; #P<0.05, ##P<0.001 vs. H/R. CHOP, C/EBP-homologous protein; TNF, tumor necrosis factor; IL, interleukin; RT-qPCR, reverse transcription-quantitative PCR; Dex, dexmedetomidine; H/R, hypoxia/reoxygenation.

Dex affects the CHOP signaling pathway

CHOP and Grp78 expression levels were determined by RT-qPCR and western blotting. Both mRNA and protein expression levels of CHOP and Grp78 were significantly upregulated in the H/R group compared with the control group, whereas in the Dex-+H/R group, CHOP and Grp78 expression levels were significantly lower compared with those in the H/R group (Fig. 2B-D).

Effects of silencing CHOP on cell viability, LDH level, apoptosis and expression of inflammatory factors and Grp78 in H9C2 cells

siCHOP was transfected into H9C2 cells, and the transfection efficiency was measured by western blotting. The expression of CHOP in the siCHOP group was significantly lower compared with the control and siNC groups (Fig. 3). In addition, MTT assay revealed that the cell viability was significantly higher in the siCHOP+Dex+H/R group compared with the siNC+Dex+H/R group (Fig. 4A). In addition, the LDH levels and apoptotic rates were significantly lower in the siCHOP+ Dex+H/R group compared with the H/R and siNC+ Dex+H/R groups (Fig. 4B-D). In the H/R group, the expression levels of TNF-α, IL-1β and IL-6 were significantly higher compared with the control group; by contrast, the expression levels of TNF-α, IL-1β and IL-6 were significantly lower in the Dex+H/R and siCHOP+ Dex+H/R groups compared with the H/R and siNC+ Dex+H/R groups (Fig. 5A). Furthermore, the protein and mRNA expression levels of Grp78 were significantly elevated in the H/R group compared with the control, whereas the expression levels of Grp78 were lower in the Dex+H/R and siCHOP+ Dex+H/R groups compared with the H/R and siNC+H/R groups (Fig. 5B-D).

Figure 3.

Transfection efficiency of siCHOP in H9C2 cells. (A and B) CHOP protein and (C) mRNA expression levels relative to GAPDH in control cells or cells transfected with siNC or siCHOP were determined by (A and B) western blotting and (C) RT-qPCR, respectively. **P<0.001 vs. control; ##P<0.001 vs. siNC. CHOP, C/EBP-homologous protein; si, small interfering; NC, negative control; RT-qPCR, reverse transcription-quantitative PCR.

Figure 4.

Effects of CHOP silencing on cell viability, LDH level and apoptosis in H9C2 cells. (A) Cell viability of H9C2 cells was determined by MTT assay at 24 h. (B) LDH levels of H9C2 cells were determined by 2,4-dinitrophenylhydrazine colorimetric assay. (C and D) Apoptotic rates of H9C2 cells were determined by flow cytometry. **P<0.001 vs. control; ##P<0.001 vs. H/R; ^^P<0.001 vs. siNC+Dex+HR. CHOP, C/EBP-homologous protein; LDH, lactate dehydrogenase, H/R, hypoxia/reoxygenation; Dex, dexmedetomidine; si, small interfering; NC, negative control; OD, optical density; PI, propidium iodide.

Figure 5.

Effects of CHOP silencing on the expression of inflammatory factors and Grp78 in H9C2 cells. (A) Expression levels of TNF-α, IL-1β and IL-6 in H9C2 cells were detected by RT-qPCR. (B-D) Expression levels of Grp78 in H9C2 cells were determined by (B and C) western blotting and (D) RT-qPCR. **P<0.001 vs. control; #P<0.05, ##P<0.001 vs. H/R; ^P<0.05, ^^P<0.001 vs. siNC+Dex+HR. TNF, tumor necrosis factor; IL, interleukin; RT-qPCR, reverse transcription-quantitative PCR; Dex, dexmedetomidine; H/R, hypoxia/reoxygenation; si, small interfering; NC, negative control; CHOP, C/EBP-homologous protein.

Effects of CHOP overexpression on cell viability, LDH level, apoptosis and expression of inflammatory factors and Grp78 in H9C2 cells

The CHOP overexpression plasmid was transfected into H9C2 cells, and significantly higher levels of CHOP were observed in the CHOP group compared with the control and NC groups (Fig. 6A-C). The effect of CHOP overexpression on cell viability was then measured; compared with the H/R and Dex+H/R groups, cell viability was significantly lower in the CHOP+Dex+H/R group (Fig. 6D). The CHOP+Dex+H/R group exhibited significantly higher LDH levels and apoptotic rates compared with the H/R and Dex+H/R groups (Fig. 6E-G). Furthermore, the expression levels of TNF-α, IL-1β and IL-6 were significantly lower in the Dex+H/R and NC+Dex+H/R groups, but significantly higher in the CHOP+Dex+H/R group compared with the H/R group (Fig. 7A). The Grp78 protein and mRNA expression levels were significantly higher in the CHOP+Dex+H/R group compared with the Dex+H/R group (Fig. 7B-D).

Figure 6.

Transfection efficiency of CHOP and effects of CHOP overexpression on cell viability, LDH level and apoptosis in H9C2 cells. (A-C) Expression levels of CHOP were determined by (A and B) western blotting and (C) RT-qPCR. (D) Cell viability of H9C2 cells was determined by MTT assay at 24 h. (E) LDH levels of H9C2 cells determined by 2,4-dinitrophenylhydrazine colorimetric assay. (F and G) Apoptotic rates of H9C2 cells were determined by flow cytometry. **P<0.001 vs. Control; ##P<0.001 vs. NC or H/R; &&P<0.001 vs. Dex+H/R; ^^P<0.001 vs. NC+Dex+HR. CHOP, C/EBP-homologous protein; RT-qPCR, reverse transcription-quantitative PC; LDH, lactate dehydrogenase; H/R, hypoxia/reoxygenation; Dex, dexmedetomidine; NC, negative control; OD, optical density; PI, propidium iodide.

Figure 7.

Effects of CHOP overexpression on the expression levels of inflammatory factors and Grp78 in H9C2 cells. (A) Expressions of TNF-α, IL-1β and IL-6 in H9C2 were detected by RT-qPCR. (B and C) Protein and (D) mRNA expression levels of Grp78 in H9C2 cells were determined by (B and C) western blotting (D) and RT-qPCR. *P<0.05, **P<0.001 vs. H/R; #P<0.05, ##P<0.001 vs. Dex+H/R; ^P<0.05, ^^P<0.001 vs. NC+Dex+H/R. TNF, tumor necrosis factor; IL, interleukin; RT-qPCR, reverse transcription-quantitative PCR; Dex, dexmedetomidine; H/R, hypoxia/reoxygenation; NC, negative control; CHOP, C/EBP-homologous protein.

Effects of silencing CHOP on the SOD activity and NO and MDA levels in H/R-induced H9C2 cells

The effects of silencing CHOP on H/R-induced H9C2 cells were further observed by measuring SOD activity, as well as MDA and NO levels. The results demonstrated that the SOD activity was significantly decreased in the H/R-group compared with the control group, and that the SOD activity was significantly higher in the Dex+H/R and siCHOP+Dex+H/R groups compared with that in the H/R and siNC+Dex+H/R groups, respectively (Fig. 8A). In addition, the NO and MDA levels were significantly higher in the H/R group compared with the control group, but significantly lower in the Dex+H/R and siCHOP+ Dex+H/R groups compared with the HR and siNC+ Dex+H/R groups (Fig. 8B and C).

Figure 8.

Effects of CHOP knockdown on the SOD activity, and NO and MDA levels in H/R-induced H9C2 cells. The levels of (A) SOD, (B) NO and (C) MDA were measured using ELISA kits. **P<0.001 vs. H/R; #P<0.05 and ##P<0.001 vs. Dex+H/R; ^P<0.05 and ^^P<0.001 vs. siNC+Dex+H/R. CHOP, C/EBP-homologous protein; SOD, superoxide dismutase; NO, nitric oxide; MDA, malondialdelyde; H/R, hypoxia/reoxygenation; Dex, dexmedetomidine; si, small interfering; NC, negative control.

Discussion

Dex has been demonstrated to reduce H/R-induced damage in primary neonatal rat cardiomyocytes (25). In addition, Dex reduces H2O2-induced cardiomyocyte apoptosis in neonatal rats through mitochondrial and endoplasmic reticulum-mediated oxidative stress pathways (26). To explore the mechanism of Dex pretreatment in the present study, an H/R model was constructed in H9C2 cells using sodium dithionite. Sodium dithionite depletes oxygen in the culture medium and simulates an anoxic environment, which causes hypoxic injury in cells without damaging the cell membrane; thus, it is frequently used to induce H/R injury in cells (27,28). In the present study, the H/R model was established with or without the pretreatment of Dex; the results demonstrated that H/R significantly reduced the viability of H9C2 cells, promoted apoptosis and increased the expression levels of LDH and inflammatory factors, whereas Dex pretreatment prior to H/R increased the cell viability and suppressed the release of LDH and inflammatory factors. LDH occurs ubiquitously in cardiomyocytes and is released into the blood upon damage to the cell membrane (29). Accordingly, the level of LDH in the supernatant of the culture medium may reflect the degree of cardiomyocyte injury (30–32). In corroboration with the results of the present study, previous studies have demonstrated that the level of LDH is significantly higher in the H/R-induced I/R injury compared with the control in cardiomyocytes (33–35). The inflammatory factors TNF-α, IL-1β and IL-6 are commonly recognized as inflammatory indicators (36). TNF-α and IL-1β are responsible for the stimulation of chemokines and the secretion of adhesion molecules in ischemic tissues, and IL-6 is responsible for the regulation of inflammation (37,38). Previous studies have reported that Dex induces multiple protective effects on MIRI (39), and such findings were further supported by the present study. Yu et al (40) have reported that microRNA-665 and Dex protect cardiomyocytes against I/R injury caused by oxide stress and suppress apoptosis. Additionally, by inhibiting the expression of inflammatory cytokines, Dex attenuates the I/R injury induced by bilateral renal pedicle clamping (41).

The present study further explored the effects of CHOP on H9C2 cells induced by H/R. Yang et al (42) have observed that the expression levels of CHOP and Grp78 are significantly upregulated in cardiomyocytes following I/R. During the H/R process, high CHOP and Grp78 expression levels in H9C2 cells are present (43). CHOP serves a role in the apoptosis signaling pathways (44,45). CHOP and Grp78 are endoplasmic reticulum (ER) stress proteins and are widely recognized as ER stress markers (46). Evidence suggests important roles for ER stress proteins in the cardiomyocyte apoptosis caused by H/R process and its regulation on CHOP in ER stress-induced autophagy (47,48). In H/R-induced H9C2 cell autophagy, the high expression level of CHOP is reduced by the inhibition of ER stress (49). Liu et al (26) have reported that Dex alleviates cardiomyocyte apoptosis induced by H2O2 via ER stress pathways. Furthermore, Dex treatment has been observed to attenuate cerebral I/R injury by moderating the protein kinase RNA-like endoplasmic reticulum kinase/CHOP/Caspase-11 pathway through inhibition of the expression of ER stress-related apoptotic pathway proteins (50). In human umbilical vein endothelial cells, pretreatment with Dex increases cell the survival rate, decreases expression of CHOP and caspase-3 protein, and the apoptotic rate of H/R-induced cells, suggesting a possible association between Dex and the CHOP signaling pathway in H/R induced apoptosis (51). In the present study, western blotting and RT-qPCR demonstrated that pretreatment with Dex significantly suppressed the H/R-induced high expression levels of CHOP and Grp78, suggesting a potential association between Dex and the CHOP signaling pathway. Additionally, in H/R-injured cells, knockdown of CHOP expression promoted cell viability, inhibited apoptosis and suppressed the release of LDH and expression of inflammatory factors and Grp78, whereas the overexpression of CHOP aggravated the cell injury induced by H/R. These results suggested that the block of CHOP may attenuate the negative effects of H/R on cell viability and apoptosis, release of LDH and the expression of inflammatory factors and Grp78 of H9C2 cells, and that the overexpression of CHOP inhibited the protective effects of Dex on cardiomyocytes.

However, the present study is still not rigorous enough; the effects of Dex on the cardiomyocytes of H/R-injured neonatal mice need further research. In future studies, an H/R injury mouse model will be established or neonatal mouse cardiomyocytes will be selected for research.

In conclusion, the present study explored the effects of Dex on H/R-induced H9C2 cells and observed that the pretreatment with Dex may alleviate H/R-induced cell injury through regulating the CHOP pathway.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

XS, ZL and JL made substantial contributions to the conception and design of the study, data acquisition, analysis and interpretation, drafted the manuscript and critically revised it for important intellectual content. All authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Kloner RA, Shi J, Dai W, Carreno J and Zhao L: Remote ischemic conditioning in acute myocardial infarction and shock states. J Cardiovasc Pharmacol Ther. 25:3307–109. 2020. View Article : Google Scholar

2 

Cooper WA, Corvera JS, Thourani VH, Puskas JD, Craver JM, Lattouf OM and Guyton RA: Perfusion-assisted direct coronary artery bypass provides early reperfusion of ischemic myocardium and facilitates complete revascularization. Ann Thorac Surg. 75:1132–1139. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Walker AC and Johnson NJ: Critical care of the post-cardiac arrest patient. Cardiol Clin. 36:419–428. 2018. View Article : Google Scholar : PubMed/NCBI

4 

Wu D, Wang J, Li H, Xue M, Ji A and Li Y: Role of hydrogen sulfide in ischemia-reperfusion injury. Oxid Med Cell Longev. 2015:1869082015. View Article : Google Scholar : PubMed/NCBI

5 

Faust KB, Chiantella V, Vinten-Johansen J and Meredith JH: Oxygen-derived free radical scavengers and skeletal muscle ischemic/reperfusion injury. Am Surg. 54:709–719. 1988.PubMed/NCBI

6 

Dong HJ, Li J, Zhan H, Li Y and Su RB: Tea polyphenols promote cardiac function and energy metabolism in ex vivo rat heart with ischemic/reperfusion injury and inhibit calcium inward current in cultured rat cardiac myocytes. Nan Fang Yi Ke Da Xue Xue Bao. 36:604–608. 2016.PubMed/NCBI

7 

Li JP, Guo LL, Chen Z, Wang R and Wang J: Relationship between calcium overload and myocardial ischemia reperfusion injury and intervention strategy of Chinese herbal medicine. Zhongguo Zhong Yao Za Zhi. 41:2168–2173. 2016.(In Chinese). PubMed/NCBI

8 

Francis A and Baynosa R: Ischaemia-reperfusion injury and hyperbaric oxygen pathways: A review of cellular mechanisms. Diving Hyperb Med. 47:110–117. 2017.PubMed/NCBI

9 

Zendedel A, Gharibi Z, Anbari K, Abbaszadeh A, Khayat ZK, Khorramabadi RM, Soleymaninejad M and Gholami M: Selenium ameliorate peripheral nerve ischemic-reperfusion injury via decreased TNF-α. Biol Trace Elem Res. 176:328–337. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Halladin NL: Oxidative and inflammatory biomarkers of ischemia and reperfusion injuries. Dan Med J. 62:B50542015.PubMed/NCBI

11 

Laubach VE and Sharma AK: Mechanisms of lung ischemia-reperfusion injury. Curr Opin Organ Transplant. 21:246–252. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Li Y, Zhu X, Liu X, Du A and Yu B: miR-200a mediates protection of thymosin β-4 in cardiac microvascular endothelial cells as a novel mechanism under hypoxia-reoxygenation injury. J Cell Biochem. 120:19098–19106. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Gao C, Wang R, Li B, Guo Y, Yin T, Xia Y, Zhang F, Lian K, Liu Y, Wang H, et al: TXNIP/Redd1 signalling and excessive autophagy: A novel mechanism of myocardial ischaemia/reperfusion injury in mice. Cardiovasc Res. 116:645–657. 2020. View Article : Google Scholar : PubMed/NCBI

14 

Manning JR, Thapa D, Zhang M, Stoner MW, Traba J, Corey C, Shiva S, Sack MN and Scott I: Loss of GCN5L1 in cardiac cells disrupts glucose metabolism and promotes cell death via reduced Akt/mTORC2 signaling. Biochem J. 476:1713–1724. 2019. View Article : Google Scholar : PubMed/NCBI

15 

El Baz MM and Farahat TEM: Efficacy of adding dexmedetomidine to intra-articular levobupivacaine on postoperative pain after knee arthroscopy. Anesth Essays Res. 13:254–258. 2019. View Article : Google Scholar : PubMed/NCBI

16 

Sha J, Zhang H, Zhao Y, Feng X, Hu X, Wang C, Song M and Fan H: Dexmedetomidine attenuates lipopolysaccharide-induced liver oxidative stress and cell apoptosis in rats by increasing GSK-3β/MKP-1/Nrf2 pathway activity via the α2 adrenergic receptor. Toxicol Appl Pharmacol. 364:144–152. 2019. View Article : Google Scholar : PubMed/NCBI

17 

Chen L, Cao J, Cao D, Wang M, Xiang H, Yang Y, Ying T and Cong H: Protective effect of dexmedetomidine against diabetic hyperglycemia-exacerbated cerebral ischemia/reperfusion injury: An in vivo and in vitro study. Life Sci. 235:1165532019. View Article : Google Scholar : PubMed/NCBI

18 

Chen N, Chen X, Xie J, Wu C and Qian J: Dexmedetomidine protects aged rats from postoperative cognitive dysfunction by alleviating hippocampal inflammation. Mol Med Rep. 20:2119–2126. 2019.PubMed/NCBI

19 

Wang Q, Tan Y, Zhang N, Xu Y, Wei W, She Y, Bi X, Zhao B and Ruan X: Dexmedetomidine inhibits activation of the MAPK pathway and protects PC12 and NG108-15 cells from lidocaine-induced cytotoxicity at its maximum safe dose. Biomed Pharmacother. 91:162–166. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Yang CL, Tsai PS and Huang CJ: Effects of dexmedetomidine on regulating pulmonary inflammation in a rat model of ventilator-induced lung injury. Acta Anaesthesiol Taiwan. 46:151–159. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Jacob H, Stanisavljevic L, Storli KE, Hestetun KE, Dahl O and Myklebust MP: A four-microRNA classifier as a novel prognostic marker for tumor recurrence in stage II colon cancer. Sci Rep. 8:61572018. View Article : Google Scholar : PubMed/NCBI

22 

Liu YJ, Wang DY, Yang YJ and Lei WF: Effects and mechanism of dexmedetomidine on neuronal cell injury induced by hypoxia-ischemia. BMC Anesthesiol. 17:1172017. View Article : Google Scholar : PubMed/NCBI

23 

Gonzalez Villarreal C, Said Fernandez S, Soto Dominguez A, Padilla Rivas G, Garza Treviño E, Rodriguez Rocha H and Martinez Rodriguez H: Bone marrow mesenchymal stem cells: Improving transgene expression level, transfection efficiency and cell viability. J BUON. 23:1893–1903. 2018.PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Peng K, Qiu Y, Li J, Zhang ZC and Ji FH: Dexmedetomidine attenuates hypoxia/reoxygenation injury in primary neonatal rat cardiomyocytes. Exp Ther Med. 14:689–695. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Liu XR, Li T, Cao L, Yu YY, Chen LL, Fan XH, Yang BB and Tan XQ: Dexmedetomidine attenuates H2O2-induced neonatal rat cardiomyocytes apoptosis through mitochondria- and ER-medicated oxidative stress pathways. Mol Med Rep. 17:7258–7264. 2018.PubMed/NCBI

27 

Jiang J, Chen DY, Liu ZT, Chen F, Zhang JJ, Cui J and Pang J: Effect of N-perfluorooctane on hypoxia/reoxygenation injury in human umbilical vein endothelial cells. Acta Cardiol Sin. 32:716–722. 2016.PubMed/NCBI

28 

Chai YL, Xu JZ, Zhang YL and Sheng GT: Effects of probucol on cultured human umbilical vein endothelial cells injured by hypoxia/reoxygenation. Genet Mol Res. 15:150167522016. View Article : Google Scholar : PubMed/NCBI

29 

Lin CX, Gu JL and Cao JM: The acute toxic effects of platinum nanoparticles on ion channels, transmembrane potentials of cardiomyocytes in vitro and heart rhythm in vivo in mice. Int J Nanomedicine. 14:5595–5609. 2019. View Article : Google Scholar : PubMed/NCBI

30 

Fan L, Zhou W, Zhang L, Jiang D, Zhao Q and Liu L: Sitagliptin protects against hypoxia/reoxygenation (H/R)-induced cardiac microvascular endothelial cell injury. Am J Transl Res. 11:2099–2107. 2019.PubMed/NCBI

31 

Kong QR, Ji DM, Li FR, Sun HY and Wang QX: MicroRNA-221 promotes myocardial apoptosis caused by myocardial ischemia-reperfusion by down-regulating PTEN. Eur Rev Med Pharmacol Sci. 23:3967–3975. 2019.PubMed/NCBI

32 

Zhang Y, Zhang H, Zhang Z, Li S, Jiang W, Li X and Lv J: lncRNA MALAT1 cessation antagonizes hypoxia/reoxygenation injury in hepatocytes by inhibiting apoptosis and inflammation via the HMGB1-TLR4 axis. Mol Immunol. 112:22–29. 2019. View Article : Google Scholar : PubMed/NCBI

33 

Ge L, Cai Y, Ying F, Liu H, Zhang D, He Y, Pang L, Yan D, Xu A, Ma H and Xia Z: miR-181c-5p exacerbates hypoxia/reoxygenation-induced cardiomyocyte apoptosis via targeting PTPN4. Oxid Med Cell Longev. 2019:19579202019. View Article : Google Scholar : PubMed/NCBI

34 

Chen Y, Wang H, Zhang Y, Wang Z, Liu S and Cui L: Pretreatment of ghrelin protects H9c2 cells against hypoxia/reoxygenation-induced cell death via PI3K/AKT and AMPK pathways. Artif Cells Nanomed Biotechnol. 47:2179–2187. 2019. View Article : Google Scholar : PubMed/NCBI

35 

Yang H, Wang C, Zhang L, Lv J and Ni H: Rutin alleviates hypoxia/reoxygenation-induced injury in myocardial cells by up-regulating SIRT1 expression. Chem Biol Interact. 297:44–49. 2019. View Article : Google Scholar : PubMed/NCBI

36 

Soomro AH, Khan E, Noori S, Lone MA, Syal Z and Sheikh S: Assessment of cytokine release against oral mucosal cell line culture (TR146) stimulated by neutrophil elastase associated with Behcet's disease. Int J Dent. 2019:60956282019. View Article : Google Scholar : PubMed/NCBI

37 

Zhang Q, Weng Y, Jiang Y, Zhao S, Zhou D and Xu N: Overexpression of miR-140-5p inhibits lipopolysaccharide-induced human intervertebral disc inflammation and degeneration by downregulating toll-like receptor 4. Oncol Rep. 40:793–802. 2018.PubMed/NCBI

38 

Peters MC, McGrath KW, Hawkins GA, Hastie AT, Levy BD, Israel E, Phillips BR, Mauger DT, Comhair SA, Erzurum SC, et al: Plasma interleukin-6 concentrations, metabolic dysfunction, and asthma severity: A cross-sectional analysis of two cohorts. Lancet Respir Med. 4:574–584. 2016. View Article : Google Scholar : PubMed/NCBI

39 

Ren J, Li C, Liu Y, Liu H and Dong Z: Protective effect of dexmedetomidine against myocardial ischemia-reperfusion injury in rabbits. Acta Cir Bras. 33:22–30. 2018. View Article : Google Scholar : PubMed/NCBI

40 

Yu J, Yang W, Wang W, Wang Z, Pu Y, Chen H, Wang F and Qian J: Involvement of miR-665 in protection effect of dexmedetomidine against oxidative stress injury in myocardial cells via CB2 and CK1. Biomed Pharmacother. 115:1088942019. View Article : Google Scholar : PubMed/NCBI

41 

Xu Z, Wang D, Zhou Z, Chen Q, Zhang D, Chen S, Jiang H, Jia C and Liu X: Dexmedetomidine attenuates renal and myocardial ischemia/reperfusion injury in a dose-dependent manner by inhibiting inflammatory response. Ann Clin Lab Sci. 49:31–35. 2019.PubMed/NCBI

42 

Yang TR, Zhang T, Mu NH, Ruan LB, Duan JL, Zhang RP and Miao YB: Resina draconis inhibits the endoplasmic-reticulum-induced apoptosis of myocardial cells via regulating miR-423-3p/ERK signaling pathway in a tree shrew myocardial ischemia-reperfusion model. J Biosci. 44:532019. View Article : Google Scholar : PubMed/NCBI

43 

Guan G, Zhang J, Liu S, Huang W, Gong Y and Gu X: Glucagon-like peptide-1 attenuates endoplasmic reticulum stress-induced apoptosis in H9c2 cardiomyocytes during hypoxia/reoxygenation through the GLP-1R/PI3K/Akt pathways. Naunyn Schmiedebergs Arch Pharmacol. 392:715–722. 2019. View Article : Google Scholar : PubMed/NCBI

44 

Hu H, Tian M, Ding C and Yu S: The C/EBP homologous protein (CHOP) transcription factor functions in endoplasmic reticulum stress-induced apoptosis and microbial infection. Front Immunol. 9:30832019. View Article : Google Scholar : PubMed/NCBI

45 

Zhao J, Xiang X, Zhang H, Jiang D, Liang Y, Qing W, Liu L, Zhao Q and He Z: CHOP induces apoptosis by affecting brain iron metabolism in rats with subarachnoid hemorrhage. Exp Neurol. 302:22–33. 2018. View Article : Google Scholar : PubMed/NCBI

46 

Lei Y, Wang S, Ren B, Wang J, Chen J, Lu J, Zhan S, Fu Y, Huang L and Tan J: CHOP favors endoplasmic reticulum stress-induced apoptosis in hepatocellular carcinoma cells via inhibition of autophagy. PLoS One. 12:e01836802017. View Article : Google Scholar : PubMed/NCBI

47 

Xu JQ, Chen B, Hu HX, Yue RC, Zhang S, Xu L, Wang H, Li Q, Tan CY, Chen HY and Zhang RY: Lycopene protects against hypoxia/reoxygenation injury in mouse cardiomyocytes by inhibiting endoplasmic reticulum stress induced apoptosis. Zhonghua Xin Xue Guan Bing Za Zhi. 44:518–523. 2016.(In Chinese). PubMed/NCBI

48 

Cao L, Chen Y, Zhang Z, Li Y and Zhao P: Endoplasmic reticulum stress-induced NLRP1 inflammasome activation contributes to myocardial ischemia/reperfusion injury. Shock. 51:511–518. 2019. View Article : Google Scholar : PubMed/NCBI

49 

Guan G, Yang L, Huang W, Zhang J, Zhang P, Yu H, Liu S and Gu X: Mechanism of interactions between endoplasmic reticulum stress and autophagy in hypoxia/reoxygenation-nduced injury of H9c2 cardiomyocytes. Mol Med Rep. 20:350–358. 2019.PubMed/NCBI

50 

Liu C, Fu Q, Mu R, Wang F, Zhou C, Zhang L, Yu B, Zhang Y, Fang T and Tian F: Dexmedetomidine alleviates cerebral ischemia-reperfusion injury by inhibiting endoplasmic reticulum stress dependent apoptosis through the PERK-CHOP-Caspase-11 pathway. Brain Res. 1701:246–254. 2018. View Article : Google Scholar : PubMed/NCBI

51 

Yang C, Gao C, Yu M, Li B, Lu Y and Lü G: Effect of dexmedetomidine pretreatment on hypoxia/reoxygenation-induced injury in human umbilical vein endothelial cells and the possible mechanism. Zhonghua Yi Xue Za Zhi. 94:3527–3530. 2014.(In Chinese). PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shi X, Liu Z and Li J: Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway. Mol Med Rep 22: 3307-3315, 2020.
APA
Shi, X., Liu, Z., & Li, J. (2020). Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway. Molecular Medicine Reports, 22, 3307-3315. https://doi.org/10.3892/mmr.2020.11442
MLA
Shi, X., Liu, Z., Li, J."Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway". Molecular Medicine Reports 22.4 (2020): 3307-3315.
Chicago
Shi, X., Liu, Z., Li, J."Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway". Molecular Medicine Reports 22, no. 4 (2020): 3307-3315. https://doi.org/10.3892/mmr.2020.11442
Copy and paste a formatted citation
x
Spandidos Publications style
Shi X, Liu Z and Li J: Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway. Mol Med Rep 22: 3307-3315, 2020.
APA
Shi, X., Liu, Z., & Li, J. (2020). Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway. Molecular Medicine Reports, 22, 3307-3315. https://doi.org/10.3892/mmr.2020.11442
MLA
Shi, X., Liu, Z., Li, J."Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway". Molecular Medicine Reports 22.4 (2020): 3307-3315.
Chicago
Shi, X., Liu, Z., Li, J."Protective effects of dexmedetomidine on hypoxia/reoxygenation injury in cardiomyocytes by regulating the CHOP signaling pathway". Molecular Medicine Reports 22, no. 4 (2020): 3307-3315. https://doi.org/10.3892/mmr.2020.11442
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team