Complement 1q protects MRL/lpr mice against lupus nephritis via inhibiting the nuclear factor-κB pathway

  • Authors:
    • Juanjuan Sun
    • Shuxia Guo
    • Fukun Niu
    • Defeng Liu
    • Yan Zhuang
  • View Affiliations

  • Published online on: October 14, 2020     https://doi.org/10.3892/mmr.2020.11588
  • Pages: 5436-5443
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Lupus nephritis (LN) is a kidney disorder that is a critical cause of mortality in patients with systemic lupus erythematosus. The present study aimed to explore the protective role of complement component 1q (C1q) on LN and the underlying mechanism involving the nuclear factor (NF)‑κB singling pathway. MRL/lpr mice served as the LN mouse model, and pcDNA‑C1q was injected into LN mice to determine the role of C1q. C1q mRNA expression was detected using reverse transcription‑quantitative PCR. Urine protein and blood urea nitrogen (BUN) levels were measured, and the histological damage index was determined using H&E staining. ELISA was used to measure the levels of tumor necrosis factor‑α (TNF‑α), interleukin (IL)‑1β, IL‑6, anti‑C1q and anti‑double stranded DNA (dsDNA). CD68‑ and Ki67‑positivity were detected using immunofluorescence, and NF‑κB‑related protein expression was examined using western blotting. C1q mRNA expression was downregulated in renal tissues of LN mice. Overexpression of C1q decreased urine protein, BUN levels and the histological damage index in LN mice. The levels of TNF‑α, IL‑1β, IL‑6, anti‑C1q and anti‑dsDNA in renal tissues of LN mice were also reduced after pcDNA‑C1q treatment. Additionally, overexpression of C1q decreased the CD68‑ and Ki67‑positivity in glomeruli and attenuated the expression of NF‑κB‑related proteins. Phorbol 12‑myristate 13‑acetate, an NF‑κB pathway activator, reversed the inhibitory effect of C1q on inflammation, macrophage infiltration and mesangial cell (MC) proliferation in renal tissues of LN mice. Thus, it was demonstrated that C1q ameliorated inflammation and macrophage infiltration and decreased MC proliferation in renal tissues of LN mice by inhibiting the NF-κB pathway.

Introduction

Lupus nephritis (LN) is a chronic and complex kidney disease (1) that is a frequent complication of systemic lupus erythematosus (2) and is usually associated with inflammatory cell infiltration and immune complex deposition in renal tissues (3). LN is clinically evident in ~50% of patients with systemic lupus erythematosus (4). In LN, ICs initiate the synthesis of various proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6, resulting in cellular infiltration and renal injury (5). The involvement of LN significantly increases patient morbidity and mortality rates (6). Patients with LN have a higher standardized mortality ratio (6-6.8 vs. 2.4) and lower survival rates compared with patients with systemic lupus erythematosus who do not have LN (7). LN pathogenesis is complex, and some patients with LN may develop end-stage renal disease (8). Therefore, it is essential to explore new approaches for the treatment of LN.

Complement component 1q (C1q) is a subcomponent of the C1 complex, which participates in the classical pathway of complement activation (9). C1q has numerous functions, including recognition of ICs and activation of the complement system (10). Previous studies have examined the relationship between LN and anti-C1q. For example, a significantly negative correlation between C1q and anti-C1q was found in patients with LN (11). Anti-C1q was also associated with proteinuria and renal activity score in patients with LN, and could serve as a potential biomarker of LN (12). In addition, high anti-C1q antibody titers are present in the blood of patients with LN, and the level of anti-C1q is related with disease progression (13). Anti-C1q has adequate specificity and sensitivity for LN diagnosis and can be used to evaluate renal activity (14); however, the underlying mechanism of C1q in the regulation of LN remains poorly understood.

Nuclear factor (NF)-κB not only participates in innate and adaptive immunity (15), but also is considered to be a proinflammatory transcription factor (16). The NF-κB pathway is related to several pathological processes in the kidneys, including immune response, inflammation and mesangial cell (MC) proliferation (1719). Deletion of NF-κB p65 was found to alleviate LN in mice (20). In LN, inhibition of the NF-κB pathway suppressed the inflammatory response (21), and blocking this pathway may decrease macrophage chemotaxis and MC proliferation (22). Nevertheless, the potential regulatory mechanism of C1q in relation to the NF-κB pathway in LN is still unknown.

In the present study, C1q expression in LN mice was evaluated and the regulatory effects of C1q on renal injury, inflammation, macrophage infiltration and MC proliferation was explored. The function of C1q in regulating NF-κB pathway activity in LN mice was also explored. These results may suggest a potential therapeutic target for LN.

Materials and methods

Animals

In total, 60 male MRL/lpr mice (used as an LN mouse model) and 15 C57BL/6 mice (age, 3 months; body weight, 18–22 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. Mice were maintained at 23–25°C and 50–55% relative humidity, and kept under a 12 h/12 h light/dark cycle with ad libitum access to food and water. The present study was performed with the approval of The Animal Ethics Committee of Linyi Central Hospital (Linyi, China).

Experimental design

pcDNA-C1q and pcDNA-negative control (NC) were obtained from Sangon Biotech Co., Ltd. After one week of adjustment, LN mice were divided into pc-NC, pcDNA-C1q and Sham groups, which were injected intraperitoneally with 1 mg/kg pc-NC, 1 mg/kg pcDNA-C1q or an equivalent quantity of normal saline, respectively (15 mice in each group). C57BL/6 mice without treatment acted as the BLANK group. In addition, LN mice in the C1q + Phorbol 12-myristate 13-acetate (PMA) group were injected intraperitoneally with 1 mg/kg pcDNA-C1q and treated with PMA (25 nM; Sigma-Aldrich; Merck KGaA).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from renal tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using the PrimeScript RT reagent kit (Takara Bio, Inc.). The reaction mixtures were incubated at 37°C for 60 min, 95°C for 5 min and then held at 4°C. miScript SYBR Green PCR kit (Qiagen, Inc.) was used to conduct qPCR. The qPCR reaction was performed on the ABI 7500HT Fast Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following conditions: 95°C for 3 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec, and a final extension step at 72°C for 10 min. Relative expression was calculated using the 2−ΔΔCq method (23). GAPDH was used for normalization. Primer sequences are shown in Table I.

Table I.

Primer sequences used in reverse transcription-quantitative PCR.

Table I.

Primer sequences used in reverse transcription-quantitative PCR.

PrimerSequences (5′→3′)
Complement 1qF: GAAACAATGGGAACAATGGAG
R: TGCTGAAGGTGAAGAAATACA
GAPDHF: ACACCTTCTACAATGAGCTG
R: CTGCTTGCTGATCCACATCT

[i] F, forward; R, reverse.

Evaluation of renal function

The 24-h urine protein excretion was measured once every 2 weeks using Multistix 10SG reagent strips (Siemens Healthineers). After 4 weeks continuous treatment, mice were anesthetized by intraperitoneal administration of 50 mg/kg pentobarbital sodium and sacrificed by cervical dislocation. Blood samples and renal tissues were collected for future experiments. Blood urea nitrogen (BUN) levels were measured using an automatic biochemical analyzer (Hitachi, Ltd.).

H&E staining

Renal tissues were fixed in 4% paraformaldehyde for 24 h at 37°C, embedded in paraffin, cut into 4-µm thick sections, dewaxed in xylene and rehydrated with 90% ethanol at 37°C. Sections were then stained with hematoxylin for 2 min and eosin for 2 min at 37°C. Using light microscopy, the degree of histological damage in renal tissues was observed (magnification, ×400). The histological damage index of glomerulus was graded on a scale of 0–3 as previously described by Muraoka et al (24), where 0 = normal, 1 = mild (cell proliferation and/or cell infiltration), 2 = moderate (cell proliferation and/or cell infiltration with membrane proliferation) and 3 = severe (cell proliferation and/or cell infiltration, membrane proliferation and crescent formation and/or hyalinosis).

Western blotting

Renal tissues were lysed using ice-cold RIPA lysis buffer (Beyotime Institute of Biotechnology) to obtain total protein. The concentration of total protein was detected using a bicinchoninic acid protein concentration assay kit (Cell Signaling Technology, Inc.). Total protein (60 µg/lane) was separated using sodium dodecyl sulphate polyacrylamide gel electrophoresis (10% separating gum and 5% concentrating gum), and subsequently transferred onto a polyvinylidene fluoride membrane. The membranes were blocked with 5% skimmed milk for 1 h at 37°C. Then, membranes were incubated with primary antibodies overnight at 4°C. The antibodies used were as follows: Anti-IκBα (1:1,000; cat. no. 9242), anti-phosphorylated (p)-IκBα (1:1,000; cat. no. 2859), anti-NF-κB p65 (1:1,000; cat. no. 8242) and anti-p-NF-κB p65 (1:1,000; cat. no. 8214) (all CST Biological Reagents Co., Ltd.). Next, membranes were incubated with HRP-labelled goat anti-rabbit IgG (1:2,000; cat. no. I5006MSDS) and HRP-labelled goat anti-mouse IgG secondary antibodies (1:4,000; cat. no. 12-349; both purchased from Sigma-Aldrich; Merck KGaA) for 1 h at 25°C. Finally, protein bands were visualized using enhanced chemiluminescence exposure solution (Invitrogen; Thermo Fisher Scientific, Inc.) and semi-quantified using Quantity One 1-D software (version 4.62; Bio-Rad Laboratories, Inc.). GAPDH (1:1,000; cat. no. 100242-MM05; Sino Biological) was used as a loading control.

ELISA

Renal tissue homogenate from each group was centrifuged at 3,000 × g at 4°C for 10 min and the resulting supernatant was collected. Then, the levels of TNF-α (cat. no. ab236712), IL-1β (cat. no. ab197742), IL-6 (cat. no. ab100713) and anti-C1q (cat. no. ab170246) were measured using ELISA kits (all purchased from Abcam). The level of anti-dsDNA was measured by the automated Alegria® ELISA reader (Orgentec Diagnostika GmbH), according to the manufacturers instructions. The absorbance of each well was measured at 450 nm using an enzyme mark instrument (Thermo Fisher Scientific, Inc.).

Immunofluorescence staining

Frozen glomeruli sections (5 µm) were dried for 15 min at 25°C. After rinsing three times, sections were blocked in PBS containing 10% goat serum (cat. no. 16210064; Thermo Fisher Scientific, Inc.) for 1 h at 25°C. Glomeruli sections were incubated with anti-CD68 antibody (1 µg/ml; cat. no. ab201340) or anti-Ki67 antibody (1 µg/ml; cat. no. ab15580; both Abcam) overnight at 4°C, followed by incubation with Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:500; cat. no. ab150077; Abcam) for 1 h at 25°C. Glomeruli sections were counterstained with DAPI (2.5 ng/µl) at 25°C for 1 h, and the percentages of CD68- and Ki67-positivity were detected using immunofluorescence microscopy (magnification, ×400; Olympus Corporation). The CellProfiler 4.0 software (www.cellprofiler.org) was used to quantify the DAPI intensity at the peri-nucleolar region of ~100 individual cells.

Statistical analysis

Statistical analysis was performed with SPSS 23.0 (IBM Corp.). Data were presented as the mean ± SD. All experiments were repeated three times. Differences among multiple groups were analyzed using one-way ANOVA followed by Tukeys multiple comparisons test. Data of two groups were assessed using unpaired Students t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Overexpression of C1q alleviates renal injury in LN mice

Analysis using RT-qPCR indicated that C1q mRNA expression was decreased in MRL/lpr mice (LN mice) compared with C57BL/6 mice. C1q-overexpression was induced by transfecting pcDNA-C1q (Fig. 1A), and the urine protein and BUN levels were examined. Compared with the BLANK group, urine protein and BUN levels were significantly increased in the Sham group, whereas transfection of pcDNA-C1q significantly decreased these levels (P<0.01; Fig. 1B and C). ELISA analysis showed that the levels of serum anti-C1q and anti-dsDNA were significantly elevated in the Sham group compared with the BLANK group. Overexpression of C1q reduced the levels of serum anti-C1q and anti-dsDNA compared with the pc-NC group (Fig. 1D and E). Compared with the BLANK group, H&E staining showed a higher histological damage index of glomeruli in the Sham group. Additionally, the histological damage index was lower in the pcDNA-C1q group compared with that in the pc-NC group (Fig. 1F). These results suggested that C1q overexpression may attenuate renal injury in LN mice.

Overexpression of C1q attenuates renal inflammation in LN mice

ELISA analysis revealed that the levels of TNF-α, IL-6 and IL-1β in renal tissues in the Sham group were markedly increased compared with those in the BLANK group. Overexpression of C1q significantly reduced the levels of TNF-α, IL-6 and IL-1β in renal tissues in the pcDNA-C1q compared with the pc-NC group (Fig. 2A-C). Overall, these results indicated that C1q overexpression may alleviate the renal inflammation in LN mice.

Overexpression of C1q reduces macrophage infiltration and MC proliferation in renal tissues of LN mice

To investigate the effect of C1q on macrophage infiltration and the proliferation of MCs in the renal tissues of LN mice, the percentages of CD68- and Ki67-positivity were measured using immunofluorescence staining. The percentage of CD68-positivity in Sham group renal tissues was higher compared with that of the BLANK group. Furthermore, compared with the Sham group, this percentage was decreased in the pcDNA-C1q group (Fig. 3A). In addition, with the BLANK group, the percentage of Ki67-positivity in renal tissues was increased in the Sham group and was decreased by C1q-overexpression (Fig. 3B). Taken together, C1q overexpression may decrease macrophage infiltration and MC proliferation in renal tissues of LN mice.

Overexpression of C1q inhibits the NF-κB pathway in the renal tissues of LN mice

To evaluate the effect of C1q-overexpression on the NF-κB pathway in LN mouse renal tissues, the expression of NF-κB-related proteins was measured via western blotting. Compared with the BLANK group, the protein expression of p-IκBα/IκBα and p-NF-κB p65/NF-κB p65 in renal tissues was significantly increased in the Sham group. These levels in renal tissues were significantly decreased in the pcDNA-C1q group compared with the Sham group. PMA, an activator of the NF-κB pathway (25), was injected into the pcDNA-C1q-treated LN mice. Consequently, the inhibitory effect of C1q on the NF-κB pathway was attenuated by PMA compared with the pcDNA-C1q group (Fig. 4). These results demonstrated that C1q overexpression may inhibit the NF-κB pathway in the renal tissues of LN mice.

Overexpression of C1q ameliorates renal injury in LN mice via inhibiting the NF-κB pathway

PMA was administered to LN mice, and the levels of renal inflammatory factors were measured. The results showed that overexpression of C1q significantly decreased the levels of TNF-α, IL-1β and IL-6 in the renal tissues of LN mice (Fig. 5A). In addition, immunofluorescence staining demonstrated that the percentages of CD68- and Ki67-positivity in renal tissues were decreased in the pcDNA-C1q group compared with the pc-NC group (Fig. 5B and C). Moreover, PMA attenuated the effects of C1q on inflammatory factors and percentages of CD68- and Ki67-positivity in LN mice renal tissues (Fig. 5A-C). Overall this indicated that C1q overexpression may ameliorate renal injury by inhibiting the NF-κB pathway in LN mice.

Discussion

The MRL/lpr mouse model is frequently recognized as a suitable model of human LN (26,27). In the present study, C1q expression was decreased in LN mice. The 24-h urine protein and BUN levels are reliable measures of renal function in patients with LN (28,29), and, in the present study, these levels were decreased by C1q-overexpression in LN mice. Anti-C1q and anti-dsDNA are valuable biological markers for the prediction of human LN (30,31). It was shown in the present study that transfection of pcDNA-C1q significantly reduced the levels of serum anti-C1q and anti-dsDNA in LN mice. In addition, overexpression of C1q also decreased the histological damage index of glomeruli in LN mice. Taken together, these results suggested that C1q alleviates renal injury in LN mice through improving renal function and attenuating histological damage.

Proinflammatory cytokines play critical roles in the occurrence and developmental process of LN (32,33). For example, nucleotide-binding oligomerization domain-containing protein 2 was found to participate in LN pathogenesis through promoting the release of proinflammatory cytokines (34). Upregulation of microRNA-146a alleviated LN in patients via suppressing the gene expression of TNF-α, IL-1β and IL-6 (35). In the present study, overexpression of C1q significantly decreased the levels of proinflammatory cytokines in the renal tissues of LN mice. CD68-positivity is a macrophage marker in renal diseases (36). Macrophage infiltration in renal tissues induced by T cells is related to podocyte injury in patients with LN (37). Ki67 is a nuclear protein associated with the cell cycle and is used as a marker for MC proliferation in glomeruli (38). Normal MC proliferation is involved in maintaining glomerular function and structure (39). The results of the present study demonstrated that C1q-overexpression significantly reduced macrophage infiltration and MC proliferation in the renal tissues of LN mice. Together, these data indicated that C1q protected against LN by decreasing inflammation, macrophage infiltration and MC proliferation in renal tissues.

Previous research found that the NF-κB pathway participates in LN progression (40,41). In the present study, the expression of NF-κB-related proteins in the renal tissues of LN mice was significantly decreased by treatment with pcDNA-C1q, indicating that C1q inhibited the NF-κB pathway in these tissues. The NF-κB pathway was found to play a role in LN inflammation, and was ameliorated by demethylzeylasteral through attenuating the NF-κB pathway (42). NF-κB-related proteins are also related to the macrophage infiltration and MC proliferation in renal diseases. Curcumin alleviated macrophage infiltration of diabetic nephropathy by inhibiting NF-κB activation (43). Resveratrol reduced renal MC proliferation in diabetic nephropathy via downregulating the expression of NF-κB-related proteins (44). In the present study, it was found that overexpression of C1q decreased inflammation, macrophage infiltration and MC proliferation through inhibiting the NF-κB pathway in the renal tissues of LN mice. To further confirm this result, LN mice were treated with PMA, an NF-κB pathway activator (45). The results showed that PMA effectively reversed the inhibitory effect of C1q on inflammation, macrophage infiltration and MC proliferation in the renal tissues of LN mice. Taken together, it was demonstrated that C1q may protect against LN through inhibiting the NF-κB pathway.

The present study has some limitations. Firstly, only glomerular nephritis in mice was analyzed. Interstitial nephritis, another type of renal inflammation in LN mice (46), may more comprehensively reflect the histopathological changes in LN. Secondly, IFN-γ, a key regulator in renal tissues, was not detected. IFN-γ plays a role in the perpetuation of local inflammatory processes in the kidney by the activation of monocytes, macrophages or renal resident cells. The expression of IFN-γ in renal tissues may better reflect the inflammatory changes in LN. Finally, the detailed mechanism of action of C1q in LN remains to be studied. Further in vitro experiments are needed to identify the regulatory mechanism of C1q in the development of LN.

In summary, C1q expression was decreased in the renal tissues of LN mice. Overexpression of C1q alleviated inflammation and macrophage infiltration and inhibited MC proliferation in these tissues. The protective effect of C1q on LN was closely associated with the suppression of the NF-κB pathway. Therefore, C1q may be a promising therapeutic target for LN.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors contributions

JS conceived and designed the study, performed the data analyses and wrote the manuscript. SG, FN and DL contributed to the conception of the study. JS, SG, FN and DL performed the experiments. YZ contributed to analysis and manuscript preparation. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

The present study was approved by The Ethics Committee of Linyi Central Hospital (approval no. 2020013; Linyi, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests

References

1 

Davidson A, Aranow C and Mackay M: Lupus Nephritis: Challenges and progress. Curr Opin Rheumatol. 31:682–688. 2019. View Article : Google Scholar : PubMed/NCBI

2 

Cameron JS: Lupus Nephritis. J Am Soc Nephrol. 10:413–424. 1999.PubMed/NCBI

3 

Faurschou M, Dreyer L, Kamper AL, Starklint H and Jacobsen S: Long-term mortality and renal outcome in a cohort of 100 patients with lupus nephritis. Arthritis Care Res (Hoboken). 62:873–880. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Parikh SV, Almaani S, Brodsky S and Rovin BH: Update on lupus nephritis: Core curriculum 2020. Am J Kidney Dis. 76:265–281. 2020. View Article : Google Scholar : PubMed/NCBI

5 

Inoue A, Hasegawa H, Kohno M, Ito MR, Terada M, Imai T, Yoshie O, Nose M and Fujita S: Antagonist of fractalkine (CX3CL1) delays the initiation and ameliorates the progression of lupus nephritis in MRL/lpr mice. Arthritis Rheum. 52:1522–1533. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Mok CC, Kwok RC and Yip PS: Effect of renal disease on the standardized mortality ratio and life expectancy of patients with systemic lupus erythematosus. Arthritis Rheum. 65:2154–2160. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Almaani S, Meara A and Rovin BH: Update on lupus nephritis. Clin J Am Soc Nephrol. 12:825–835. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Houssiau FA and Ginzler EM: Current treatment of lupus nephritis. Lupus. 17:426–430. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Kishore U and Reid KBM: C1q: Structure, function, and receptors. Immunopharmacology. 49:159–170. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Liu G, Pang Y, Liu X and Li QW: Structure, distribution, classification, and function of C1q protein family: A review. Yi Chuan. 35:1072–1080. 2013.(In Chinese). View Article : Google Scholar : PubMed/NCBI

11 

Zhang FC, Zhou B and Dong Y: The roles of complement 1q and anti-C1q autoantibodies in pathogenesis of lupus nephritis. Zhonghua Yi Xue Za Zhi. 85:955–959. 2005.(In Chinese). PubMed/NCBI

12 

Akhter E, Burlingame RW, Seaman AL, Magder L and Petri M: Anti-C1q antibodies have higher correlation with flares of lupus nephritis than other serum markers. Lupus. 20:1267–1274. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Sinico RA, Radice A, Ikehata M, Giammarresi G, Corace C, Arrigo G, Bollini B and Li Vecchi M: Anti-C1q autoantibodies in lupus nephritis: Prevalence and clinical significance. Ann N Y Acad Sci. 1050:193–200. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Yin Y, Wu X, Shan G and Zhang X: Diagnostic value of serum anti-C1q antibodies in patients with lupus nephritis: A meta-analysis. Lupus. 21:1088–1097. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Mankan AK, Lawless MW, Gray SG, Kelleher D and McManus R: NF-κB regulation: The nuclear response. J Cell Mol Med. 13:631–643. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Ruan Q and Chen YH: Nuclear factor-κB in immunity and inflammation: The Treg and Th17 connection. Adv Exp Med Biol. 946:207–221. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Zhong J, Shi QQ, Zhu MM, Shen J, Wang HH, Ma D and Miao CH: MFHAS1 is associated with sepsis and stimulates TLR2/NF-κB signaling pathway following negative regulation. PLoS One. 10:e01436622015. View Article : Google Scholar : PubMed/NCBI

18 

Zhou Y, Fang L, Jiang L, Wen P, Cao H, He W, Dai C and Yang J: Uric acid induces renal inflammation via activating tubular NF-κB signaling pathway. PLoS One. 7:e397382012. View Article : Google Scholar : PubMed/NCBI

19 

Xu F, Wang Y, Cui W, Yuan H, Sun J, Wu M, Guo Q, Kong L, Wu H and Miao L: Resveratrol prevention of diabetic nephropathy is associated with the suppression of renal inflammation and mesangial cell proliferation: Possible roles of Akt/NF-B Pathway. Int J Endocrinol. 2014:1–9. 2014. View Article : Google Scholar

20 

Jiang X, Zhao X, Luo H and Zhu K: Therapeutic effect of polysaccharide of large yellow croaker swim bladder on lupus nephritis of mice. Nutrients. 6:1223–1235. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Jiang T, Tian F, Zheng H, Whitman SA, Lin Y, Zhang Z, Zhang N and Zhang DD: Nrf2 suppresses lupus nephritis through inhibition of oxidative injury and the NF-κB-mediated inflammatory response. Kidney Int. 85:333–343. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Sun F, Teng J, Yu P, Li W, Chang J and Xu H: Involvement of TWEAK and the NF-κB signaling pathway in lupus nephritis. Exp Ther Med. 15:2611–2619. 2018.PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Muraoka M, Hasegawa H, Kohno M, Inoue A, Miyazaki T, Terada M, Nose M and Yasukawa M: IK cytokine ameliorates the progression of lupus nephritis in MRL/lpr mice. Arthritis Rheum. 54:3591–3600. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Kong R, Kang OH, Seo YS, Zhou T, Kim SA, Shin DW and Kwon DY: MAPKs and NF-κB pathway inhibitory effect of bisdemethoxycurcumin on phorbol 12 myristate 13 acetate and A23187 induced inflammation in human mast cells. Mol Med Rep. 17:630–635. 2018.PubMed/NCBI

26 

Wang YY, Li HT, Lu Y, Jia XY, Li YL, Chen S, Chai JX, Zhang JJ, Liu D and Xie CH: Protective effects of glycyrrhizic acid against lupus nephritis in MRL/lpr mice. Nan Fang Yi Ke Da Xue Xue Bao. 37:957–961. 2017.(In Chinese). PubMed/NCBI

27 

Liu Z, Xue L, Liu Z, Huang J, Wen J, Hu J, Bo L and Yang R: Tumor necrosis factor-like weak inducer of apoptosis accelerates the progression of renal fibrosis in lupus nephritis by activating SMAD and p38 MAPK in TGF-β1 signaling pathway. Mediators Inflamm. 2016:1–13. 2016. View Article : Google Scholar

28 

Christopher-Stine L, Petri M, Astor BC and Fine D: Urine protein-to-creatinine ratio is a reliable measure of proteinuria in lupus nephritis. J Rheumatol. 31:1557–1559. 2004.PubMed/NCBI

29 

Wang Q, Sun P, Wang R and Zhao X: Therapeutic effect of dendrobium candidum on lupus nephritis in mice. Pharmacogn Mag. 13:129–135. 2017.PubMed/NCBI

30 

Fenton K, Fismen S, Hedberg A, Seredkina N, Fenton C, Mortensen ES and Rekvig OP: Anti-dsDNA antibodies promote initiation, and acquired loss of renal Dnase1 promotes progression of lupus nephritis in autoimmune (NZBxNZW)F1 mice. PLoS One. 4:e84742009. View Article : Google Scholar : PubMed/NCBI

31 

Chen Z, Wang GS, Wang GH and Li XP: Anti-C1q antibody is a valuable biological marker for prediction of renal pathological characteristics in lupus nephritis. Clin Rheumatol. 31:1323–1329. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Li H and Ding G: Elevated serum inflammatory cytokines in lupus nephritis patients, in association with promoted hsa-miR-125a. Clin Lab. 62:631–638. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Wang Q, Sun P, Wang R and Zhao X: Therapeutic effect of Dendrobium candidum on lupus nephritis in mice. Pharmacogn Mag. 13:129–135. 2017.PubMed/NCBI

34 

Jin O, Hou CC, Li XQ, Zhang X, Qiu M, Lin D, Fang L, Guo X, Lin Z, Liao Z, et al: THU0274 upregulation of NOD2 involved in the inflammatory response by activation of MAPK signaling pathway in lupus nephritis. Annals of the Rheumatic Diseases. 75:282–286. 2016. View Article : Google Scholar

35 

Zheng CZ, Shu YB, Luo YL and Luo J: The role of miR-146a in modulating TRAF6-induced inflammation during lupus nephritis. Eur Rev Med Pharmacol Sci. 21:1041–1048. 2017.PubMed/NCBI

36 

Saitoh A, Ikoma M, Kamiyama C, Doi K and Koitabashi Y: Investigation of CD68 positive monocytes/ macrophage(CD68+ Mo/M phi) in urine and infiltrated tissue of various kidney diseases in children. Nihon Jinzo Gakkai Shi. 44:798–805. 2002.(In Japanese). PubMed/NCBI

37 

Ma R, Jiang W, Li Z, Sun Y and Wei Z: Intrarenal macrophage infiltration induced by T cells is associated with podocyte injury in lupus nephritis patients. Lupus. 25:1577–1586. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Wong CY, Cheong SK, Mok PL and Leong CF: Differentiation of human mesenchymal stem cells into mesangial cells in post-glomerular injury murine model. Pathology. 40:52–57. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Schlöndorff D and Banas B: The mesangial cell revisited: No cell is an island. J Am Soc Nephrol. 20:1179–1187. 2009. View Article : Google Scholar : PubMed/NCBI

40 

Liu J, Zhu L, Xie GL, Bao JF and Yu Q: Let-7 miRNAs modulate the activation of NF-κB by targeting TNFAIP3 and are involved in the pathogenesis of lupus nephritis. PLoS One. 10:e01212562015. View Article : Google Scholar : PubMed/NCBI

41 

Huang F, Zhang RY and Song L: Beneficial effect of magnolol on lupus nephritis in MRL/lpr mice by attenuating the NLRP3 inflammasome and NF-κB signaling pathway: A mechanistic analysis. Mol Med Rep. 16:4817–4822. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Geng C, Li J, Ding F, Wu G, Yang Q, Sun Y, Zhang Z, Dong T and Tian X: Curcumin suppresses 4-hydroxytamoxifen resistance in breast cancer cells by targeting SLUG/Hexokinase 2 pathway. Biochem Biophys Res Commun. 473:147–153. 2016. View Article : Google Scholar : PubMed/NCBI

43 

Soetikno V, Sari FR, Veeraveedu PT, Thandavarayan RA, Harima M, Sukumaran V, Lakshmanan AP, Suzuki K, Kawachi H and Watanabe K: Curcumin ameliorates macrophage infiltration by inhibiting NF-κB activation and proinflammatory cytokines in streptozotocin induced-diabetic nephropathy. Nutr Metab (Lond). 8:35. 2011. View Article : Google Scholar : PubMed/NCBI

44 

Zhang L, Pang S, Deng B, Qian L, Chen J, Zou J, Zheng J, Yang L, Zhang C, Chen X, et al: High glucose induces renal mesangial cell proliferation and fibronectin expression through JNK/NF-κB/NADPH oxidase/ROS pathway, which is inhibited by resveratrol. Int J Biochem Cell Biol. 44:629–638. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Korashy HM and El-Kadi AOS: The role of redox-sensitive transcription factors NF-κB and AP-1 in the modulation of the Cyp1a1 gene by mercury, lead, and copper. Free Radic Biol Med. 44:795–806. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Wilson PC, Kashgarian M and Moeckel G: Interstitial inflammation and interstitial fibrosis and tubular atrophy predict renal survival in lupus nephritis. Clin Kidney J. 11:207–218. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December-2020
Volume 22 Issue 6

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Sun J, Guo S, Niu F, Liu D and Zhuang Y: Complement 1q protects MRL/lpr mice against lupus nephritis via inhibiting the nuclear factor-κB pathway . Mol Med Rep 22: 5436-5443, 2020
APA
Sun, J., Guo, S., Niu, F., Liu, D., & Zhuang, Y. (2020). Complement 1q protects MRL/lpr mice against lupus nephritis via inhibiting the nuclear factor-κB pathway . Molecular Medicine Reports, 22, 5436-5443. https://doi.org/10.3892/mmr.2020.11588
MLA
Sun, J., Guo, S., Niu, F., Liu, D., Zhuang, Y."Complement 1q protects MRL/lpr mice against lupus nephritis via inhibiting the nuclear factor-κB pathway ". Molecular Medicine Reports 22.6 (2020): 5436-5443.
Chicago
Sun, J., Guo, S., Niu, F., Liu, D., Zhuang, Y."Complement 1q protects MRL/lpr mice against lupus nephritis via inhibiting the nuclear factor-κB pathway ". Molecular Medicine Reports 22, no. 6 (2020): 5436-5443. https://doi.org/10.3892/mmr.2020.11588