Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2021 Volume 23 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2021 Volume 23 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage

  • Authors:
    • Hefei Huang
    • Keting Liu
    • Hua Ou
    • Xuankun Qian
    • Jianshan Wan
  • View Affiliations / Copyright

    Affiliations: Department of Orthopaedics, Qujing First People's Hospital, Qujing, Yunnan 655000, P.R. China
    Copyright: © Huang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 419
    |
    Published online on: April 1, 2021
       https://doi.org/10.3892/mmr.2021.12058
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The primary pathological changes observed in osteoarthritis (OA) involve inflammation and degeneration of chondrocytes. 3‑phosphoglycerate dehydrogenase (Phgdh), a rate‑limiting enzyme involved in the conversion of 3‑phosphoglycerate to serine, serves as a crucial molecular component of cell growth and metabolism. However, its effects on chondrocytes in OA have not been determined. In the present study, a rat model of OA was used to investigate the expression levels of Phgdh in vivo and in vitro. Additionally, the role of Phgdh in extracellular matrix (ECM) synthesis, inflammation, apoptosis and oxidative stress levels of chondrocytes was detected in vitro. Phgdh expression was decreased in OA, and Phgdh overexpression promoted ECM synthesis, decreased levels inflammatory cytokines, such as Il‑6, TNF‑α, a disintegrin and metalloproteinase with thrombospondin motifs 5 and MMP13, and decreased apoptosis. Furthermore, expression of Phgdh effectively increased expression levels of the cellular antioxidant enzymes catalase and superoxide dismutase 1, and decreased the levels of reactive oxygen species in chondrocytes; and this may have been regulated by a Kelch like ECH associated protein 1/nuclear factor erythroid 2‑related factor 2 axis. Taken together, these results suggest that Phgdh may be used to manage the progression of OA.

Introduction

Osteoarthritis (OA) is a common joint disease that affects 50% of the population aged >65 years, and 12% of individuals aged >25 years (1). The primary pathological mechanisms of OA are progressive inflammation of chondrocytes, extracellular matrix (ECM) degradation, loss of articular cartilage, proliferation of subchondral bone and formation of osteophytes, which result in the loss of joint function (2,3). The risk factors for OA include aging, history of joint injury, obesity, sex and genetic and anatomical factors (4). However, the exact molecular pathogenesis of OA remains unclear. Considering that articular cartilage has no self-repair capability and its homeostasis is precisely regulated by a series of factors, for example signal transduction (5), cytokines (6) and hormones (7), understanding the homeostatic mechanism of chondrocytes in the process of OA is of significance for the development of effective therapies for OA.

OA was previously considered to be a non-inflammatory joint disease, but more recent studies have suggested that inflammatory mechanisms are involved in the pathological process of OA chondrocytes (8,9). Inflammatory factors, such as IL-1β, IL-6 and TNF-α, in the microenvironment of the joint cavity may decrease the viability of chondrocytes, and increase necrosis and apoptosis (6). Elevated expression levels of MMPs degrade the ECM of chondrocytes, which is accompanied by an active inflammatory response (10). Additionally, a disintegrin and metalloproteinase with thrombospondin motifs (Adamts) family of proteins, which are also known as aggrecanases, exert a proteoglycan/aggrecan (Acan) depletion effect that is associated with cartilage degradation and inflammation during OA (11). The effects of certain genetic molecules on OA have been determined. For example, inhibiting the expression of m6A methyltransferase complex including methyltransferase-like 3 decreases inflammation and apoptosis of OA chondrocytes, which slows progression of OA (12). Overexpression or activation of silent mating type information regulation 2 homolog 1 decreases loss of cartilage by exerting an inhibitory effect on MMP13 (13). In addition, Adamts-5 is inhibited by microRNA-137, and this decreases levels of inflammatory factors and ECM degradation in OA (14). Therefore, investigation of the molecular function of OA chondrocytes would improve understanding of the molecular pathology of OA, and may highlight potential novel therapeutic targets.

3-Phosphoglycerate dehydrogenase (Phgdh) is a key enzyme involved in serine biosynthesis and serves as a rate-limiting enzyme in the conversion from 3-phosphoglycerate to serine. The serine released during this process provides a large amount of energy and metabolites for cell growth and metabolism (15,16). Elevated levels of Phgdh have been observed in several types of cancer, including colon (17), breast (18) and cervical cancer (19), which suggests that overexpression of Phgdh is associated with a poor prognosis in these types of cancer. Moreover, a previous study suggested that Phgdh-deficient mouse embryonic fibroblasts are more vulnerable to oxidative damage, accompanied by an increase in levels of inflammatory factors (16). These findings suggest that upregulation of Phgdh expression may increase cell viability and proliferation, whereas downregulation of Phgdh may result in oxidative damage and the promotion of an inflammatory response. To the best of our knowledge, however, the role of Phgdh in OA chondrocytes has not yet been studied.

In the present study, the expression levels of Phgdh in OA chondrocytes were assessed and its biological effects on chondrocytes were determined. Phgdh levels were assessed using both an in vitro and in vivo model. Next, the effect of Phgdh on ECM synthesis, inflammation, apoptosis and oxidative stress levels were determined. The present study aimed to improve understanding of the pathogenesis of OA and highlight potentially novel therapeutic targets for the management of OA.

Materials and methods

Affymetrix microarray analysis

In order to determine the levels of Phgdh in the chondrocytes in an OA rat model, the microarray dataset GSE42295 [(Rat230_2) Affymetrix Rat Genome 230 2.0 Array] from Gene Expression Omnibus was used. There were a total of 12 samples, including 3 cases of surgically induced 2 or 8 week rat OA models, and corresponding sham controls, which underwent surgical incision without structural modification. The differentially expressed genes (DEG) were identified between the sham- and OA-2 and 8 week groups using the GEO2R tool (20). Criteria for classification as a DEG were P<0.05 and a |log2Fold Change (FC)|>1.

Establishment of the in vitro OA model, and isolation and culture of chondrocytes

A total of 36 male newborn (weight, 5–6 g) Sprague-Dawley rats, which were all reared at room temperature under 12/12 h day/night cycles, were purchased from the Experimental Animal Centre of the Kunming Medical University (Kunming, China) for chondrocyte extraction. Briefly, after rats were sacrificed by cervical dislocation without anesthesia, articular cartilage was harvested from the knee joints. The cartilage tissue was cut into 1–3 mm3 pieces followed by digestion with 2 mg/ml collagenase II (Sigma-Aldrich; Merck KGaA) for 3 h at 37°C. Finally, the digested chondrocytes were suspended in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 1% penicillin/streptomycin (Beijing Solarbio Science & Technology Co., Ltd.) and 10% FBS (Zhejiang Tianhang Biotechnology Co., Ltd.) at 37°C with 5% CO2 in a humidified incubator. The chondrocytes adhered to the plate after 2–3 days of culture, at which point the tissue pieces were discarded and the medium replaced. The cells were cultured for three passages for chondrocyte identification and use in subsequent experiments. IL-1β (10 ng/ml; Beijing Solarbio Science & Technology Co., Ltd.) was used to stimulate chondrocytes to establish the in vitro OA model as previously described (21). The present study was approved by the Ethics Committee of Qujing First People's Hospital (approval no. 19-025).

Chondrocyte identification and immunofluorescence analysis

Immunofluorescence analysis was performed for chondrocyte identification and Phgdh detection in IL-1β-induced chondrocytes. Collagen type II α 1 chain (Col2a1), a specific marker for chondrocytes, was utilized for chondrocyte identification via immunofluorescence assay. Briefly, third generation chondrocytes and chondrocytes from the Control and IL-1β groups were harvested, washed using PBS and fixed using 4% paraformaldehyde for 30 min at room temperature. After blocking with 5% BSA (Boster Biological Technology) for 30 min at room temperature, primary antibodies against Col2a1 (1:900; cat. no. 28459-1-AP; ProteinTech Group, Inc.) and Phgdh (1:1,000; cat. no. 14719-1-AP; ProteinTech Group, Inc.) were used to incubate the cells at 4°C overnight. The following day, the primary antibody was removed and the cells were incubated with the FITC-conjugated mouse anti-rabbit IgG (1:5,000; cat. no. BM2012; Boster Biological Technology) for 1 h at room temperature. After staining the cell nuclei with DAPI (1:10,000; Beijing Solarbio Science & Technology Co., Ltd.) for 5 min at room temperature, images were obtained using a fluorescence microscope (magnification, ×100; Olympus Corporation).

Cell transfection

The expression plasmid encoding the full-length open reading frame of rat Phgdh with EGFP tags (pIRES2-EGFP-Phgdh) and the corresponding negative control plasmid were synthesized and purchased from Shanghai GenePharma Co., Ltd. For cell transfection, chondrocytes were seeded into six-well plates at a density of 5×106 cells per well and cultured overnight at 37°C with 5% CO2 in a humidified incubator. When confluence reached 70–80% density, Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) reagent was used for transfection according to the manufacturer's protocol. The mixture contained plasmids and transfection reagents (1 µg: 3 µl) and cell transfection with the plasmid was performed at a final concentration of 50 nM; cells were incubated with the transfection mixture and Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.) for 6–7 h at 37°C with 5% CO2 in a humidified incubator. Subsequently, DMEM supplemented with 10% FBS was used to culture cells for 48 h. The experiments were grouped as follows: Control (chondrocytes without any treatment); IL-1β (chondrocytes treated with IL-1β); IL-1β + pcDNA (chondrocytes treated with IL-1β and transfected with negative control plasmid) and Il-1β + Phgdh (chondrocytes treated with IL-1β and transfected with Phgdh cDNA plasmid).

Cell viability assay

Chondrocytes were seeded into 96-well plates at a density of 8×103 cells per well and cultured for 24, 48 or 72 h. Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.) assay was used to measure cell viability. Briefly, 10 µl CCK-8 solution was added to the wells and cultured for 2 h. The absorbance was then measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Inc.).

Safranin O staining

In order to detect the deposition of glycosaminoglycans (GAGs) from chondrocytes, safranin O staining kit (Beijing Solarbio Science & Technology Co., Ltd.) was used to perform the safranin O staining assay according to the manufacturer's protocol. Cells were harvested and fixed using 95% ethanol for 30 min at room temperature, followed by washing three times with PBS. Next, 0.1% safranin O (Beijing Solarbio Science & Technology Co., Ltd.) solution was used to stain the cells for 10–15 min at room temperature. Staining was observed using a light microscope (magnification, ×100; Olympus Corporation) and images were captured.

GAGs detection

Treated chondrocytes were incubated with 60 µg/ml proteinase K (Sigma-Aldrich; Merck KGaA) for 10 h at 56°C and the digested aliquot was used to detect GAGs and DNA content. Dimethylmethylene blue (DMMB) dye binding experiment was used to measure the GAGs, as previously described (22), and the absorbance was measured at 525 nm using a microplate reader (Thermo Fisher Scientific, Inc.). Hoechst 33258 (1 µg/ml; Sigma-Aldrich; Merck KGaA) was used to incubate samples at room temperature for 5 min and measured at 460 nm on a microplate fluorescence reader (FLx800; BioTek Instruments, Inc.) to detect DNA content. After the levels of GAGs and DNA content were measured separately, production of GAGs was expressed as the GAG/DNA ratio.

Reverse transcription-quantitative (RT-q)PCR

RT-qPCR was performed to quantify gene expression levels of Col2a1, Acan, sex determining region Y-box 9 (Sox9), Col1a1, catalase (Cat) and superoxide dismutase 1 (Sod1). The sequences of the primers used are listed in Table I. Total RNA from differently treated cells was extracted using a total RNA isolation kit (Megentec), according to the manufacturer's protocol. A RT kit (Takara Bio, Inc.) was used to reverse transcribe RNA into cDNA, according to the manufacturer's protocols. qPCR was performed with a Fast Start Universal SYBR Green Master Mix (Roche Diagnostics) using a light Cycler 96 system (Roche Diagnostics). The thermocycling conditions were as follows: 10 min at 95°C; followed by 40 cycles of 95°C for 10 sec and 60°C for sec. Relative gene expression levels were normalized to GAPDH and calculated using the 2−ΔΔCq method (23).

Table I.

Primer sequences used for reverse transcription-quantitative PCR.

Table I.

Primer sequences used for reverse transcription-quantitative PCR.

GeneForward primer, 5′→3′Reverse primer, 5′→3′
Phgdh GAACCCTGCCTAGTCACTGGA CCTTAGTAGCTGACCGGACG
Sox9 TCCAGCAAGAACAAGCCACA CGAAGGGTCTCTTCTCGCTC
Acan GAATGGGAGCCAGCCTACAC GAGAGGCAGAGGGACTTTCG
Col2a1 ATTGCCTACCTGGACGAAGC GACAGGCCCTATGTCCACAC
Col1a1 GCTTCACCTACAGCGTCACT AAGCCGAATTCCTGGTCTGG
Catalase AGAGGAAACGCCTGTGTGAG TAGTCAGGGTGGACGTCAGT
Sod1 ATTCACTTCGAGCAGAAGGCA ATTGCCCAGGTCTCCAACAT
GAPDH CTATAAATTGAGCCCGCAGC ACCAAATCCGTTGACTCCG

[i] Phgdh, 3-phosphoglycerate dehydrogenase; Sox9, sex determining region Y-box 9; Col2a1, collagen type II α 1 chain; Sod1, superoxide dismutase 1; Col1a1, collagen type I α 1 chain; Acan, aggrecan.

ELISA

The medium of chondrocytes following treatment was collected to investigate the levels of pro-inflammatory cytokines (IL-6 and TNF-α) using specific ELISA kits (cat. nos. PR6000B and PRTA00; R&D Systems, Inc.), according to the manufacturer's protocol. The absorbance at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Inc.).

Apoptosis assay

Apoptosis of chondrocytes following treatment was investigated using an apoptosis kit (Beijing Solarbio Science & Technology Co., Ltd.). Chondrocytes were stained with 10 µl Annexin V-FITC and 10 µl PI solution in the dark for 10 min at room temperature. Next, cells were rinsed, resuspended in PBS and analyzed using a flow cytometer (BD FACSCalibur™; BD Biosciences) and FlowJo software (version 7; FlowJo LLC).

Measurement of production of reactive oxygen species (ROS)

The levels of ROS in chondrocytes were determined using a 2′-7′-dichlorodihydrofluorescein-diacetate (DCFH-DA) kit (Beyotime Institute of Biotechnology). Briefly, serum-free medium containing DCFH-DA (10 µM) was used to incubate the cells at 37°C for 30 min in the dark. Next, the cells were digested, resuspended in PBS and analyzed using a flow cytometer (BD Biosciences) and FlowJo software (version 7).

Western blot assay

Western blot analysis was used to assess the protein expression levels of Phgdh, Sox9, Acan, Col2a1, Col1a1, MMP13, Adamts-5, Bcl2, Bax, cleaved caspase-3, Kelch like ECH associated protein 1 (Keap1) and Nuclear factor erythroid 2-related factor 2 (Nrf2). Total protein from differently treated cells was extracted using RIPA Lysis Buffer (Boster Biological Technology) supplemented with 1 mM phenylmethylsulfonyl fluoride (Boster Biological Technology). The concentrations of protein were detected using a BCA kit (Nanjing Jiancheng Bioengineering Institute). A total of 50 µg protein from each group was loaded on a 10% SDS gel, resolved using SDS-PAGE and transferred to PVDF membranes (Biosharp Life Sciences). Membranes were blocked using 5% non-fat milk for 1 h at room temperature. Subsequently, membranes were incubated with primary antibodies against Phgdh (1:1,000; cat. no. 14719-1-AP; ProteinTech Group, Inc.), Sox9 (1:1,000; cat. no. 67439-1-Ig; ProteinTech Group, Inc.), Acan (1:1,000; cat. no. 13880-1-AP; ProteinTech Group, Inc.), Col2a1 (1:900; cat. no. 28459-1-AP; ProteinTech Group, Inc.), Col1a1 (1:5,000; cat. no. 67288-1-Ig; ProteinTech Group, Inc.), MMP13 (1:1,000; cat. no. 18165-1-AP; ProteinTech Group, Inc.), Adamts-5 (1:1,000; cat. no. ab41037; Abcam), cleaved caspase-3 (1:1,000; cat. no. 9664S; CST Biological Reagents Co., Ltd.), Bcl2 (1:1,000; cat. no. 3498; CST Biological Reagents Co., Ltd.), Bax (1:1,000; cat. no. 5023; CST Biological Reagents Co., Ltd.), Keap1 (1:1,000; cat. no. 8047; CST Biological Reagents Co., Ltd.), Nrf2 (1:1,000; cat. no. 12721; CST Biological Reagents Co., Ltd.) and β-actin (1:5,000; cat. no. 66009-1-Ig; ProteinTech Group, Inc.). Membranes were incubated with the primary antibodies overnight at 4°C followed by incubation with HRP-conjugated secondary antibody (1:10,000; cat. no. 7074; CST Biological Reagents Co., Ltd.) for 1 h at room temperature. ECL kit (Beijing Solarbio Science & Technology Co., Ltd.) was used to visualize the protein membranes. Signals were visualized using an Odyssey Infrared Imaging System (LI-COR Biosciences). Densitometry was performed with ImageJ software (version 1.8.0.112; National Institutes of Health).

Statistical analysis

Data were analyzed using SPSS version 22.0 (IBM Corp.) and are presented as the mean ± SD (n=3). All experiments were repeated three times. An unpaired Student's t-test was used to compare differences between two groups and one-way ANOVA followed by Tukey's multiple comparisons post hoc test was used to compare differences between ≥3 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Phgdh expression is decreased in chondrocytes both in vivo and in an in vitro OA model

First, the expression of Phgdh was investigated in chondrocytes in an in vivo model of OA using microarray analysis. In both the 2 and 8 week OA in vivo model, Phgdh expression was significantly decreased compared with the corresponding sham group (Fig. 1A and B). Downregulation of Phgdh was greatest in the 8 week OA model (Fig. 1C), suggesting that downregulation of Phgdh may be associated with the severity of OA.

Figure 1.

Phgdh expression in an in vivo and in vitro model of OA. (A) DEGs between the 2 week sham and OA groups. (B) DEGs between the 8 week sham and OA groups. (C) Boxplot of Phgdh expression based on microarray analysis of the different groups. (D) Immunofluorescence assay for detection of Col2a1 in chondrocytes harvested from newborn rats. (E) Immunofluorescence analysis for detection of Phgdh in chondrocytes treated with IL-1β. Scale bar, 200 µm. (F) mRNA and (G) protein expression levels of Phgdh in IL-1β induced chondrocytes. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01, ***P<0.001 vs. Control. Phgdh, 3-phosphoglycerate dehydrogenase; OA, osteoarthritis; DEG, differentially expressed gene; Col2a1, collagen type II α 1 chain.

Next, chondrocytes from newborn rats were extracted. Successful harvesting was demonstrated by immunofluorescence analysis to detect expression of Col2a1 (Fig. 1D). IL-1β treatment was used to establish the in vitro OA model. Phgdh expression was detected using immunofluorescence staining (Fig. 1E), RT-qPCR (Fig. 1F) and western blotting (Fig. 1G) assays. Phgdh expression in chondrocytes was significantly decreased following IL-1β treatment. These results suggest that Phgdh expression in chondrocytes was decreased in OA.

Phgdh increases the viability of chondrocytes treated with IL-1β

In order to assess the biological effect of Phgdh on chondrocytes, a Phgdh cDNA overexpression plasmid was used to transfect the chondrocytes. Phgdh mRNA and protein expression levels in chondrocytes in the presence or absence of IL-1β treatment were significantly increased following Phgdh cDNA transfection, whereas the negative control plasmid exhibited no significant effect on Phgdh expression (Fig. 2A-D). CCK-8 assay was used to assess cell viability; the results suggested that Phgdh cDNA and negative control plasmid had no significant effect on the viability of chondrocytes in untreated cells. However, overexpression of Phgdh increased cell viability of chondrocytes treated with IL-1β (Fig. 2E).

Figure 2.

Phgdh increases the viability of chondrocytes treated with IL-1β. (A) mRNA and (B) protein expression levels of Phgdh transfected with Phgdh overexpression vector or negative control plasmid in chondrocytes without IL-1β treatment. (C) mRNA and (D) protein expression levels of Phgdh transfected with a Phgdh overexpression vector or the corresponding negative control plasmid in chondrocytes with IL-1β treatment. (E) Cell viability analysis of chondrocytes following overexpression of Phgdh. Data are presented as the mean ± SD (n=3). **P<0.01, ***P<0.001 vs. Control or IL-1β; ##P<0.01, ###P<0.001 vs. Control + pcDNA or IL-1β + pcDNA. Phgdh, 3-phosphoglycerate dehydrogenase; NS, not significant.

Phgdh alleviates IL-1β-induced chondrocyte degeneration

The degeneration of chondrocytes primarily manifests as decreased levels of GAGs and decreased expression of chondrogenic-specific genes, including Col2a1, Sox9 and Acan (24). Safranin-O staining showed that chondrocytes in the IL-1β + Phgdh group exhibited increased GAG staining compared with the IL-1β group (Fig. 3A). Moreover, the DMMB assay also confirmed that GAG levels were increased in the IL-1β + Phgdh group compared with the IL-1β group (Fig. 3B). The expression levels of cartilage-specific genes were consistent with the aforementioned results; Sox9 (Fig. 3C), Acan (Fig. 3D) and Col2a1 (Fig. 3E) expression levels were increased in the IL-1β + Phgdh group compared with the IL-1β group, whereas Col1a1 expression levels were decreased (Fig. 3F). The protein expression levels of Sox9, Acan, Col2a1 and Col1a1 were also assessed. Sox9, Acan, Col2a1 protein expression levels were upregulated in the IL-1β + Phgdh group compared with the IL-1β group, whereas Col1a1 expression levels were decreased (Fig. 3G). There results suggested that overexpression of Phgdh alleviated IL-1β-induced chondrocyte degeneration.

Figure 3.

Phgdh alleviates IL-1β-induced chondrocyte degeneration. (A) GAG secretion in the different groups was determined using Safranin O staining. Scale bar, 200 µm. (B) Quantitative analysis of GAGs, normalized to DNA (in mg). mRNA expression levels of (C) Sox9, (D) Acan, (E) Col2a1 and (F) Col1a1. (G) Protein expression levels of Sox9, Acan, Col2a1 and Col1a1. Data are presented as the mean ± SD (n=3). **P<0.01, ***P<0.001 vs. Control; ##P<0.01, ###P<0.001 vs. IL-1β. Phgdh, 3-phosphoglycerate dehydrogenase; GAG, glycosaminoglycan; Sox9, sex determining region Y-box 9; Acan, aggrecan; Col2a1, collagen type II α 1 chain; Col1a1, collagen type I α 1 chain.

Phgdh decreases IL-1β-induced chondrocyte inflammation and apoptosis

Production of inflammatory factors and expression of matrix-degrading enzymes results in chondrocyte degeneration (25). The effect of Phgdh on chondrocyte inflammation and apoptosis was investigated. Using ELISA, it was shown that the levels of key inflammatory factors in OA, such as Il-6 and TNF-α, were decreased in the IL-1β + Phgdh group compared with the IL-1β group (Fig. 4A). The protein expression levels of Adamts-5 and MMP13 were also significantly decreased in the Il-1β + Phgdh group (Fig. 4B). Moreover, the apoptotic rate of cells in the IL-1β + Phgdh group was lower than that in the IL-1β group (Fig. 4C). Expression of apoptosis-associated proteins, such as cleaved caspase-3, Bax and Bcl2, were detected. Expression of the pro-apoptotic proteins cleaved caspase-3 and Bax was decreased and that of the anti-apoptotic protein Bcl2 was elevated in the IL-1β + Phgdh group compared with the IL-1β group (Fig. 4D). These results suggested that overexpression of Phgdh alleviated inflammation and apoptosis of chondrocytes treated with IL-1β.

Figure 4.

Phgdh decreases IL-1β-induced chondrocyte inflammation and apoptosis. (A) Levels of IL-6 and TNF-α. (B) Protein expression levels of Adamts-5 and MMP13. (C) Apoptotic rate of cells. (D) Expression levels of apoptosis-associated proteins Bcl2, Bax and cleaved caspase-3. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01, ***P<0.001 vs. Control; #P<0.05, ###P<0.001 vs. IL-1β. Phgdh, 3-phosphoglycerate dehydrogenase; Adamts-5, a disintegrin and metalloproteinase with thrombospondin motifs 5.

Phgdh decreases oxidative stress damage of chondrocytes treated with IL-1β

Evidence has suggested that an imbalance in oxidative stress is associated with inflammation (26). Studies have also shown that inhibiting oxidative stress levels and improving the antioxidant capacity of cells may decrease inflammation and degeneration of chondrocytes (26,27). In the present study, it was shown that overexpression of Phgdh decreased ROS levels of chondrocytes treated with IL-1β (Fig. 5A). The mRNA expression levels of the anti-oxidant enzymes Cat and Sod1 were measured. The results suggested that Phgdh increased the levels of Cat and Sod1 (Fig. 5B). Key proteins associated with oxidative stress include Nrf2 and Keap1, and their expression was next determined. Overexpression of Phgdh increased expression levels of Nrf2 and decreased those of Keap1 (Fig. 5C). These results suggested that Phgdh may exhibit a regulatory effect on the oxidative stress levels of chondrocytes via the Nrf2/Keap1 axis.

Figure 5.

Phgdh decreases oxidative stress damage of chondrocytes treated with IL-1β. (A) Flow cytometry analysis for ROS levels. (B) mRNA expression levels of Cat and Sod1. (C) Protein expression levels of Nrf2 and Keap1 protein. Data are presented as the mean ± SD (n=3). *P<0.05, **P<0.01, ***P<0.001 vs. Control; #P<0.05, ##P<0.01, ###P<0.001 vs. IL-1β. Phgdh, 3-phosphoglycerate dehydrogenase; ROS, reactive oxygen species; Cat, catalase; Sod1, superoxide dismutase; Keap1, Kelch like ECH associated protein 1; Nrf2, nuclear factor erythroid 2-related factor 2.

Discussion

OA is the most common disease of joints and is characterized by damaged articular cartilage, which is primarily composed of chondrocytes and cartilage matrix (1). The primary function of chondrocytes is to secrete ECM proteins, such as Acan and Col2a1, to maintain homeostasis of the articular cartilage (28). Alterations to chondrocyte function are accompanied by degeneration of cartilage matrix, which eventually results in the initiation and progression of OA. Protecting or rescuing the function of chondrocytes may thus assist in alleviating the progress of OA (29). Although a number of potential targets and mechanisms of OA chondrocytes have been reported, these studies have not translated into clinically useful therapeutic options due to a lack of sensitivity and specificity (30–33). Therefore, investigating the novel pathogenesis of OA chondrocytes may highlight potential molecules for targeted therapy of OA. In the present study, Phgdh was found to be downregulated in OA chondrocytes and decreased with the progression of OA. Overexpression of Phgdh prevented IL-1β-induced chondrocyte degeneration, inflammation, apoptosis and oxidative damage. Thus, the potential effect of Phgdh on OA chondrocytes was highlighted and the results suggested that Phgdh may be a promising therapeutic target for management of OA.

Phgdh is a key enzyme involved in serine biosynthesis, where it synthesizes serine to provide large amounts of energy and metabolites for cell growth and metabolism (34). In tumors, upregulated expression of Phgdh has been detected in lung, breast, pancreatic and colorectal cancer, where it is positively associated with cell proliferation, migration, invasion and poor prognosis (17,18,35,36). However, downregulation of Phgdh is also associated with certain non-tumor diseases. For example, decreased Phgdh expression, accompanied by low serine levels, is associated with the development of fatty liver disease (37). Moreover, Phgdh deficiency is also a risk factor for the development of Macular Telangiectasia type 2 development, an uncommon bilateral retinal disease (38). These aforementioned studies suggest that the expression of Phgdh is carefully regulated, and its abnormal expression can result in pathophysiological changes or disease. In the present study, Phgdh expression was shown to be decreased in the chondrocytes of OA and with the progression of OA over time, suggesting that Phgdh was also involved in OA pathogenesis.

Under normal physiological conditions, the activity of synthesis and decomposition of cartilage matrix is in a dynamic balance. Transcription factor Sox9 is a key molecule in maintaining the phenotype of the chondrocyte (39). Sox9 activates a series of downstream signaling molecules to promote the deposition of Col2a1, Acan and GAGs (40). In patients with OA, numerous inflammatory factors, such as IL-1β, IL-6 and TNF-α, inhibit the expression of Sox9 and degrade cartilage ECM by activating a series of proteases, such as MMPs and Adamts (41). Decreasing the level of inflammation and restoring the homeostasis of chondrocytes are key to preventing the progression of OA (42,43). In the present study, in chondrocytes treated with IL-1β, it was observed that inflammatory stimulation decreased the levels of GAGs, and overexpression of Phgdh restored the deposition of GAGs. Furthermore, overexpression of Phgdh offset the inhibitory effect of IL-1β on Sox9, Acan, and Col2a1 expression in chondrocytes and decreased expression levels of the osteogenesis-specific gene Col1a1. In addition, upregulation of Phgdh decreased expression levels of IL-6, TNF-α, MMP13 and Adamts-5 and inhibited apoptosis of chondrocytes treated with IL-1β. These results suggested that Phgdh exerted a protective effect on chondrocyte homeostasis, inflammation and apoptosis.

Oxidative stress is a negative outcome that results from production of free radicals in tissue, and is a key factor for mediating inflammation (44). Oxidative stress damage is primarily the result of increased ROS production and decreased levels of antioxidant enzymes, such as Sod and Cat (45). Oxidative stress is a key factor is associated with the progression of OA. Excessive ROS production activates the inflammatory response via the NF-κB signaling pathway and inhibits synthesis of proteoglycans and ECM in chondrocytes (46). In addition, a lack of Phgdh increases the vulnerability of fibroblasts to oxidative stress damage (16). In the present study, Phgdh exerted a regulatory effect on oxidative stress levels of chondrocytes in OA. Phgdh decreased the levels of ROS and increased expression levels of Cat and Sod1 in chondrocytes treated with IL-1β. Nrf2 is a major antioxidant factor, which normally binds to Keap1 (47). Under oxidative damage, Nrf2 dissociates from Keap1 and translocates to the nucleus to initiate the transcription of antioxidant enzymes (48). It has previously been shown that promoting the expression of Nrf2 decreases the inflammatory response and progression of OA (43). In the present study, overexpression of Phgdh promoted the expression levels of Nrf2 and decreased those of Keap1 in chondrocytes treated with IL-1β, suggesting that Phgdh regulated oxidative stress levels of chondrocytes in OA via Nrf2.

In conclusion, Phgdh was decreased in OA and was associated with OA progression. Moreover, Phgdh was found to be involved in chondrocyte homeostasis: Overexpression of Phgdh decreased inflammation and apoptosis and restored the phenotype of chondrocytes in OA. Additionally, overexpression of Phgdh alleviated oxidative stress damage; this may have involved a Keap1-Nrf2 axis which is involved in the pathological mechanism of OA. Therefore, Phgdh may be a potentially significant target for OA research and treatment.

Acknowledgements

The authors would like to thank Dr Li Hongwei (Biological Laboratory of Qujing First People's Hospital; Qujing, China) for their guidance on the experimental design and technology.

Funding

No funding was received.

Availability of data and materials

The microarray dataset is available in the GSE42295 from Gene Expression Omnibus Database. The data collected and analyzed during the current study are available from the corresponding author upon reasonable request.

Authors' contributions

JW and XQ conceptualized and designed the study. HH, KL and HO collected and analyzed data. HH and KL wrote the manuscript. HH, KL, HO, HQ and JW confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Qujing First People's Hospital (approval no. 19-025; Qujing, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

OA

osteoarthritis

Phgdh

3-phosphoglycerate dehydrogenase

ECM

extracellular matrix

Adamts-5

a disintegrin and metalloproteinase with thrombospondin motifs 5

Cat

catalase

Sod1

superoxide dismutase 1

ROS

reactive oxygen species

Keap1

Kelch like ECH associated protein 1

Nrf2

nuclear factor erythroid 2-related factor 2

Sox9

sex determining region Y-box 9

Acan

aggrecan

Col2a1

collagen type II α 1 chain

Col1a1

collagen type I α 1 chain

References

1 

Hayami T, Pickarski M, Zhuo Y, Wesolowski GA, Rodan GA and Duong LT: Characterization of articular cartilage and subchondral bone changes in the rat anterior cruciate ligament transection and meniscectomized models of osteoarthritis. Bone. 38:234–243. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Sellam J and Berenbaum F: The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat Rev Rheumatol. 6:625–635. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Hawker GA: Osteoarthritis is a serious disease. Clin Exp Rheumatol. 37 (Suppl 120):S3–S6. 2019.

4 

Johnson VL and Hunter DJ: The epidemiology of osteoarthritis. Best Pract Res Clin Rheumatol. 28:5–15. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Xie Y, Zinkle A, Chen L and Mohammadi M: Fibroblast growth factor signalling in osteoarthritis and cartilage repair. Nat Rev Rheumatol. 16:547–564. 2020. View Article : Google Scholar : PubMed/NCBI

6 

Wojdasiewicz P, Poniatowski Ł A and Szukiewicz D: The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediators Inflamm. 2014:5614592014. View Article : Google Scholar : PubMed/NCBI

7 

Savvidou O, Milonaki M, Goumenos S, Flevas D, Papagelopoulos P and Moutsatsou P: Glucocorticoid signaling and osteoarthritis. Mol Cell Endocrinol. 480:153–166. 2019. View Article : Google Scholar : PubMed/NCBI

8 

Shen J, Abu-Amer Y, O'Keefe RJ and McAlinden A: Inflammation and epigenetic regulation in osteoarthritis. Connect Tissue Res. 58:49–63. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Houard X, Goldring MB and Berenbaum F: Homeostatic mechanisms in articular cartilage and role of inflammation in osteoarthritis. Curr Rheumatol Rep. 15:3752013. View Article : Google Scholar : PubMed/NCBI

10 

Xu K, Ma C, Xu L, Ran J, Jiang L, He Y, Adel Abdo Moqbel S, Wang Z and Wu L: Polygalacic acid inhibits MMPs expression and osteoarthritis via Wnt/β-catenin and MAPK signal pathways suppression. Int Immunopharmacol. 63:246–252. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Verma P and Dalal K: ADAMTS-4 and ADAMTS-5: Key enzymes in osteoarthritis. J Cell Biochem. 112:3507–3514. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Liu Q, Li M, Jiang L, Jiang R and Fu B: METTL3 promotes experimental osteoarthritis development by regulating inflammatory response and apoptosis in chondrocyte. Biochem Biophys Res Commun. 516:22–27. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Elayyan J, Lee EJ, Gabay O, Smith CA, Qiq O, Reich E, Mobasheri A, Henrotin Y, Kimber SJ and Dvir-Ginzberg M: LEF1-mediated MMP13 gene expression is repressed by SIRT1 in human chondrocytes. FASEB J. 31:3116–3125. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Zhang Y, Wang G, Ma L, Wang C, Wang L, Guo Y and Zhao X: miR-137 suppresses cell growth and extracellular matrixdegradation through regulating ADAMTS-5 in chondrocytes. Am J Transl Res. 11:7027–7034. 2019.PubMed/NCBI

15 

Sayano T, Kawakami Y, Kusada W, Suzuki T, Kawano Y, Watanabe A, Takashima K, Arimoto Y, Esaki K, Wada A, et al: L-serine deficiency caused by genetic Phgdh deletion leads to robust induction of 4E-BP1 and subsequent repression of translation initiation in the developing central nervous system. FEBS J. 280:1502–1517. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Hamano M, Haraguchi Y, Sayano T, Zyao C, Arimoto Y, Kawano Y, Moriyasu K, Udono M, Katakura Y, Ogawa T, et al: Enhanced vulnerability to oxidative stress and induction of inflammatory gene expression in 3-phosphoglycerate dehydrogenase-deficient fibroblasts. FEBS Open Bio. 8:914–922. 2018. View Article : Google Scholar : PubMed/NCBI

17 

Jia XQ, Zhang S, Zhu HJ, Wang W, Zhu JH, Wang XD and Qiang JF: Increased expression of PHGDH and prognostic significance in colorectal cancer. Transl Oncol. 9:191–196. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Samanta D, Park Y, Andrabi SA, Shelton LM, Gilkes DM and Semenza GL: PHGDH expression is required for mitochondrial redox homeostasis, breast cancer stem cell maintenance, and lung metastasis. Cancer Res. 76:4430–4442. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Jing Z, Heng W, Aiping D, Yafei Q and Shulan Z: Expression and clinical significance of phosphoglycerate dehydrogenase and squamous cell carcinoma antigen in cervical cancer. Int J Gynecol Cancer. 23:1465–1469. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al: NCBI GEO: Archive for functional genomics data sets-update. Nucleic Acids Res. 41:D991–D995. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Cheng F, Hu H, Sun K, Yan F and Geng Y: miR-455-3p enhances chondrocytes apoptosis and inflammation by targeting COL2A1 in the in vitro osteoarthritis model. Biosci Biotechnol Biochem. 84:695–702. 2020. View Article : Google Scholar : PubMed/NCBI

22 

Guingamp C, Gegout-Pottie P, Philippe L, Terlain B, Netter P and Gillet P: Mono-iodoacetate-induced experimental osteoarthritis: A dose-response study of loss of mobility, morphology, and biochemistry. Arthritis Rheum. 40:1670–1679. 1997. View Article : Google Scholar : PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Shen S, Wu Y, Chen J, Xie Z, Huang K, Wang G, Yang Y, Ni W, Chen Z, Shi P, et al: CircSERPINE2 protects against osteoarthritis by targeting miR-1271 and ETS-related gene. Ann Rheum Dis. 78:826–836. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Son YO, Park S, Kwak JS, Won Y, Choi WS, Rhee J, Chun CH, Ryu JH, Kim DK, Choi HS and Chun JS: Estrogen-related receptor γ causes osteoarthritis by upregulating extracellular matrix-degrading enzymes. Nat Commun. 8:21332017. View Article : Google Scholar : PubMed/NCBI

26 

Li B, Jiang T, Liu H, Miao Z, Fang D, Zheng L and Zhao J: Andrographolide protects chondrocytes from oxidative stress injury by activation of the Keap1-Nrf2-Are signaling pathway. J Cell Physiol. 234:561–571. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Tang Q, Zheng G, Feng Z, Chen Y, Lou Y, Wang C, Zhang X, Zhang Y, Xu H, Shang P and Liu H: Trehalose ameliorates oxidative stress-mediated mitochondrial dysfunction and ER stress via selective autophagy stimulation and autophagic flux restoration in osteoarthritis development. Cell Death Dis. 8:e30812017. View Article : Google Scholar : PubMed/NCBI

28 

Salinas D, Mumey BM and June RK: Physiological dynamic compression regulates central energy metabolism in primary human chondrocytes. Biomech Model Mechanobiol. 18:69–77. 2019. View Article : Google Scholar : PubMed/NCBI

29 

Charlier E, Deroyer C, Ciregia F, Malaise O, Neuville S, Plener Z, Malaise M and de Seny D: Chondrocyte dedifferentiation and osteoarthritis (OA). Biochem Pharmacol. 165:49–65. 2019. View Article : Google Scholar : PubMed/NCBI

30 

Deng Z, Jia Y, Liu H, He M, Yang Y, Xiao W and Li Y: RhoA/ROCK pathway: Implication in osteoarthritis and therapeutic targets. Am J Transl Res. 11:5324–5331. 2019.PubMed/NCBI

31 

Fernandes JC, Martel-Pelletier J and Pelletier JP: The role of cytokines in osteoarthritis pathophysiology. Biorheology. 39:237–246. 2002.PubMed/NCBI

32 

Fernandes TL, Gomoll AH, Lattermann C, Hernandez AJ, Bueno DF and Amano MT: Macrophage: A potential target on cartilage regeneration. Front Immunol. 11:1112020. View Article : Google Scholar : PubMed/NCBI

33 

Xie C and Chen Q: Adipokines: New therapeutic target for osteoarthritis? Curr Rheumatol Rep. 21:712019. View Article : Google Scholar : PubMed/NCBI

34 

Yoshida K, Furuya S, Osuka S, Mitoma J, Shinoda Y, Watanabe M, Azuma N, Tanaka H, Hashikawa T, Itohara S and Hirabayashi Y: Targeted disruption of the mouse 3-phosphoglycerate dehydrogenase gene causes severe neurodevelopmental defects and results in embryonic lethality. J Biol Chem. 279:3573–3577. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Song Z, Feng C, Lu Y, Lin Y and Dong C: PHGDH is an independent prognosis marker and contributes cell proliferation, migration and invasion in human pancreatic cancer. Gene. 642:43–50. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Unterlass JE, Baslé A, Blackburn TJ, Tucker J, Cano C, Noble MEM and Curtin NJ: Validating and enabling phosphoglycerate dehydrogenase (PHGDH) as a target for fragment-based drug discovery in PHGDH-amplified breast cancer. Oncotarget. 9:13139–13153. 2018. View Article : Google Scholar : PubMed/NCBI

37 

Sim WC, Lee W, Sim H, Lee KY, Jung SH, Choi YJ, Kim HY, Kang KW, Lee JY, Choi YJ, et al: Downregulation of PHGDH expression and hepatic serine level contribute to the development of fatty liver disease. Metabolism. 102:1540002020. View Article : Google Scholar : PubMed/NCBI

38 

Bonelli R, Woods SM, Ansell BRE, Heeren TFC, Egan CA, Khan KN, Guymer R, Trombley J, Friedlander M, Bahlo M and Fruttiger M: Systemic lipid dysregulation is a risk factor for macular neurodegenerative disease. Sci Rep. 10:121652020. View Article : Google Scholar : PubMed/NCBI

39 

Kozhemyakina E, Lassar AB and Zelzer E: A pathway to bone: Signaling molecules and transcription factors involved in chondrocyte development and maturation. Development. 142:817–831. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Lefebvre V and Dvir-Ginzberg M: SOX9 and the many facets of its regulation in the chondrocyte lineage. Connect Tissue Res. 58:2–14. 2017. View Article : Google Scholar : PubMed/NCBI

41 

Lefebvre V, Angelozzi M and Haseeb A: SOX9 in cartilage development and disease. Curr Opin Cell Biol. 61:39–47. 2019. View Article : Google Scholar : PubMed/NCBI

42 

Si HB, Zeng Y, Liu SY, Zhou ZK, Chen YN, Cheng JQ, Lu YR and Shen B: Intra-articular injection of microRNA-140 (miRNA-140) alleviates osteoarthritis (OA) progression by modulating extracellular matrix (ECM) homeostasis in rats. Osteoarthritis Cartilage. 25:1698–1707. 2017. View Article : Google Scholar : PubMed/NCBI

43 

Sun K, Luo J, Jing X, Guo J, Yao X, Hao X, Ye Y, Liang S, Lin J, Wang G and Guo F: Astaxanthin protects against osteoarthritis via Nrf2: A guardian of cartilage homeostasis. Aging. 11:10513–10531. 2019. View Article : Google Scholar : PubMed/NCBI

44 

Ansari MY, Ahmad N and Haqqi TM: Oxidative stress and inflammation in osteoarthritis pathogenesis: Role of polyphenols. Biomed Pharmacother. 129:1104522020. View Article : Google Scholar : PubMed/NCBI

45 

Dandekar A, Mendez R and Zhang K: Cross talk between ER stress, oxidative stress, and inflammation in health and disease. Methods Mol Biol. 1292:205–214. 2015. View Article : Google Scholar : PubMed/NCBI

46 

Brandl A, Hartmann A, Bechmann V, Graf B, Nerlich M and Angele P: Oxidative stress induces senescence in chondrocytes. J Orthop Res. 29:1114–1120. 2011. View Article : Google Scholar : PubMed/NCBI

47 

Sangokoya C, Telen MJ and Chi JT: MicroRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116:4338–4348. 2010. View Article : Google Scholar : PubMed/NCBI

48 

Jiang HK, Miao Y, Wang YH, Zhao M, Feng ZH, Yu XJ, Liu JK and Zang WJ: Aerobic interval training protects against myocardial infarction-induced oxidative injury by enhancing antioxidase system and mitochondrial biosynthesis. Clin Exp Pharmacol Physiol. 41:192–201. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Huang H, Liu K, Ou H, Qian X and Wan J: Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage. Mol Med Rep 23: 419, 2021.
APA
Huang, H., Liu, K., Ou, H., Qian, X., & Wan, J. (2021). Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage. Molecular Medicine Reports, 23, 419. https://doi.org/10.3892/mmr.2021.12058
MLA
Huang, H., Liu, K., Ou, H., Qian, X., Wan, J."Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage". Molecular Medicine Reports 23.6 (2021): 419.
Chicago
Huang, H., Liu, K., Ou, H., Qian, X., Wan, J."Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage". Molecular Medicine Reports 23, no. 6 (2021): 419. https://doi.org/10.3892/mmr.2021.12058
Copy and paste a formatted citation
x
Spandidos Publications style
Huang H, Liu K, Ou H, Qian X and Wan J: Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage. Mol Med Rep 23: 419, 2021.
APA
Huang, H., Liu, K., Ou, H., Qian, X., & Wan, J. (2021). Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage. Molecular Medicine Reports, 23, 419. https://doi.org/10.3892/mmr.2021.12058
MLA
Huang, H., Liu, K., Ou, H., Qian, X., Wan, J."Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage". Molecular Medicine Reports 23.6 (2021): 419.
Chicago
Huang, H., Liu, K., Ou, H., Qian, X., Wan, J."Phgdh serves a protective role in Il‑1β induced chondrocyte inflammation and oxidative‑stress damage". Molecular Medicine Reports 23, no. 6 (2021): 419. https://doi.org/10.3892/mmr.2021.12058
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team