Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2022 Volume 25 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2022 Volume 25 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats

  • Authors:
    • Xiaoyan Pu
    • Fuxin Li
    • Xue Lin
    • Rong Wang
    • Zhi Chen
  • View Affiliations / Copyright

    Affiliations: Qinghai Normal University, Xining, Qinghai 810001, P.R. China, College of Medicine, Qinghai University, Xining, Qinghai 810001, P.R. China
    Copyright: © Pu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 49
    |
    Published online on: December 9, 2021
       https://doi.org/10.3892/mmr.2021.12565
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to investigate the changes in lung histomorphology and oxidative stress, as well as the expression of interleukin (IL)‑17C and other inflammatory factors during acute mountain sickness (AMS) in male Sprague‑Dawley rats and to explore the underlying mechanism. Rats were randomly divided into a control group (0 h) and three hypoxia stress groups, exposed to low‑pressure oxygen storage at a simulated altitude of 6,000 m for 24, 48 and 72 h, respectively. Morphological changes in lung tissue were observed by hematoxylin and eosin staining under light microscopy and transmission electron microscopy. The expression of inflammatory factors IL‑17C, nuclear factor‑κB (NF‑κB), IL‑1β, IL‑6 and tumor necrosis factor‑α (TNF‑α) in lung tissue was assessed by RNA sequencing and verified by reverse transcription‑quantitative PCR (RT‑qPCR) and western blotting (WB). Superoxide dismutase (SOD) and glutathione peroxidase (GSH‑Px) enzyme activity and malondialdehyde (MDA) expression were also measured. Experimental groups were compared to the control group following 24, 48 and 72 h of hypoxic stress. Lung tissue suffered from different degrees of injury, and the damage was the most severe after 48 h of hypoxic stress. RNA sequencing data from the lung tissue of rats from each group suggested that the expression of IL‑17C, NF‑κB, IL‑1β, IL‑6, and TNF‑α increased significantly after hypoxic stress. RT‑qPCR and WB demonstrated that the expression of IL‑17C and NF‑κB increased significantly after hypoxia lasting 48 and 72 h. IL‑1β expression increased significantly after hypoxia stress lasting 24 and 48 h, and the expressions of TNF‑α and IL‑6 increased significantly after hypoxia stress lasting 24, 48 and 72 h (P<0.01). The enzyme activity of SOD and GSH‑Px decreased significantly after lasting 24, 48 and 72 h of hypoxia (P<0.01), and MDA increased significantly after hypoxic stress lasting 48 and 72 h (P<0.01). In conclusion, under hypoxic stress, rats quickly initiate oxidative stress and immune responses. However, with prolonged hypoxic stress time, excessive oxidative stress can further stimulate the immune system in vivo, and release a large quantity of inflammatory factors accumulating in the body. This, in turn, may lead to the occurrence of inflammatory storms and further damage the lung tissue resulting in AMS.

Introduction

Acute mountain sickness (AMS) is a potentially lethal condition caused by acute hypoxia after ascending to altitudes higher than 2,500 m in a short time. It is common in high-altitude travelers, and may lead to life-threatening high-altitude conditions such as high-altitude cerebral edema (HACE) or high-altitude pulmonary edema (HAPE) (1,2).

Previous studies suggested that hypoxia stress can induce an oxidative stress reaction, which leads to increases in endogenous reactive oxygen species (ROS), and oxidative stress damage, resulting in body damage (3–5). ROS are very active and unstable, and indirectly reflect the level of oxidative stress, as well as the degree of injury through the enzyme activity of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and the expression of malondialdehyde (MDA) (6,7).

Previous studies demonstrated that oxidative stress can induce the production of inflammatory factors (8). The presence of inflammatory cells, immunoglobulins and complement components in the broncho-alveolar lavage fluid of patients with HAPE suggests that inflammatory immune responses can lead to increased permeability of the pulmonary blood barrier and are involved in the occurrence of HAPE (9). In addition, key factors such as nuclear factor-κB (NF-κB), interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) serve an important role in the development of exacerbated immune responses, among which IL-1β is an important pro-inflammatory factor (10–13). Activation of the above factors can stimulate the proliferation of vascular smooth muscle cells, which can lead to pulmonary hypertension (14–16). During oxidative stress, vascular endothelial cells can release adhesion factors and monocytes, causing lymphocytes to aggregate into endothelial cells through these two inflammatory factors (17). TNF-α can activate neutrophils, release a large number of oxygen-free radicals and proteases, resulting in tissue damage (18). NF-κB is a transcription regulator. Activation of NF-κB promotes the transcription of cytokines and the activation of inflammatory transmitter gene transcription (19,20). IL-17C is a member of the IL-17 family. Previous studies demonstrated that activated T cells do not synthesize IL-17C (21), and that epithelial cells from various tissues and organs are the main source of IL-17C (22). IL-17C can promote the secretion of IL-1β, IL-6, and TNF-α, activate the NF-κB pathway (23), and induce inflammation and immune regulation (24–26). As research has progressed, microorganisms have been shown to promote the expression of IL-17C in epithelial cells in inflammatory environments (27), yet the role of IL-17C and AMS has not been established.

In the present study, it was hypothesized that oxidative stress and inflammatory reactions induced by hypoxia could serve an important role in the onset and development of AMS. To verify this hypothesis and further explore the underlying regulatory mechanism, an AMS rat model was used to study the role and the mechanism of oxidative stress response and inflammatory factors, such as IL-17C, in the occurrence and development of AMS.

Materials and methods

Establishment of the animal model of AMS

A total of 48 male Sprague-Dawley rats weighing 180–220 g and aged 12 weeks were purchased from the Laboratory Animal Center of The Medical Department of Xi'an Jiaotong University [SCXK (Shaanxi) 2018-001], and kept in a specific pathogen-free at 20°C environment. Rats were provided with water and food ad libitum under a 12-h light/dark cycle. Rats were randomly divided into a control group (980 hPa) and simulated acute hypoxic stress groups (475 hPa) for 24, 48 and 72 h (n=12 in each group). The animals in the simulated hypoxia group were placed in a hypobaric oxygen chamber at a simulated altitude of 6,000 m for the aforementioned periods of time. The altitude in the chamber increased at a uniform speed of 10 m/sec. The rats were given free access to standard rodent food and water. Then, 30 mg/kg pentobarbital sodium was injected intraperitoneally to anesthetize the rats. When the breathing of the rat became slow and smooth and muscles were loose, the tissue of both lungs was removed if no traction reflex was observed, and the rat was then decapitated (28). The morphological changes in the right upper lobe lung tissue were detected using hematoxylin and eosin (H&E) staining under light microscopy and transmission electron microscopy. The remaining lung tissues were immediately stored in three cryopreservation tubes and then subjected to transcriptome sequencing and oxidative stress response evaluation (measurement of SOD levels). The levels of MDA, GSH-Px and inflammatory factors (IL-1β, IL-6, IL-17C, NF-κB, and TNF-α) were also assessed. The measures for handling animals involved in the sampling process were implemented in accordance with the National Regulations on the Administration of Laboratory Animals (GB14923-2010; http://www.cmu.edu.cn/sydwb/info/1835/1388.htm). The animal experiment scheme was assessed and approved by the Ethics Committee of School of Medicine of Qinghai University.

Histomorphological examination of lung tissue

Tissue was harvested from the right upper lobe of the lung, then fixed in 4% paraformaldehyde for 4 weeks at 4°C, embedded in paraffin, and sectioned to 5-µm thickness. Lung sections were concurrently stained with H&E (~95 min) for histopathological examination. Images were captured using a light microscope (magnification, ×400).

After dissection, the remaining fresh lung tissues were immersion-fixed in 2.5% glutaraldehyde for 24 h at 4°C. The samples were post-fixed in 1% osmium tetroxide for 1.5 h at 4°C, dehydrated through a series of graded ethanol solutions and 1:1 EPON-812 epoxy resin, and then embedded in EPON-812 epoxy resin. 5 nm semi-thin sections were stained with toluidine blue for 10 min, blocks trimmed, and ultrathin sections stained with lead citrate and uranyl acetate at room temperature. Specimens were examined using a transmission electron microscope (magnification, ×10,000 or 20,000).

RNA sequencing and differential gene screening

Briefly, the total RNA of lung tissue was prepared with an RNA TRIzol® reagent (Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's instructions and agarose gel electrophoresis of extracted RNA performed to ensure sample RNA integrity and inexistence of DNA contamination. Finally, the differentially expressed genes were analyzed by functional annotation and enrichment analysis using clusterProfiler software (http://www.bioconductor.org/packages/release/bioc/html/clusterProfiler.html) for Gene Ontology functional enrichment analysis of the differential gene sets and Kyoto Encyclopedia of Genes and Genomes (KEGG) (29) pathway enrichment analysis and then the differentially related genes associated with AMS in the IL-17 signaling pathway screened.

Reverse transcription-quantitative PCR (RT-qPCR)

A total of 0.1 g lung tissue was ground in liquid nitrogen and then 1 ml TRIzol® (Thermo Fisher Scientific, Inc.) added to extract the total RNA. The cDNA was obtained using a PrimeScript RT reagent kit with gDNA Eraser (Takara Bio, Inc.). RT-qPCR was performed using a TB Green Premix Ex Taq II (Takara Bio, Inc.) with a PIKORed 96 RT-PCR detection system (Thermo Fisher Scientific, Inc.). All operations were performed in accordance with the manufacturer's protocols. Relative gene expression levels of IL-1, IL-6, IL-17C, NF-κB, and TNF-α were determined using the comparative 2−ΔΔCq method using β-actin as endogenous control (30). The thermocycling conditions were: denaturation temperature 94°C for 30 sec, annealing temperature 56°C for 35 sec and extension temperature 72°C for 30 sec (36 cycles). The primer sequences in this study are shown in Table I. Each experiment was repeated more than three times per tissue to ensure consistency of the experimental results.

Table I.

Primer sequences for IL-17C, NF-κB, IL-1β, IL-6 and TNF-α.

Table I.

Primer sequences for IL-17C, NF-κB, IL-1β, IL-6 and TNF-α.

AnalyteForward primer sequence, 5′-3′Reverse primer sequence, 5′-3′
IL-1β AAACAGATGAAGTGCTCCTTCCAGG TGGAGAACACCACTTGTTGCTCCA
IL-17C GCCTATTTGCCCACCTACAA AAATTCAGACGGCAAACGAC
IL-6 TGTGTGAAAGCAGCAAAG AGTCTCCTCATTGAATCCA
TNF-α CGATGAACCACGCCAGTCGCC GGATGAACACGCCAGTCGCC
NF-κB CGACGTATTGCTGTGCCTTC TTGAGATCTGCCCAGGTGGTA
β-actin GAGACCTTCAACACCCAGCC GCGGGGCATCGGAACCGCTCA

[i] IL, interleukin; TNF-α, tumor necrosis factor-α; NF-κB, nuclear factor-κB.

Western blot analysis

The protein expressions of IL-1, IL-6, IL-17C, NF-κB, and TNF-α in lung tissues were detected by WB. The lung tissue was homogenized in RIPA containing protease and phosphatase inhibitors (Beyotime Institute of Biotechnology) and lysed on ice for 10 min. The lysate was centrifuged at 12,000 × g at 4°C for 10 min to collect the supernatant. The total protein concentration was detected using the BCA protein quantification kit (Beyotime Institute of Biotechnology). Subsequently, protein sample was separated on 7% SDS-PAGE gel with 40 µg protein loaded per lane and transferred onto PVDF membranes (Sigma-Aldrich; Merck KGaA). PVDF membrane was placed in 5% skimmed milk diluted with TBST (0.1% Tween) Buffer, incubation box and agitated for 2 h. The PVDF membrane was washed three times with TBST for 5 min each. The above operations were all performed at room temperature. The primary antibodies anti-β-actin (1:100,000; cat. no. AC026; Abclonal), anti-IL-1 (1:1,000; cat. no. ab234437; Abcam), anti-IL-6 (1:1,000; cat. no. ab9324; Abcam), anti-IL-17C (1:1,000; cat. no. bs26112; BIOSS), anti-NF-κB, (1:1,000; cat. no. ab32536; Abcam), and anti-TNF-α (1:1,000; cat. no. ab55275; Abcam) were used to detect the relative protein expression in samples and the secondary antibody was Goat Anti-Rabbit IgG H&L (1:5,000; cat. no. ab6721; Abcam). Images were acquired using Tanon GIS chassis control software v2.0 (Shanghai, China).

Detection of relevant indicators of oxidative stress

The levels of GSH-Px, SOD and MDA in lung tissue were determined using ELISA kits purchased from Shanghai Enzyme Union Biotechnology Co. Ltd. (cat. nos. ml059387-C, ml097316-C and ml077384-C). Standard curve pore and detection pore were established. Optical density was measured at 450 nm wavelength using a microplate reader. GSH-Px, SOD and MDA levels were calculated using a standard curve.

Statistical analysis

All data were analyzed using SPSS 22.0 (IBM Corp.) statistical analysis software, and shown as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) was used with the Tukey HSD post hoc test. Two-tailed Student's t-test were applied to analyze the significant differences between the groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Morphological changes in rat lung tissue at different time points following hypoxic stress

Lung tissue of the 24 h group (Fig. 1B) showed thickening of the alveolar septum and inflammatory cell infiltration not visible in the control group (Fig. 1A). The alveolar structure of the 48-h group was severely damaged (Fig. 1C), with a large number of inflammatory cells and red blood cells diffused in the field of vision. Lung tissue injury was still apparent in the 72-h group (Fig. 1D). However, alveolar structure showed none of the damage visible in the 48-h group, suggesting recovery from hypoxic stress at the 72-h time point.

Figure 1.

Histomorphological changes in the lungs of Sprague-Dawley rats of different groups. Light microscopy images for the (A) 0 h group, (B) 24 h group, (C) 48 h group and (D) 72 h group. Scale bar, 10 µm. Electron microscope for the (E) 0 h group, scale bar, 1 µm, (F) 24 h group, scale bar, 500 nm, (G) 48 h group, scale bar, 1 µm) and (H) 72 h group, scale bar, 500 nm. Pathological changes are indicated by arrows.

Electron microscopy demonstrated that the thickness of the basement membrane of the capillary increased, compared with the control group (Fig. 1E) to different extents. The control group was also used as a marker to measure the pathological damage of each group of rats. In the lung tissue of the 24 h group, the thickness of the capillary basement membrane increased to varying degrees. Alveolar septum capillary thickness also increased, and microvilli shedding was observed (Fig. 1F). In the 48 h group, alveolar wall capillary endothelial cell edema became more apparent (Fig. 1G). In the 72 h group, basal membrane partial shedding and blood-air barrier obviously thinning are still evident (Fig. 1H).

Transcriptome sequencing results

RNA sequencing analysis of lung tissues from rats in each group identified 1,728 differentially expressed genes in the 24 h, and 2,148 differentially expressed genes were found in the 48 h group, and there were 8,201 genes of 72 h group differentially expressed relative to the control group. The differentially expressed genes were obtained by KEGG (Fig. 2). The present study focused on the IL-17 signaling pathway. The main differentially expressed genes in this pathway were IL-17C, NF-κB, IL-1β, IL-6, and TNF-α.

Figure 2.

The Kyoto Encyclopedia of Genes and Genomes function classification of differentially expressed genes in the 48 h group, vs. the 0 h group. IL-17 signaling pathway is underlined in red.

Expression of IL-1β, IL-6, IL-17C, NF-κB, and TNF-α in rats subjected to 24, 48 or 72 h of hypoxic stress

The expression of IL-17C was significantly upregulated in the 24, 48 and 72 h groups, compared with the control group. NF-κB expression was a significantly upregulated after 48 and 72 h of hypoxia. The expression of IL-1β, TNF-α and IL-6 was also significantly upregulated at all time points (Fig. 3).

Figure 3.

Expression of IL-17C, NF-κB, IL-1β, IL-6, and TNF-α in lung tissues of Sprague Dawley rats in different groups; *P<0.01 and **P<0.01, vs. the 0 h group.

Levels of GSH-Px, SOD and MDA in rats under hypoxic stress in different groups

The activity of SOD and GSH-Px decreased significantly after 24, 48 and 72 h of hypoxia (P<0.01), while the expression of MDA increased significantly after 48 and 72 h of hypoxic stress (P<0.01; Table II).

Table II.

Experimental results of oxidative stress in rats of each group.

Table II.

Experimental results of oxidative stress in rats of each group.

GroupnGSH-Px (mg/l)SOD (Um/l)MDA (nmol/ml)
  0 h64.18±0.162.62±0.110.91±0.04
24 h6 3.63±0.12a 2.31±0.15a0.91±0.02
48 h6 3.47±0.25a 2.25±0.18a 0.95±0.04a
72 h6 3.93±0.36a 2.36±0.16a 0.95±0.04a

a P<0.01 GSH-Px, glutathione peroxidase; SOD, superoxide dismutase; MDA, malondialdehyde.

Discussion

After rapid exposure to a hypoxic environment, a series of reactions as oxidative stress response occur to adapt to the hypoxic environment and even damage the lung tissue. The main manifestations include diffuse swelling and hyperemia of both lungs, considerable leakage of protein-rich liquid into the alveolar cavity, thickening of the alveolar cavity (31), increasing the activity of macrophages and infiltration of inflammatory cells (32). Luo et al (33) and Guo et al (34) demonstrated that lung tissue injury was most serious after exposure to a simulated altitude of 5,000 m and 48 h of hypoxia. Li et al (35) also suggested that lung tissue injury was the most serious after exposure to a simulated altitude of 6,000 m and hypoxic stress lasting 72 h. In the present study, Sprague-Dawley rats were exposed to a simulated altitude of 6,000 m and hypoxia stress lasting 24, 48 or 72 h. Morphological examination of the lung tissues in each group suggested that the alveolar structure of rats in hypoxic stress groups was damaged to varying degrees. Lung tissue was damaged most severely after hypoxic stress lasting 48 h.

The production of ROS and the elimination of antioxidants create a stable dynamic balance. When the organism is subjected to hypoxic stress, oxygen-free radicals accumulate in cells and damage lipids, proteins and DNA, thus causing lung tissue damage (36–38). The present study suggested that the activities of SOD and GSH-Px decreased and the expression of MDA increased as hypoxic stress was prolonged; that is, oxidative damage occurred in lung tissue under hypoxic stress.

Oxidative damage can directly stimulate macrophages to release IL-1β. As a pro-inflammatory factor, IL-1β can initiate immune response and recruit centralized granulocytes, macrophages and other inflammatory cells, which in turn can to infiltrate tissues and release IL-6 and TNF-α (39). The results of the present study demonstrated that IL-1β levels were highest after 24 h of hypoxic stress, while IL-6 and TNF-α expression was highest after 48 h of hypoxic stress. GSH-Px and SOD activity were the lowest after 48 h of hypoxia stress, and MDA was highly expressed, suggesting that inflammation and the exudation of tissue fluid in lung tissue were further aggravated. The injury to alveolar epithelial cells and pulmonary interstitial edema was most pronounced at 48 h. Previous studies demonstrated that IL-17C was not produced by activated T cells (22); rather, it is secreted by the epithelial cells of various tissues (40). In the present study, it was hypothesized that, given the aforementioned three factors, pulmonary epithelial cells could also participate in the immune response. The presence of large quantities of IL-17C activates the NF-κB pathway and participates in the onset and development of AMS. According to the experimental results of the present study, IL-17C stimulation could increase the expression of NF-κB in the AMS rat model. The combined stimulation of IL-17C and NF-κB also increased the expression of IL-17C, NF-κB, TNF-α, IL-1β, and IL-6 in alveolar epithelial cells, which also reflects the positive feedback regulation of IL-17C on the acute inflammatory response of pulmonary epithelial cells.

The innovation of the current study was the combination of hypoxia-induced oxidative stress and excessive inflammation to study the damage to the body. Under hypoxic stress, rats quickly initiate the oxidative stress response and immune response, but it is worth noting that, with the prolongation of hypoxic stress time, excessive oxidative stress can further stimulate the immune system, and release a large number of inflammatory factors, which accumulate in the body, and even lead to the occurrence of inflammatory storms.

According to the literature, IL-17C can also regulate the expression of IL-1β, TNF-α, and IL-6. However, the expression of these three factors was downregulated in the 72-h group. The specific molecular mechanism needs further study, and it may be related to the immune regulatory function of 1,25-dihydroxyvitamin D3 (41), studied earlier by our group.

Acknowledgements

Not applicable.

Funding

The present study was supported by The Second Tibetan Plateau Scientific Expedition and Research Program (grant no. 2019QZKK0606), The Chinese National Natural Science Foundation (grant no. 81460051), The Key Laboratory of Medicinal Animal and Plant resources of The Qinghai-Tibetan Plateau (grant no. 2017-ZJ-Y13), The Department of Science and Technology of Qinghai Province (grant no. 2019-ZJ-7042), The Scientific Research for Middle-aged and Young people of the Medical College of Qinghai University (grant no. 2018-kyy-1), and The National Students' Platform for Innovation and Entrepreneurship Training Program (grant no. 201910743003).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Authors' contributions

XP contributed to the idea of the study and served an important role in interpreting the results. FL contributed significantly to analysis and manuscript preparation. XL performed data analysis and wrote the manuscript. ZC and RW helped perform the analysis with constructive discussion. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The animals involved in the present study were handled in accordance with the National Regulations on the Administration of Laboratory Animals (GB14923-2010). The animal experiment scheme was approved and examined by the Ethics Committee of School of Medicine of Qinghai University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Tang E, Chen Y and Luo Y: Dexamethasone for the prevention of acute mountain sickness: Systematic review and meta-analysis. Int J Cardiol. 173:133–138. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Guo P, Luo H, Fan Y, Luo Y and Zhou Q: Establishment and evaluation of an experimental animal model of high altitude cerebral edema. Neurosci Lett. 547:82–86. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Swenson ER, Maggiorini M, Mongovin S, Gibbs JS, Greve I, Mairbäurl H and Bärtsch P: Pathogenesis of high-altitude pulmonary edema: Inflammation is not an etiologic factor. JAMA. 287:2228–2235. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Zhao S, Zhang L, Lian G, Wang X, Zhang H, Yao X, Yang J and Wu C: Sildenafil attenuates LPS-induced pro-inflammatory responses through down-regulation of intracellular ROS-related MAPK/NF-κB signaling pathways in N9 microglia. Int Immunopharmacol. 11:468–474. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Wyse C, Cathcart A, Sutherland R, Ward S, McMillan L, Gibson G, Padgett M and Skeldon K: Effect of maximal dynamic exercise on exhaled ethane and carbon monoxide levels in human, equine, and canine athletes. Comp Biochem Physiol A Mol Integr Physiol. 141:239–246. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Balan DJ, Rajavel T, Das M, Sathya S, Jeyakumar M and Devi KP: Thymol induces mitochondrial pathway-mediated apoptosis via ROS generation, macromolecular damage and SOD diminution in A549 cells. Pharmacol Rep. 73:240–254. 2021. View Article : Google Scholar : PubMed/NCBI

7 

Ma Y, Wang D, Xu X, Yang X, Wang X, Zhu Z, Zhao Y, Chen M, Xu F, Fu L, et al: Dynamic changes of ROS, MDA and SOD during arsenic-induced neoplastic transformation in human keratinocytes. Wei Sheng Yan Jiu. 44:456–461. 2015.(In Chinese). PubMed/NCBI

8 

Zi Y, Jiang B, He C and Liu L: Lentinan inhibits oxidative stress and inflammatory cytokine production induced by benzo(a)pyrene in human keratinocytes. J Cosmet Dermatol. 19:502–507. 2020. View Article : Google Scholar : PubMed/NCBI

9 

Altamura S, Bärtsch P, Dehnert C, Maggiorini M, Weiss G, Theurl I, Muckenthaler MU and Mairbäurl H: Increased hepcidin levels in high-altitude pulmonary edema. J Appl Physiol (1985). 118:292–298. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Gao H, Liu L, Zhao Y, Hara H, Chen P, Xu J, Tang J, Wei L, Li Z, Cooper DK, et al: Human IL-6, IL-17, IL-1β, and TNF-α differently regulate the expression of pro-inflammatory related genes, tissue factor, and swine leukocyte antigen class I in porcine aortic endothelial cells. Xenotransplantation. 24:2017. View Article : Google Scholar

11 

Sun Y, Hu G, Zhang X and Minshall RD: Phosphorylation of caveolin-1 regulates oxidant-induced pulmonary vascular permeability via paracellularand transcellular pathways. Circ Res. 105:676–685. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Shukla D, Saxena S, Jayamurthy P, Sairam M, Singh M, Jain SK, Bansal A and Ilavazaghan G: Hypoxic preconditioning with cobalt attenuates hypobaric hypoxia-induced oxidative damage inratlungs. High Alt Med Biol. 10:57–69. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Gonzalez NC and Wood JG: Leukocyte endothelial interactions in environmental hypoxia. Adv Exp Med Biol. 502:39–60. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Xiao-Lin MA, Jin RB, Zhang XH, Cui GY, Ren XJ, Shi H and Sun YQ: Study on management of 726 victims in military hospitals following Yushu earthquake in Qinghai province. J Traumat Surg. 4:339–343. 2010.(In Chinese).

15 

Tang C, Luo Y, Li S, Huang B, Xu S and Li L: Characteristics of inflammation process in monocrotaline-induced pulmonary arterial hypertension in rats. Biomed Pharmacother. 133:1110812021. View Article : Google Scholar : PubMed/NCBI

16 

Han Z, Li X, Cui X, Yuan H and Wang H: The roles of immune system and autoimmunity in pulmonary arterial hypertension: A review. Pulm Pharmacol Ther 102094. Nov 2–2021.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

17 

Hu DL, Yu YX, Liang R, Zhou SY, Duan SL, Jiang ZY, Meng CY, Jiang W, Wang H, Sun YX and Fang LS: Regulation of hypoxia inducible factor-1α on permeability of vascular endothelial cells and the mechanism. Zhonghua Shao Shang Za Zhi. 35:209–217. 2019.(In Chinese). PubMed/NCBI

18 

Zhou Q, Luo Y, Li H, Li S, Zhang X, Gao W, Zheng B, Yang D, Liu F and Yuqi G: Epidemiological study of mountain sickness complicated with multiple organ dysfunction syndrome on the Qinghai-Tibetan Plateau: report of 103 cases. Sci Res Essays. 5:2010.

19 

Althubiti M, Rada M, Samuel J, Escorsa JM, Najeeb H, Lee KG, Lam KP, Jones GD, Barlev NA and Macip S: BTK modulates p53 activity to enhance apoptotic and senescent responses. Cancer Res. 76:5405–5414. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Barbarulo A, Grazioli P, Campese AF, Bellavia D, Di Mario G, Pelullo M, Ciuffetta A, Colantoni S, Vacca A, Frati L, et al: Notch3 and canonical NF-kappaB signaling pathways cooperatively regulate Foxp3 transcription. J Immunol. 186:6199–6206. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Li H, Chen J, Huang A, Stinson J, Heldens S, Foster J, Dowd P, Gurney AL and Wood WI: Cloning and characterization of IL-17B and IL-17C, two new members of the IL-17 cytokine family. Proc Natl Acad Sci USA. 97:773–778. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Song X, He X, Li X and Qian Y: The roles and functional mechanisms ofinterleukin-17 family cytokines in mucosal immunity. Cell Mol Immunol. 13:418–431. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Song X, Zhu S, Shi P, Liu Y, Shi Y, Levin SD and Qian Y: IL-17RE is the functional receptor for IL-17C and mediates mucosal immunity to infection with intestinal pathogens. NatImmunol. 12:1151–1158. 2011.

24 

Akitsu A and Iwakura Y: Interleukin-17-producing γδ T (γδ17) cells in inflammatory diseases. Immunology. 155:418–426. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Yamaguchi Y, Fujio K, Shoda H, Okamoto A, Tsuno NH, Takahashi K and Yamamoto K: IL-17B and IL-17C are associated with TNF-alpha production and contribute to the exacerbation of inflammatory arthritis. J Immunol. 179:7128–7136. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Ruiz de Morales JMG, Puig L, Daudén E, Cañete JD, Pablos JL, Martín AO, Juanatey CG, Adán A, Montalbán X, Borruel N, et al: Critical role of interleukin (IL)-17 in inflammatory and immune disorders: An updated review of the evidence focusing in controversies. Autoimmun Rev. 19:1024292020. View Article : Google Scholar : PubMed/NCBI

27 

Yu S, Luo X, Yang B, Xiao L, Wu X, Li H and Wu C: Poly-functional T helper cells in human tonsillar mononuclear cells. Eur Cytokine Netw. 30:114–122. 2019.PubMed/NCBI

28 

De-Doncker L, Picquet F, Petit J and Falempin M: Characterization of spindle afferents in rat soleus muscle using ramp-and-hold and sinusoidal stretches. J Neurophysiol. 89:442–449. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Kanehisa M and Goto S: KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28:27–30. 2000. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Ryan CF, Lowe AA and Fleetham JA: Nasal continuous positive airway pressure (CPAP) therapy for obstructive sleep apnea in Hallermann-Streiff syndrome. Clin Pediatr (Phila). 29:122–124. 1990. View Article : Google Scholar : PubMed/NCBI

32 

Maggiorini M, Mélot C, Pierre S, Pfeiffer F, Greve I, Sartori C, Lepori M, Hauser M, Scherrer U and Naeije R: High-altitude pulmonary edema is initially caused by an increase in capillary pressure. Circulation. 103:2078–2083. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Luo X, Guo W, Xu R, et al: Effect of high altitude and hypoxia in simulated environment on HPT axis and expression of VEGF and HIF-1 in lung tissues of rats. Acad J Chin PLA Med Sch. 37:864–868. 2016.(In Chinese).

34 

Guo W: The dynamic observation of hypothalamic-pituitary-adrenala axis/hypothalamic-pituitary-thyroid axis stress and the effect of lung and brain tissue under simulated high altitude hypoxia. Gan Su University of Chinese Medicine; 2016, (In Chinese).

35 

Li Y: The research of hypoxia related genes in high altitude pulmonary edema. Qing Hai University; 2017, (In Chinese).

36 

Brandon M, Baldi P and Wallace DC: Mitochondrial mutations in cancer. Oncogene. 25:4647–4662. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Morrow JD: Quantification of isoprostanes as indices of oxidant stress and the risk of atherosclerosis in humans. Arterioscler Thromb Vasc Biol. 25:279–286. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Zhou L, Aon MA, Almas T, Cortassa S, Winslow RL and O'Rourke B: A reaction-diffusion model of ROS-induced ROS release in a mitochondrial network. PLoS Comput Biol. 6:e10006572010. View Article : Google Scholar : PubMed/NCBI

39 

Xiong R, Jiang W, Li N, Liu B, He R, Wang B and Geng Q: PM2.5-induced lung injury is attenuated in macrophage-specific NLRP3 deficient mice. Ecotoxicol Environ Saf. 221:1124332021. View Article : Google Scholar : PubMed/NCBI

40 

Ramirez-Carrozzi V, Sambandam A, Luis E, Lin Z, Jeet S, Lesch J, Hackney J, Kim J, Zhou M, Lai J, et al: IL-17C regulates the innate immune function of epithelial cells in an autocrine manner. Nat Immunol. 12:1159–1166. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Uberti F, Lattuada D, Morsanuto V, Nava U, Bolis G, Vacca G, Squarzanti DF, Cisari C and Molinari C: Vitamin D protects human endothelial cells from oxidative stress through the autophagic and survival pathways. J Clin Endocrinol Metab. 99:1367–1374. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pu X, Li F, Lin X, Wang R and Chen Z: Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats. Mol Med Rep 25: 49, 2022.
APA
Pu, X., Li, F., Lin, X., Wang, R., & Chen, Z. (2022). Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats. Molecular Medicine Reports, 25, 49. https://doi.org/10.3892/mmr.2021.12565
MLA
Pu, X., Li, F., Lin, X., Wang, R., Chen, Z."Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats". Molecular Medicine Reports 25.2 (2022): 49.
Chicago
Pu, X., Li, F., Lin, X., Wang, R., Chen, Z."Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats". Molecular Medicine Reports 25, no. 2 (2022): 49. https://doi.org/10.3892/mmr.2021.12565
Copy and paste a formatted citation
x
Spandidos Publications style
Pu X, Li F, Lin X, Wang R and Chen Z: Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats. Mol Med Rep 25: 49, 2022.
APA
Pu, X., Li, F., Lin, X., Wang, R., & Chen, Z. (2022). Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats. Molecular Medicine Reports, 25, 49. https://doi.org/10.3892/mmr.2021.12565
MLA
Pu, X., Li, F., Lin, X., Wang, R., Chen, Z."Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats". Molecular Medicine Reports 25.2 (2022): 49.
Chicago
Pu, X., Li, F., Lin, X., Wang, R., Chen, Z."Oxidative stress and expression of inflammatory factors in lung tissue of acute mountain sickness rats". Molecular Medicine Reports 25, no. 2 (2022): 49. https://doi.org/10.3892/mmr.2021.12565
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team