Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2022 Volume 26 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2022 Volume 26 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Binaprofen induces zebrafish liver injury via the mitochondrial pathway

  • Authors:
    • Qiuping Guo
    • Guiying Chen
    • Huiyu Ou
    • Ruomin Jin
    • Qingchun Ni
    • Renan Qin
  • View Affiliations / Copyright

    Affiliations: Drug Non‑Clinical Evaluation and Research Center, Guangzhou General Pharmaceutical Research Institute, Haizhu, Guangzhou 510240, P.R. China, Drug Safety Evaluation Center, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, P.R. China
    Copyright: © Guo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 314
    |
    Published online on: August 17, 2022
       https://doi.org/10.3892/mmr.2022.12830
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Binaprofen (C18H23NO5) is a drug not commercially available that causes liver injury; however, the underlying mechanism is unknown. The aim of the present study was to determine the mechanism underlying binaprofen‑induced liver injury at the genetic level. Zebrafish were treated with binaprofen. Serum biomarkers [alanine transaminase (ALT), aspartate transaminase (AST) and lactate dehydrogenase (LDH)], malondialdehyde (MDA) and glutathione (GSH) content analysis, liver cell morphology examination, DAPI staining, electron microscopy, microarray analysis and reverse transcription‑quantitative (RT‑q)PCR were performed 12, 24 and 48 h post‑treatment to analyze the mechanism underlying binaprofen‑induced liver injury. Following exposure to binaprofen, zebrafish serum levels of ALT, AST and LDH increased; MDA content of liver tissue increased and GSH content decreased. Liver cells exhibited mild to moderate vacuolization and mitochondria exhibited vacuolization and disrupted cristae. Liver cell apoptosis rate increased. There were 190 common differentially expressed genes at 12, 24 and 48 h. Gene Ontology analysis showed that the function of downregulated genes was primarily associated with ‘DNA replication’, ‘DNA metabolic process’, ‘cell cycle’, ‘cell redox homeostasis’, ‘mitochondrion’ and ‘lipid transport’. The function of upregulated genes was primarily associated with ‘peroxisome proliferator’, ‘oxidation activity’, ‘peroxisome’ and ‘apoptosis’. Pathway analysis showed that downregulated genes were those pertaining to ‘cell cycle’, ‘DNA replication’, ‘ribosome’, ‘spliceosome’, ‘pyrimidine metabolism’, ‘purine metabolism’, upregulated genes were those pertaining to ‘PPAR signaling pathway’, ‘p53 signaling pathway’; RT‑qPCR assay supported the microarray results. The mechanism underlying binaprofen‑induced liver injury was associated with lipid peroxidation and apoptosis. Binaprofen downregulated genes associated with lipid transport and anti‑apoptosis genes, upregulated pro‑apoptosis genes and induces liver cell injury via the mitochondrial signaling pathway.

Introduction

Drug-induced liver injury (DILI) is a toxic side effect of numerous drugs (1–4), including a number of anti-inflammatory and analgesia drugs (5–8). DILI is the commonest reason for withdrawing drugs from the market and/or issuing warnings and modification of use (9). Data from prospective DILI registries suggest that antibiotics remain the most common cause of DILI (10–12). The American DILI Network (DILIN) reported antibiotics to be implicated in 45.4% of cases (13). Other common drug classes reported by the American DILIN (14) are herbal and dietary supplements (16.1%), cardiovascular agents (9.8%), central nervous system agents (9.1%), anti-neoplastic agents (5.5%) and analgesics (3.7%). DILI includes the whole spectrum from asymptomatic elevation in liver tests to acute liver failure (ALF). In fact, DILI remains the most common cause of ALF in the UK (14) and USA (15).

Binaprofen is an anti-inflammatory drug that is not currently in market, and still in clinical study; its chemical structure is C18H23NO5 and it relieves fever and analgesia (16–18). It exhibits a notable analgesic effect. Studies have done about the pharmacological and toxicological effects of binaprofen (19,20), and it has been clinical licensed in China.

Our previous study (21) demonstrated that binaprofen induces liver toxicity and damage similar to acetaminophen (APAP) in zebrafish. APAP is one of the most widely used antipyretic and analgesic drugs in the US. It is reported to be regularly consumed by over 60 million Americans on a weekly basis (22). Though it is safe at therapeutic doses, an overdose can cause severe liver injury and even ALF in humans (23). The mechanisms that underlying APAP-induced liver injury have been extensively studied (24,25). So APAP was chosen as positive drug in this paper. To the best of our knowledge, however, the mechanism underlying liver injury has not yet been revealed. The present study aimed to determine this mechanism at the genetic level and provide a basis for potential treatment options.

Materials and methods

Maintenance and breeding of zebrafish

Male and female AB-line, 1–2 g, adult zebrafish (Danio rerio, 90–100 days post-fertilization; weight, 1–2 g) were obtained from Southern Medical University, Guangzhou, China. Zebrafish were acclimatized for 2 weeks. The animal protocol was designed according to animal welfare and ethics, which was approved by animal care and use committee of Guangzhou General Pharmaceutical Research Institute (Haizhu, China; approval no. was 2012-005). Fish were maintained in aerated water at 23±1°C, humidity 65%, pH 7.8±1.0, 0.25 g/l hardness, 12/12-h light/dark cycle and density of 1 fish/l with free access to food and water. Experiments were performed using a total of 150 animals, including 75 male and 75 female.

Zebrafish exposure to binaprofen

Our previous study (21) demonstrated that binaprofen at 0.8 mM and APAP at 4.0 mM cause notable liver damage in zebrafish. Therefore, zebrafish were divided into control (untreated), binaprofen (0.8 mM) and APAP (4.0 mM) groups (n=50/group). Zebrafish were exposed to drug at 22.8°C for 12, 24 or 48 h, then euthanized via 2-step hypothermal shock, as described in AVMA guidelines (26).

Zebrafish were rapidly killed by immersion in 2–4°C water for 10–20 sec. Exposure was continued for ≥10 min following loss of operculum movement to ensure death. Followed by rapid chilling, zebrafish tail was transected as previously described (27) and 20 µl blood was collected. Exsanguination was performed to euthanize zebrafish. Rapid chilling followed by exsanguination was the recommended 2-step euthanasia method in AVMA Guidelines for the Euthanasia of Animals: 2020 Edition (28).

Serum biomarkers detection

Blood was collected by exsanguination. Serum samples were collected by tail cutting and capillary collection method (n=5/group). Briefly, the tail was transected from cranial to the caudal fin, 100-µl microcapillaries was used to collect zebrafish blood from the cut surface and blood was placed in 1.5 ml centrifugal tube. A total of 200 µl blood was collected as one sample; there were 5 samples/group. Blood was centrifuged for 10 min at 1,800 × g at 4°C. Supernatant was collected to detect alanine transaminase (ALT), aspartate transaminase (AST) and lactate dehydrogenase (LDH) (ALT assay kit, cat. no. 130301, AST assay kit, cat. no. 130201and LDH assay kit, cat. no. 130503, all kits from Zhejiang Yilikang biotek Company) by biochemical detection method using a biochemical analyzer (7100; Hitachi, Ltd.).

Malondialdehyde (MDA) and glutathione (GSH) detection

The entire zebrafish liver (n=5/group) was collected and placed in 1.5 ml centrifugal tube. 0.9% NaCl was added and liver tissue was homogenized and centrifuged for 10 min at 4,000 × g at 4°C. Supernatant was collected to detect MDA and GSH (MDA assay kit, cat. no. 20130515 and GSH assay kit, cat. no. 20130428; both kits from Nanjing Jiancheng Bioengineering Institute) using a microplate reader (Elx800; BioTek China) according to the manufacturer's instructions.

Histological analysis

Liver tissue samples (n=10/group) were fixed in 10% formalin for at 25°C for 24 h and dehydrated with gradient alcohol. Tissue was immersed in 60°C paraffin wax for 1 h and moved to −10°C freezing table for 30 min. Paraffin-embedded samples were sliced (5 µm). Sections were dewaxed with xylene and rehydrated in descending alcohol. Slices were dyed with 0.5% hematoxylin aqueous solution at 25°C for 3 min and 0.5% eosin staining solution at 25°C for 3 min. 90% neutral balata was used as blocking reagent, slices were blocked at 25°C for 30 sec. Morphological examination of hepatocytes was performed using a light microscope (BX51; Olympus Corporation) at 40X magnification using image analysis system 11.0 (cellSens Standard; both Olympus Corporation). Samples were scored as previously described (29) by two independent pathologists who were blinded to the experimental groups.

DAPI analysis

Liver tissue slices (n=10/group) were prepared as aforementioned. Slices were stained with 1 µg/ml DAPI at 25°C for 20 min. Apoptosis of hepatocytes was assessed by fluorescence microscopy (BX51, Olympus Corporation) with fluorescence light, 40× magnification using image analysis system 11.0 (cellSens Standard; both Olympus Corporation, Japan). Five visual fields were randomly selected from each slice to observe the apoptotic cells. Normal cell: complete nucleus and uniform chromatin; Apoptosis cell: nuclear enrichment, deep staining, or crescent-shaped aggregation of nuclear chromatin on one side of the nuclear membrane.

Electron microscopic detection of mitochondria

Liver tissue samples were fixed in 2% osmium tetroxide at 4°C for 24 h, dehydrated, embedded in Epon/Araldite resin at 4°C for 1 h and sectioned (70 nm). Samples were stained with premixed solutions of 2% uranyl acetate and lead citrate at 4°C for 20 min. Ultrastructure examination of hepatocytes was performed using a transmission electron microscope (JEM-1400; JEOL, Ltd.) with 10× magnification. The morphological changes of hepatocyte mitochondria were examined using image analysis system 11.0 (cellSens Standard; both Olympus Corporation).

Microarray analysis

Livers tissue samples were collected and total RNA was extracted (RNA extraction kit, Qiagen GmbH) and purified. RNA quality was assessed before detection. RNA was hybridized into two gene chip probe arrays (Affymetrix; Thermo Fisher Scientific, Inc.). RNA was used to synthesize double stranded cDNA (iScipt cDNA Synthesis kit; Qiagen GmbH, German) and produce biotin-tagged cDNA. cDNA was fragmented to strands 35–200 bases in length. Fragmented cRNA was hybridized to gene chip array at 45°C for 16 h using Gene Chip Hybridization Oven640 (Affymerix; Thermo Fisher Scientific, Inc., US). Gene chip arrays were washed using Gene Chip IVT labeling kit (Affymerix; Thermo Fisher Scientific, Inc., US) and stained in SAPE solution at 25°C for 10 min using Affymetrix Fluidics Station 450 and scanned using Gene Chip Scanner 3000 (both Affymetrix; Thermo Fisher Scientific, Inc., US) with SAPE solution and array holding buffer at 25°C for 10 cycles.

Gene chip data were analyzed using Gene Chip Operating Software (version 1.4, Thermo Fisher Scientific, Inc.). The criterion of differentially expressed genes was >2-fold change compared with control. Gene Ontology (GO analysis) was performed to determine the function of differentially expressed genes by using Gene Ontology Resource (geneontology.org).

Kyoto Encyclopedia of Genes and Genomes Pathway analysis was performed to determine the pathways associated with differentially expressed genes by KEGG pathway database (https://www.kegg.jp). P<0.05 was considered to indicate a statistically significant difference. Common different genes were analyzed using VENN database (bioinformatics.psb.ugent.be).

Reverse transcription-quantitative (RT-q)PCR

Microarray data were validated by RT-qPCR using five samples/group. GAPDH was used as housekeeping for the internal control. A total of six candidate genes was chosen for RT-qPCR. Primer 5.0 software (PREMIER Design Lnc.) was used to design primers (Table I). RNA was extracted from liver samples and purified (RNA Simple Total RNA kit; Tiangen Biotech Co., Ltd.). RT-qPCR was performed by cDNA synthesis (iScipt cDNA Synthesis kit) and amplification using a 2 Real-time Detection system (2X QuantiFast SYBR Green PCR Master Mix; both Qiagen GmbH). RT kit was used according to the manufacturer's protocol. Thermocycling conditions were as follows: Initial denaturation at 94°C for 4 min, followed by 45 cycles of 94°C for 20 sec, 58°C for 25 sec and 72°C for 25 sec. Melting curve analysis was performed. Following amplification, quantitative detection was performed using a fluorescence qPCR instrument (cat. no. DA7600; Daan Gene Co., Ltd.). The relative fold change was calculated using the 2−ΔΔCq method (30).

Table I.

Primer design.

Table I.

Primer design.

PrimerSequence, 5′→3′
Zebrafish-Zgc136383-F GTTCCCATCAATCCAGACGGT
Zebrafish-Zgc136383-R TGACAGTTCTGCATCAACACATC
Zebrafish-Zgc123120-F CCAGACACCTCCCCTCATT
Zebrafish-Zgc123120-R CTCTCCAGCACAACTTCCC
Zebrafish-Eif4ebp3l-F AAGAAAGCACATCAGAACATAAA
Zebrafish-Eif4ebp3l-R GAAATCCAGGCAAACGAAA
Zebrafish-Cap3-F CCGCTGCCCATCACTAGA
Zebrafish-Cap3-R ATCCTTTCACGACCATCT
Zebrafish-Loc100330641-F TGAGATTGCTAATGGTGTTGGC
Zebrafish-Loc100330641-R ACATAGCCGTACCATTGACACTTGC
Zebrafish-Vtg6-F TGAGTATGCTAATGGTGTGGTTGGC
Zebrafish-Vtg6-R TGTTCTGCGTCTTCTTGAGGTTGAG
Zebrafish-GAPDH-F GTGACCCCTTTGCTGTTTCTTT
Zebrafish-GAPDH-R GGCACGTGGTGCAAACATT

[i] F, forward; R, reverse; Zgc136383, vitellogenin 4; Zgc123120, BCL2/adenovirus E1B interacting protein 4; Eif4ebp31, eukaryotic translation initiation factor 4E binding protein 3; Cap 3, apoptosis-related cysteine peptidase 3; Loc100330641, vitellogenin-like; Vtg 6, vitellogenin 6.

Statistical analysis

SPSS software (13.0; SPSS, Inc.) was used for statistical analysis. The data are presented as mean ± SD (n=5). Variables with normal distribution were analyzed with Student's t-test (unpaired) for two groups; for multiple groups, one-way ANOVA followed Tukey's post hoc test was used. Variables with abnormal distribution were analyzed with Mann-Whitney test. P<0.05 was considered to indicate a statistically significant difference.

Results

Value of serum biomarkers

Compared with control, APAP increased ALT and LDH levels at 48 h (Fig. 1). Binaprofen treatment increased ALT, AST and LDH levels at 48 h. These results indicated injury or inflammation of liver.

Figure 1.

Value of serum biomarkers. ALT, AST and LDH serum levels following exposure to binaprofen or APAP for 12, 24 and 48 h. One-way ANOVA showed no significant difference between treatment groups and control at 12 and 24 h. ALT, AST and LDH increased significantly in binaprofen group at 48 h. *P<0.05 vs. control. ALT, alanine transaminase; AST, aspartate transaminase; LDH, lactate dehydrogenase; APAP, acetaminophen.

Value of MDA and GSH

Compared with control group, APAP and binaprofen increased MDA and decreased GSH levels at 48 h (Fig. 2). These results indicated increased levels of hepatic oxidative products.

Figure 2.

Value of MDA and GSH. MDA and GSH levels in liver tissue following exposure to binaprofen or APAP for 12, 24 and 48 h. One-way ANOVA showed no difference between treatment and control groups at 12 and 24 h. MDA increased and GSH decreased significantly in binaprofen group at 48 h. *P<0.05, **P<0.01 vs. control. MDA, malondialdehyde; GSH, glutathione; APAP, acetaminophen.

Liver morphological changes from histological analysis

Compared with control group, APAP caused mild vacuolization in 2/10 samples at 12 and 24 h and mild to moderate vacuolization in all samples at 48 h (Fig. 3). Binaprofen caused mild vacuolization in one sample at 12 h and 2 samples at 24 h and mild to moderate vacuolization in 5/10 samples at 48 h. These results indicated morphological changes of liver cell.

Figure 3.

Representative hematoxylin and eosin-stained micrographs of zebrafish liver cells following exposure to binaprofen or APAP for 12, 24 and 48 h. There was no notable change in zebrafish liver cells following exposure to binaprofen at 12 and 24 h. Half of zebrafish liver samples exhibited mild (arrow) to moderate vacuolization at 48 h in binaprofen group. Magnification, ×400 (top) and ×800 (bottom). APAP, acetaminophen.

Liver cell apoptosis

Control cells exhibited round nuclei with clear edges and uniform staining, while the nuclei of apoptotic cells exhibited irregular edges and concentration of chromosomes (Fig. 4). Liver cells with strong staining accompanied by nuclear contraction and nucleosome fragmentation were considered to indicate apoptosis. In Binaprofen and APAP groups, DAPI staining is bluish-white fluorescent, apoptotic cells presented with nuclear enrichment, deep staining, or crescent-shaped aggregation of nuclear chromatin on one side of the nuclear membrane. The nucleus broke down to form fragments and disintegrated. These results indicated that liver cell apoptosis occurred in binaprofen and APAP groups.

Figure 4.

Representative DAPI-stained micrographs of zebrafish liver cells following exposure to binaprofen or APAP for 12, 24 and 48 h. Zebrafish liver cells exhibited apoptosis at 48 h. Apoptotic cells (arrow) presented with nuclear enrichment, deep staining, or crescent-shaped aggregation of nuclear chromatin on one side of the nuclear membrane and nucleus broke down to form fragments and disintegrated. Magnification, ×400 (top) and ×800 (bottom). APAP, acetaminophen.

Mitochondrial change

Compared with control, APAP treatment caused endoplasmic reticulum thickening, mitochondrial swelling and vacuolation and ruptured cristae at 48 h (Fig. 5). Binaprofen treatment caused mitochondrial swelling and vacuolation and rupture or disappearance of cristae at 48 h.

Figure 5.

Representative transmission electron microscopy micrographs of zebrafish liver cells following exposure to binaprofen or APAP for 12, 24 and 48 h. Liver cell mitochondria (arrow) are swollen and vacuolarized, arranged in disorder or rupture of the crest at 48 h. Magnification, ×30,000 (top) and ×60,000 (bottom). APAP, acetaminophen.

Gene expression profiling

Compared with control group, in binaprofen group, 3,673 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels at 12 h. Of these, 2499 genes were up- and 1,174 genes were downregulated. At 24 h, 3,945 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels; of these, 2,745 genes were up- and 1,200 genes were downregulated. At 48 h, 5,496 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels; of these, 3,851 genes were up- and 1,645 genes were downregulated (Table II, Fig. 6). Venn analysis identified 190 common differentially expressed genes at 12, 24 and 48 h. The function of downregulated genes was primarily associated with ‘DNA replication’, ‘DNA metabolic process’, ‘cell cycle’, ‘cell redox homeostasis’, ‘mitochondrion’ and ‘lipid transport’. The function of upregulated genes was primarily associated with ‘peroxisome proliferator’, ‘oxidation activity’, ‘peroxisome’ and ‘apoptosis’. There was a significant increase in Bcl2 and caspase gene expression. Expression levels of 8 genes were different at 12, 24 and 48 h; of these, six genes were down- and two were upregulated (Table III).

Figure 6.

Microarray and RT-qPCR assay of zebrafish liver cells following exposure to binaprofen for 48 h. Volcano graphs showed that 3,673 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels at 12 h. Of these, 2,499 genes were up- and 1,174 genes were downregulated. At 24 h, 3,945 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels; of these, 2,745 genes were up- and 1,200 genes were downregulated. At 48 h, 5,496 genes exhibited fold-change ≥2.0 or ≤0.5 in expression levels; of these, 3,851 genes were up- and 1,645 genes were downregulated. Among these, 6 genes were verified by RT-qPCR assay. A total of five samples/group was used to detect zgc136383, Vtg 6, Loc100330641, Eif4ebp31, Zgc123120 and Cap 3. Heatmap of microarray results was consistent with RT-qPCR results. *P<0.05, **P<0.01 vs. control. RT-q, reverse transcription-quantitative; Zgc136383, vitellogenin 4; Zgc123120, BCL2/adenovirus E1B interacting protein 4; Eif4ebp31, eukaryotic translation initiation factor 4E binding protein 3; Cap 3, apoptosis-related cysteine peptidase 3; Loc100330641, vitellogenin-like; Vtg 6, vitellogenin 6.

Table II.

Number of differentially expressed genes following exposure to binaprofen for 12–48 h.

Table II.

Number of differentially expressed genes following exposure to binaprofen for 12–48 h.

Gene count

Gene regulation12 h (n=3,673)24 h (n=3,945)48 h (n=5,496)
Up2,4992,7451,200
Down1,1741,2001,645

Table III.

Effect of binaprofen on certain differentially expressed genes at 12, 24 and 48 h.

Table III.

Effect of binaprofen on certain differentially expressed genes at 12, 24 and 48 h.

Fold change Time of greatest differential expression, h

Gene12 h24 h48 hRegulation
Zgc1363830.0010.0010.000     Down48
Vtg60.00080.00070.0005     Down48
Loc1003306410.0010.0010.000     Down48
Eif4ebp310.4290.3140.301     Down48
Loc10053528880.00040.00040.0003     Down48
Loc1005347310.4420.4140.276     Down48
Zgc12312011.45918.67315.656Up24
Cap 350.11750.37514.833Up24

[i] Zgc136383, vitellogenin 4; Zgc123120, BCL2/adenovirus E1B interacting protein 4; Eif4ebp31, eukaryotic translation initiation factor 4E binding protein 3; Cap 3, apoptosis-related cysteine peptidase 3; Loc100330641, vitellogenin-like; Vtg 6, vitellogenin 6, Loc100535288, uncharacterized Loc100535288; Loc100534731, uncharacterized Loc100534731.

GO analysis

GO analysis showed that the function of downregulated genes was primarily associated with ‘DNA replication’, ‘DNA metabolic process’, ‘cell cycle’, ‘cell redox homeostasis’, ‘mitochondrion’ and ‘lipid transport’ (Table IV). The function of upregulated genes was primarily associated with ‘peroxisome proliferator’, ‘oxidation activity’ and ‘peroxisome’.

Table IV.

Gene Ontology analysis of differentially expressed genes following exposure to binaprofen for 12–48 h.

Table IV.

Gene Ontology analysis of differentially expressed genes following exposure to binaprofen for 12–48 h.

A, Downregulated genes

Gene count

Term12 h24 h48 h
DNA replication3266
DNA metabolic process7148
Cell cycle4788
Mitochondrion271818
Lipid transport-1510

B, Upregulated genes

Gene count

Term12 h24 h48 h

Peroxisome proliferator28--
Oxidation activity-498
Peroxisome-44
Apoptosis121215

[i] -, indicates that there is no obvious up regulation or downregulation.

Gene pathway analysis

Differentially expressed genes were associated with biological process according to GO pathway analysis. Pathway analysis showed that upregulated and downregulated GO pathways were associated with ‘cell cycle’, ‘DNA replication’, ‘ribosome’, ‘spliceosome’, ‘pyrimidine metabolism’, ‘purine metabolism’, ‘PPAR signaling pathway’ and ‘p53 signaling pathway’ (Table V).

Table V.

Pathway analysis of differentially expressed genes following exposure to binaprofen for 12–48 h.

Table V.

Pathway analysis of differentially expressed genes following exposure to binaprofen for 12–48 h.

Gene count

KEGG IDPathway12 h24 h48 h
dre03030DNA replication242429
dre03010Ribosome-2829
dre03040Spliceosome416-
dre04110Cell cycle414152
dre00240Pyrimidine metabolism31-34
dre00230Purine metabolism34-37
dre03320PPAR signaling pathway-1218
dre04115p53 signaling pathway121213

[i] KEGG, Kyoto Encylcopedia of Genes and Genomes; upregulated and downregulated genes pathways were associated with ‘cell cycle’, ‘DNA replication’, ‘ribosome’, ‘spliceosome’, ‘pyrimidine metabolism’, ‘purine metabolism’, ‘PPAR signaling pathway’ and ‘p53 signaling pathway’.

RT-qPCR

Expression levels of 8 genes changed over time: Loc100535288, Loc100534731, Zgc136383, vitellogenin (Vtg) 6, Loc100330641, Vtg-like eukaryotic translation initiation factor 4E binding protein 31 (Eif4ebp31), Zgc123120 and Cap 3. Because Loc100535288 and Loc100534731 were uncharacterized geneswithout any functional information, the other six genes were selected to verify the results of microarray (Fig. 6). Microarray showed that Zgc136383, Vtg6, Loc100330641, Eif4ebp31 were downregulated and Zgc123120 and Cap 3 were upregulated. RT-qPCR showed that Zgc136383, Vtg 6, Loc100330641, Eif4ebp31 were downregulated and Zgc123120 and Cap 3 were upregulated. Meanwhile, the fold-change was also similar. The results of RT-qPCR and microarray were consistent.

Discussion

Binaprofen is not currently commercially available. Our previous study evaluated the effect of different doses of binaprofen and APAP on liver injury; both induced liver injury to a similar extent (21). The half-maximal lethal concentration (LC50) of binaprofen was 1.2 mM, which was 2 times higher than its maximum recommend dose (19); LC50 of APAP was 5.2 mM, which was 1.6 times higher than its people maximum recommend dose (31). Therefore, binaprofen was selected for investigation of the underlying mechanism of toxicity. APAP was used as a positive control because of its known ability to induce liver injury (32).

The present study investigated the mechanism of binaprofen-induced liver injury in zebrafish. Binaprofen increased levels of liver biomarkers ALT, AST and LDH in a time-dependent manner, increased MDA and decreased GSH content. Binaprofen induced hepatocyte vacuolization, as well as mitochondrial swelling, vacuolization and rupture or disappearance of cristae. Binaprofen induced hepatocyte apoptosis. Binaprofen induced altered gene expression at 12, 24 and 48 h. There were 190 common differentially expressed genes at all three timepoints. The function of downregulated genes were primarily associated with ‘DNA replication’, ‘DNA metabolic process’, ‘cell cycle’, ‘cell redox homeostasis’, ‘mitochondrion’ and ‘lipid transport’. The function of upregulated genes was primarily associated with ‘peroxisome proliferator’, ‘oxidation activity’, ‘peroxisome’ and ‘apoptosis’. GO pathways were associated with ‘cell cycle’, ‘DNA replication’, ‘ribosome’, ‘spliceosome’, ‘pyrimidine metabolism’, ‘purine metabolism’, ‘PPAR signaling pathway’ and ‘p53 signaling pathway’. Six genes from microarray were verified, and the results of RT-qPCR were in accordance with microarray results.

Therefore, the experimental results showed that the mechanism of hepatotoxicity was associated with lipid peroxidation and apoptosis.

DILI is associated with inappropriate activation of apoptotic cell death pathways (33–36). Apoptosis serves a key role in progression of liver disease, such as cirrhosis (37,38). Apoptosis is mediated by two central pathways, the intrinsic and extrinsic pathway. The mitochondrial pathway is the intrinsic pathway and begins with permeabilization of the mitochondrial outer membrane (39–42). Release of cytochrome c from mitochondria is key factor to initiate apoptosis (43,44). The released cytochrome c activates caspase-9; this leads to caspase-3 activation, cellular protein cleavage and apoptosis (45). Following binaprofen exposure, there was swelling in mitochondria and increase in DAPI-positive cells with condensed and fragmented nuclei. According to reports (46), DAPI stains apoptotic cells with high labeling efficiency (~100%) and does not change the ultrastructure of organelles. The present study aimed to determine the toxicity of binaprofen, therefore, DAPI was used to detect hepatocyte apoptosis. The results suggested apoptosis occurred; this was confirmed by altered expression of genes associated with apoptosis in the microarray. Moreover, electron microscopy showed liver cell mitochondrial swelling and vacuolization, which indicated that apoptosis was associated with mitochondria. In addition, there was a significant increase in Bcl2 family and caspase gene expression in microarray; this was validated by RT-qPCR. These data suggested that binaprofen induces zebrafish liver injury via the mitochondria-mediated apoptosis pathway.

In the present study, DAPI staining of apoptotic cells was not quantified. TUNEL staining and western blotting were not performed to confirm levels of apoptosis markers; these experiments should be performed in future to quantify apoptosis. Here, it is also found that the signaling pathway of binaprofen-induced liver injury may be associated with PPAR signaling pathway and P53 signaling pathway, we will do further study to clear them.

The mechanism of binaprofen-induced liver injury was associated with lipid peroxidation and apoptosis. Binaprofen induced hepatocyte mitochondrial structural damage and activated apoptosis via the mitochondrial signaling pathway.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Foundation of Ministry of Science and Technology of People's Republic of China (grant nos. 2018ZX09721004 and 201604046020), High-Level Leading Talent Introduction Program of Guangdong Academic of Sciences and People's Republic of China (grant no. 2016GDASRC-0104).

Availability of data and materials

The datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus database of National Center for Biotechnology Information repository, ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE199758 (accession no. GSE199758).

Authors' contributions

QG designed and performed experiments. GC performed experiments. HO and QN analyzed the data. RJ conceived the study. RQ and RJ interpreted the data. All authors have read and approved the final manuscript. QG and GC confirm the authenticity of all the raw data.

Ethics approval and consent to participate

The present study was approved by the Institutional Animal Care and Use Committee of Guangzhou General Pharmaceutical Research Institute (approval no. 2012-005) and performed in accordance with international guidelines for the care and use of laboratory animals. All zebrafish experiments in this study were performed from 1st of July to 30th of August 2012.

Patient consent for participation

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Jee A, Sernoskie SC and Uetrecht J: Idiosyncratic Drug-induced liver injury: Mechanistic and clinical challenges. Int J Mol Sci. 22:29542021. View Article : Google Scholar : PubMed/NCBI

2 

Villanueva-Paz M, Morán L, López-Alcántara N, Freixo C, Andrade RJ, Lucena MI and Cubero FJ: Oxidative stress in drug-induced liver injury (DILI): From mechanisms to biomarkers for use in clinical practice. Antioxidants (Basel). 10:3902021. View Article : Google Scholar : PubMed/NCBI

3 

Jing J and Teschke R: Traditional chinese medicine and herb-induced liver injury: Comparison with drug-induced liver injury. J Clin Transl Hepatol. 6:57–68. 2018. View Article : Google Scholar : PubMed/NCBI

4 

Teschke R: Idiosyncratic DILI: Analysis of 46,266 cases assessed for causality by RUCAM and published from 2014 to early 2019. Front Pharmacol. 10:7302019. View Article : Google Scholar : PubMed/NCBI

5 

Subramanya SB, Venkataraman B, Meeran MFN, Goyal SN, Patil CR and Ojha S: Therapeutic potential of plants and plant derived phytochemicals against acetaminophen-induced liver injury. Int J Mol Sci. 19:37762018. View Article : Google Scholar : PubMed/NCBI

6 

Kanabar DJ: A clinical and safety review of paracetamol and ibuprofen in children. Inflammopharmacology. 25:1–9. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Donati M, Conforti A, Lenti MC, Capuano A, Bortolami O, Motola D, Moretti U, Vannacci A, Rafaniello C, Vaccheri A, et al: Risk of acute and serious liver injury associated to nimesulide and other NSAIDs: Data from drug-induced liver injury case-control study in Italy. Br J Clin Pharmacol. 82:238–248. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Zhong H, Yuan-Keng H, Yuan-Keng X, Hui-Yu O and Wei Y: Effect of felbinac trometamol injection on analgesia and its active site. Central South Pharm. 7:481–484. 2013.(In Chinese).

9 

Kaplowitz N: Idiosyncratic drug hepatotoxicity. Nat Rev Drug Discov. 4:489–499. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Björnsson ES: Drug-induced liver injury due to antibiotics. Scand J Gastroenterol. 52:617–623. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Katarey D amd Verma S, . Drug-induced liver injury. Clin Med (Lond). 16 (Suppl 6):s104–s109. 2016.PubMed/NCBI

12 

Leise MD, Poterucha JJ and Talwalkar JA: Drug-induced liver injury. Mayo Clin Proc. 89:95–106. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Chalasani N, Bonkovsky HL, Fontana R, Lee W, Stolz A, Talwalkar J, Reddy KR, Watkins PB, Navarro V, Barnhart H, et al: Features and outcomes of 899 patients with drug-induced liver injury: The DILIN prospective study. Gastroenterology. 148:1340–1352.e7. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Bernal W and Wendon J: Acute liver failure. N Engl J Med. 369:2525–2534. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Lee WM: Acute liver failure in the United States. Semin Liver Dis. 23:217–226. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Wang W, Ou HY, Xiao BQ, Huang YJ, Yang W and Wang QS: The study of abirritation of a first type of new drug, felbinac trometamol injection. Chin J Med Guide. 11:1327–1332. 2009.

17 

Wang W, Ou H and Liang H: Preliminary pharmacodynamics and safety studies of a first type of new drug, felbinac trometamol injection. Chin J Ethnomedicine Ethnopharmacy. 12:3–4. 2009.(In Chinese).

18 

Zhang C, Cui X, Yang Y, Gao F, Sun Y, Gu J, Fawcett JP, Yang W and Wang W: Pharmacokinetics of felbinac after intravenous administration of felbinac trometamol in rats. Xenobiotica. 41:340–348. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Xiao BQ, Lei XL, Yang W, Huang YK, Ou HY and Lian XK: afety pharmacology research of class I new drug: felbinac trometamol injection. Chin J New Drug. 20:1386–1391. 2011.(In Chinese).

20 

Han Z, Ou HY, Sun H, Feng MJ, Xiao BQ and Yang W: Experiment for security evaluation of class I new drug of felbinac trometamol injection. Pharm Today. 23:201–204, (In Chinese).

21 

Guo Q, Guo J, Chen G, Han Z, Xiao B, Jin R, Liang C and Yang W: Biomarkers associated with binaprofen-induced liver injury. Mol Med Rep. 18:5076–5086. 2018.PubMed/NCBI

22 

Herndon CM and Dankenbring DM: Patient perception and knowledge of acetaminophen in a large family medicine service. J Pain Palliat Care Pharmacother. 28:109–116. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Altyar A, Kordi L and Skrepnek G: Clinical and economic characteristics of emergency department visits due to acetaminophen toxicity in the USA. BMJ Open. 5:e0073682015. View Article : Google Scholar : PubMed/NCBI

24 

Mcgill MR and Jaeschke H: Metabolism and disposition of acetaminophen: Recent advances in relation to hepatotoxicity and diagnosis. Pharm Res. 30:2174–2187. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Hinson JA, Roberts DW and James LP: Mechanisms of acetaminophen-induced liver necrosis. Handb Exp Pharmacol. 196:369–405. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Cima G: AVMA guidelines for the euthanasia of animal: 2013 Edition. Am Vet Med Assoc. 242:715–716. 2013.

27 

Thurman CE, Rasmussen S and Prestia KA: Effect of 3 euthanasia methods on serum yield and serum cortisol concentration in zebrafish (Danio rerio). J Am Assoc Lab Anim Sci. 58:823–828. 2019. View Article : Google Scholar : PubMed/NCBI

28 

Köhler A, Collymore C, Finger-Baier K, Geisler R, Kaufmann L, Pounder KC, Schulte-Merker S, Valentim A, Varga ZM, Weiss J and Strähle U: Report of workshop on euthanasia for zebrafish-a matter of welfare and science. Zebrafish. 14:547–551. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Schafer KA, Eighmy J, Fikes JD, Halpern WG, Hukkanen RR, Long GG, Meseck EK, Patrick DJ, Thibodeau MS, Wood CE and Francke S: Use of severity grades to characterize histopathologic changes. Toxicol Pathol. 46:256–265. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Lv S, Wang Y, Xu W and Dong X: Serum exosomal miR-17-5p as a promising biomarker diagnostic biomarker for breast cancer. Clin Lab. 66:2020. View Article : Google Scholar

31 

Fisher ES and Curry SC: Evaluation and treatment of acetaminophen toxicity. Adv Pharmacol. 85:263–272. 2019. View Article : Google Scholar : PubMed/NCBI

32 

Shojaie L, Iorga A and Dara L: Cell death in liver diseases: A review. Int J Mol Sci. 21:96822020. View Article : Google Scholar : PubMed/NCBI

33 

Chao X, Wang H, Jaeschke H and Ding WX: Role and mechanisms of autophagy in acetaminophen-induced liver injury. Liver Int. 38:1363–1374. 2018.Schwabe RF and Luedde T: Apoptosis and necroptosis in the liver: a matter of life and death. Nat Rev Gastroenterol Hepatol. 15:738–752. 2018. View Article : Google Scholar : PubMed/NCBI

34 

Iorga A, Dara L and Kaplowitz N: Drug-induced liver injury: Cascade of events leading to cell death, apoptosis or necrosis. Int J Mol Sci. 18:10182017. View Article : Google Scholar : PubMed/NCBI

35 

Zhao X, Yang L, Chang N, Hou L, Zhou X, Yang L and Li L: Neutrophils undergo switch of apoptosis to NETosis during murine fatty liver injury via S1P receptor 2 signaling. Cell Death Dis. 11:3792020. View Article : Google Scholar : PubMed/NCBI

36 

Ke PY: Diverse Functions of autophagy in liver physiology and liver diseases. Int J Mol Sci. 20:3002019. View Article : Google Scholar : PubMed/NCBI

37 

Ko S, Russell JO, Molina LM and Monga SP: Liver progenitors and adult cell plasticity in hepatic injury and repair: Knowns and unknowns. Annu Rev Pathol. 15:23–50. 2020. View Article : Google Scholar : PubMed/NCBI

38 

Dong W, Luo B, Qiu C, Jiang X, Shen B, Zhang L, Liu W and Zhang W: TRIM3 attenuates apoptosis in Parkinson's disease via activating PI3K/AKT signal pathway. Aging (Albany NY). 13:735–749. 2020. View Article : Google Scholar : PubMed/NCBI

39 

Zhang Q, Liu J, Zhang M, Wei S, Li R, Gao Y, Peng W and Wu C: Apoptosis induction of fibroblast-like synoviocytes is an important molecular-mechanism for herbal medicine along with its active components in treating rheumatoid arthritis. Biomolecules. 9:7952019. View Article : Google Scholar : PubMed/NCBI

40 

Sha L, Ma D and Chen C: Exosome-mediated Hic-5 regulates proliferation and apoptosis of osteosarcoma via Wnt/β-catenin signal pathway. Aging (Albany NY). 12:23598–23608. 2020. View Article : Google Scholar : PubMed/NCBI

41 

Li RL, Zhang Q, Liu J, Sun JY, He LY, Duan HX, Peng W and Wu CJ: Hydroxy-α-sanshool possesses protective potentials on H2O2-stimulated PC12 cells by suppression of oxidative stress-induced apoptosis through regulation of PI3K/Akt signal pathway. Oxid Med Cell Longev. 2020:34817582020.PubMed/NCBI

42 

Li Y, Ding H, Liu L, Song Y, Du X, Feng S, Wang X, Li X, Wang Z, Li X, et al: Non-esterified fatty acid induce dairy cow hepatocytes apoptosis via the mitochondria-mediated ROS-JNK/ERK signaling pathway. Front Cell Dev Biol. 8:2452020. View Article : Google Scholar : PubMed/NCBI

43 

Li W, Li Y, Jiang X, Li X and Yu Z: Compound ammonium glycyrrhizin protects hepatocytes from injury induced by lipopolysaccharide/florfenicol through a mitochondrial pathway. Molecules. 23:23782018. View Article : Google Scholar : PubMed/NCBI

44 

Saito Y, Hikita H, Nozaki Y, Kai Y, Makino Y, Nakabori T, Tanaka S, Yamada R, Shigekawa M, Kodama T, et al: DNase II activated by the mitochondrial apoptotic pathway regulates RIP1-dependent non-apoptotic hepatocyte death via the TLR9/IFN-β signaling pathway. Cell Death Differ. 26:470–486. 2019. View Article : Google Scholar : PubMed/NCBI

45 

Nguyen SM, Lieven CJ and Levin LA: Simultaneous labeling of projecting neurons and apoptotic state. J Neurosci Methods. 161:281–284. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Wallberg F, Tenev T and Meier P: Analysis of apoptosis and necroptosis by fluorescence-activated cell sorting. Cold Spring Harb Protoc. 2016.pdb.prot087387, 2016. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo Q, Chen G, Ou H, Jin R, Ni Q and Qin R: Binaprofen induces zebrafish liver injury via the mitochondrial pathway. Mol Med Rep 26: 314, 2022.
APA
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., & Qin, R. (2022). Binaprofen induces zebrafish liver injury via the mitochondrial pathway. Molecular Medicine Reports, 26, 314. https://doi.org/10.3892/mmr.2022.12830
MLA
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., Qin, R."Binaprofen induces zebrafish liver injury via the mitochondrial pathway". Molecular Medicine Reports 26.4 (2022): 314.
Chicago
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., Qin, R."Binaprofen induces zebrafish liver injury via the mitochondrial pathway". Molecular Medicine Reports 26, no. 4 (2022): 314. https://doi.org/10.3892/mmr.2022.12830
Copy and paste a formatted citation
x
Spandidos Publications style
Guo Q, Chen G, Ou H, Jin R, Ni Q and Qin R: Binaprofen induces zebrafish liver injury via the mitochondrial pathway. Mol Med Rep 26: 314, 2022.
APA
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., & Qin, R. (2022). Binaprofen induces zebrafish liver injury via the mitochondrial pathway. Molecular Medicine Reports, 26, 314. https://doi.org/10.3892/mmr.2022.12830
MLA
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., Qin, R."Binaprofen induces zebrafish liver injury via the mitochondrial pathway". Molecular Medicine Reports 26.4 (2022): 314.
Chicago
Guo, Q., Chen, G., Ou, H., Jin, R., Ni, Q., Qin, R."Binaprofen induces zebrafish liver injury via the mitochondrial pathway". Molecular Medicine Reports 26, no. 4 (2022): 314. https://doi.org/10.3892/mmr.2022.12830
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team