Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2022 Volume 26 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2022 Volume 26 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis

  • Authors:
    • Xiyuan Xu
    • Baoying Bu
    • Hongjun Tian
    • Rina Wu
    • Jingping Yang
  • View Affiliations / Copyright

    Affiliations: Department of Respiratory and Critical Medicine, Third Affiliated Hospital, Inner Mongolia Medical University, Baotou, Inner Mongolia Autonomous Region 014010, P.R. China
    Copyright: © Xu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 334
    |
    Published online on: September 12, 2022
       https://doi.org/10.3892/mmr.2022.12850
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The early diagnosis and treatment of sepsis are of particular importance to patient survival. To obtain novel biomarkers that serve as prompt indicators of sepsis, the current study screened the differentially expressed microRNAs (DEMs) that were associated with sepsis susceptibility. The correlation between the elucidated DEMs and the inflammatory response was also examined. The present study included 40 patients with sepsis and 40 healthy controls. RNA‑sequencing technology and bioinformatics analysis were applied to screen the DEMs between the two cohorts. The expression of these DEMs was subsequently verified by performing reverse transcription‑quantitative PCR (RT‑qPCR). In addition, IL‑6, IL‑21, C‑X‑C motif chemokine ligand‑8 (CXCL8) and monocyte chemoattractant protein‑1 (MCP‑1) levels, along with T‑cell death‑associated gene 8 (TDAG8) and toll‑like receptor 4 (TLR4) mRNA expression levels were assessed. The association between microRNA (miRNA/miR)‑3663‑3p and the secretion of various proinflammatory cytokines or TDAG8 and TLR4 mRNA expressions were subsequently evaluated by linear correlation analysis. The results revealed 305 DEMs (P<0.05; fold change >2) between patients with sepsis and healthy controls. Among these, the top 18 up‑ and downregulated miRNAs were selected for RT‑qPCR verification. In addition, the serum content of IL‑6, IL‑21, CXCL8 and MCP‑1, and the expression of TDAG8 and TLR4 mRNAs were significantly increased in patients with sepsis compared with healthy controls. Moreover, in patients with sepsis, a positive correlation was identified between miR‑3663‑3p and the secretion of inflammatory cytokines or TDAG8 and TLR4 mRNA expression. A positive correlation was also elucidated between TDAG8 and TLR4 mRNA expression and proinflammatory cytokine/chemokine secretion. Receiver operating characteristic curve analysis of miR‑3663‑3p expression, IL‑6, IL‑21, CXCL8 and MCP‑1 secretion and TDAG8 and TLR4 mRNA expression demonstrated that miRNA analysis may be invaluable for the diagnosis of sepsis. Collectively, the results determined that miR‑3663‑3p may be a potentially powerful diagnostic and predictive biomarker of sepsis and that the combined and simultaneous detection of several biomarkers, including proteins, miRNAs and mRNA may be a reliable approach for the fast diagnosis and early identification of sepsis.

Introduction

Severe sepsis is one of the most prevalent diseases in patients admitted to the intensive care unit of hospitals (1). It is a main cause of death in critically ill patients and affects millions of individuals around the world each year, with 11 million sepsis deaths and 48.9 million cases of sepsis reported in 2017 (2). Despite an overwhelming increase in knowledge regarding the pathogenesis of sepsis and subsequent advances in clinical care, the incidence of sepsis is still increasing in both adults and children, accounting for an unacceptably high mortality rate ranging between 25–30% depending on age and disease severity (3). It is often characterized by a systemic inflammatory response to infection that is typically bacterial in origin (4). Moreover, sepsis is defined as a documented or suspected infection in a subset of four findings (body temperature >38°C or <36°C; heart rate >90 beats/min; hyperventilation evidenced by breathing rate of >20 breaths/min or PaCO2 <32 mmHg; white blood cell count >12,000 cells/µl or <4,000/µl) that describe systemic inflammatory response syndrome (4,5). Sepsis can progress rapidly, resulting in organ failure (severe sepsis) or impaired tissue perfusion (septic shock) (6). Although a number of biomarkers, such as procalcitonin and C-reactive protein, have been proposed as candidate markers for the diagnosis, prognosis and therapeutic guidance of sepsis, each have certain limitations; for example, low specificity for early diagnosis, and the lack of definitive evaluation parameters for the severity of sepsis and the prognosis of patients, which make it difficult to diagnose sepsis with high sensitivity and specificity (7). Therefore, new biomarkers with high sensitivity and specificity are urgently required.

MicroRNAs (miRNAs/miRs) are a class of small noncoding RNAs that pair to sites in mRNAs to regulate gene expression in eukaryotes (8). To date, ~1,000 miRNAs have been identified in humans, which may directly regulate at least 30% of the genes in a cell, therefore serving important roles in a variety of cellular functions as well as in several diseases (9,10). Thus, miRNAs are involved in the regulation of almost all major cellular functions, including cell development, differentiation, proliferation and apoptosis (11). The abnormal expression of miRNAs may implicate changes in a wide array of cellular and developmental processes of disease initiation and progression that can lead to malignant phenotypes (12–14). This means that in various pathological conditions, such as inflammation, infection and sepsis, miRNA levels may change, which is a parameter that can be quickly detected (15). Thus, miRNAs isolated from the peripheral blood of patients with sepsis may be measured by performing genome-wide profiling microarrays in leukocytes in order to elucidate potential biomarkers of sepsis. Interestingly, serum miR-16 and miR-483-5p have been identified as prognostic predictors of patients with sepsis, as they are associated with sepsis-induced death (16).

To identify putative miRNA biomarkers involved in the process of sepsis, the current study analyzed the differentially expressed microRNAs (DEMs) via microarray analysis followed by verification via reverse transcription-quantitative PCR (RT-qPCR) and bioinformatics. Additionally, the correlations between the identified miRNAs and proinflammatory cytokines and chemokines were evaluated. The results of the present study may further clarify the roles of miRNAs in the diagnosis and treatment of sepsis, so as to elucidate a novel miRNA biomarker.

Materials and methods

Patients

A total of 40 patients (21 male patients and 19 female patients; age range, 20–80 years; mean age, 66.5±5.8 years) admitted to the Department of Respiratory and Critical Care Medicine of the Third Affiliated Hospital of Inner Mongolia Medical University (Baotou, China) between January 1st 2015 and October 31st 2015 were enrolled in the current study. The inclusion criteria were as follows: Patients with sepsis were diagnosed based on the Sepsis 3.0 guidelines, which can be simplified as follows: Sepsis = infection + sequential organ failure assessment (SOFA) ≥2 (17). The exclusion criteria were as follows: i) Patients <18 or >80 years of age; ii) patients with liver and kidney failure; iii) patients that were pregnant or lactating; iv) patients with tumors and hematological diseases; v) an agranulocytosis score of <0.5×109/l; vi) patients with human immunodeficiency virus-related complications; and vii) patients administered glucocorticoids up to 4 weeks before enrollment or that were receiving immunotherapy after organ transplantation. A total of 40 healthy individuals that donated samples following routine physical examinations were used as a control group (20 males, 20 females; aged 20–80 years). A further 80 samples (including 40 samples from patients with sepsis and 40 samples from healthy controls, whose details are listed in Table I) were obtained from individuals admitted to the same hospital that were enrolled to the present study between April 10th 2020 and January 31st 2021. The inclusion criteria were the same as aforementioned. There was no significant difference in the mean values of sex and age between the test group and the control group. All protocols were approved by the Local Ethics Committee of the Third Affiliated Hospital of Inner Mongolia Medical University (Baotou, China), and written informed consent was obtained from all subjects who were permitted to withdraw from clinical observation at any time for any reason.

Table I.

Clinical characteristics of patients with sepsis and healthy controls (n=80).

Table I.

Clinical characteristics of patients with sepsis and healthy controls (n=80).

A, Original samples

CharacteristicSepsisNormal controlP-value
Age (mean ± SD)66.5±5.867.2±4.20.12
Male (n)21200.80
Female (n)19200.74

B, Expanded samples

CharacteristicSepsisNormal controlP-value

Age (mean ± SD)63.1±1.861.5±9.40.17
Male (n)18210.56
Female (n)22190.43
Total RNA extraction from blood and quality control

To compare the DEMs in patients with sepsis and healthy controls, 2 ml whole blood samples were collected into sterilized Eppendorf tubes. Total RNA was extracted using the mirVana miRNA Isolation kit (Ambion; Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's protocol. Subsequently, the concentration and integrity of total RNA was determined using a spectrophotometer (NanoDrop™; Thermo Fisher Scientific, Inc.) and agarose gel electrophoresis. The conditions required for microarray analysis included: An average A260/280 ratio of total RNA ≥1.8, RNA content ≥1 µg/ml and clear 28S and 18S electrophoresis bands of total RNA (18).

Microarray assay and data analysis

Microarray analysis was performed by Sangon Biotech Co., Ltd. Briefly, total RNA (~200 ng) extracted from the aforementioned blood samples was subjected to dephosphorylation and labeling using the miRNA Complete Labeling and Hyb kit (Agilent Technologies, Inc.), where Cyanine3-pCp was connected to the 3′ end of RNA using T4 RNA ligase. The labeled reaction products were concentrated using a vacuum concentrator for 3 h at 45–55°C and subsequently underwent overnight hybridization using Agilent SureSelect Capture Technology (Agilent Technologies, Inc.). After washing with saline-sodium citrate at room temperature, slides were dried by air and scanned using the Agilent Scanner G2505C (Agilent Technologies, Inc.), after which the Agilent Feature Extraction (v10.7; Agilent technologies, Inc.) was utilized to extract data and analyze the hybridization results. Agilent GeneSpring (version 12.5; Agilent Technologies, Inc.) was used for quartile data normalization and to determine differences between groups. A Q-value of ≥5% and a fold change (FC) value of >2.0 or <0.5 were selected as cut-off points for DEMs. Statistical significance was determined using an unpaired t-test and was represented using a P-value. To reduce the risk of false positives, values were adjusted for multiple testing using the Benjamini-Hochberg False Discovery Rate (FDR) method. The corrected value was represented by FDR (19). FDR <0.05 was selected as the cut-off value for DEM screening. The possible miRNAs that target sepsis were predicted using TargetScan software (http://www.targetscan.org/vert_80/).

Identification of DEMs in the peripheral blood of patients with sepsis via RT-qPCR

According to microarray assay, 305 miRNAs with >2-fold expression changes (patients with sepsis vs. healthy people) were detected. Subsequently, the top 18 up- and downregulated miRNAs were selected for microarray analysis verification via RT-qPCR. The primers used for RT-qPCR were synthesized by Sangon Biotech Co., Ltd. and are listed in Table II. Total RNA was extracted using RNAiso Plus (cat. no. 9108; Takara Bio, Inc.), and reverse transcribed into cDNA using miRNA First Strand cDNA Synthesis (Stem-loop Method) (cat. no. B532453; Sangon Biotech Co., Ltd.) according to the manufacturers' instructions. RT-qPCR was performed using SYBR Premix Ex Taq™ II (Takara Bio, Inc.) with U6 as an internal control for miRNA detection. The thermocycling conditions were as follows: Pre-denaturation at 95°C for 10 min, followed by 40 cycles of denaturing at 95°C for 5 sec, annealing at 60°C for 20 sec and elongation at 70°C for 10 sec. The melt curve conditions were as follows: 60°C to 95°C in increments of 0.3°C; this was used to determine the melting temperature of the detected miRNAs and primer dimers. The relative expression of DEMs was calculated using the comparative 2−ΔΔcq method (20) and the data were analyzed using SPSS v19.0 software (IBM Corp.).

Table II.

All primer sequences used in the current study.

Table II.

All primer sequences used in the current study.

PrimerSequence (5′ to 3′)
hsa-miR-3663-3p TGAGCACCACACAGGCCG
hsa-miR-625-5p AGGGGGAAAGTTCTATAGTCC
hsa-miR-892b CACTGGCTCCTTTCTGGGT
hsa-miR-491-5p AGTGGGGAACCCTTCCATGA
hsa-miR-592 GATTGTGTCAATATGCGATGATGT
hsa-miR-3591-3p AAACACCATTGTCACACTCCAC
hsa-miR-6514-3p CTGCCTGTTCTTCCACTCC
hsa-miR-4694-5p ATCCCGTAUCTCTTCGTCTTCGA
hsa-miR-362-5p AATCCTTGGAACCTAGGTGTGA
hsa-miR-1260b ATCCCACCACTGCCACCAT
hsa-miR-491-3p CTTATGCAAGATTCCCTTCTA
hsa-miR-501-3p GCGGCGGAATGCACCCGGGCAAG
hsa-miR-17-3p GCCGCAAAGTGCTTACAGTG
hsa-miR-6881-3p TCTGGCTTGTATCTAGCGTATGA
hsa-miR-501-5p AATCCTTTGTCCCTGGGTGAGA
hsa-miR-6756-5p TTTTTCCGATTATTGCTCCTGACC
hsa-miR-6752-5p TACTGCCCTGACCTGTCCTGTCC
hsa-miR-6786-5p TAACCGCACTGTCTGGTAAAGAT
Universal reverse GTGCAGGGTCCGAGGT
miRNA primer
Human-TDAG8
  Forward TTCCTGGGCTACGCAATACC
  Reverse CCGTAGCTTGGTTGTGCTTC
Human TLR4
  Forward TTCCTGGGCTACGCAATACC
  Reverse CCGTAGCTTGGTTGTGCTTC
GAPDH
  Forward CAGGAGGCATTGCTGATGAT
  Reverse GAAGGCTGGGGCTCATTT
U6
  Forward GCTTCGGCAGCACATATACTAAAAT
  Reverse CGCTTCACGAATTTGCGTGTCAT

[i] hsa, Homo sapiens; miR, microRNA; TDAG8, T-cell death-associated gene 8; TLR4, toll-like receptor 4.

RT-qPCR determination of T-cell death-associated gene 8 (TDAG8) and toll-like receptor 4 (TLR4) mRNA expression

It has been reported that TDAG8 is involved in the maintenance of lysosomal function, particularly during pathogen defense (21). In addition, TLR4 can be activated by lipopolysaccharide (LPS) to induce the production of proinflammatory mediators to eradicate bacteria or other pathogens (22). Dysregulation of the host response to LPS can lead to sepsis, which is a systemic inflammatory condition (23). The current study therefore detected the expression levels of TDAG8 and TLR4 mRNA in the peripheral blood of patients with sepsis. Total RNA was extracted using RNAiso Plus, and reverse transcribed into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (cat. no. R047A; Takara Bio, Inc.) according to the manufacturer instructions. The primers used for this reaction are listed in Table II. Amplification was performed using the SYBR Premix Ex Taq™ II under the following thermocycling conditions: Initial denaturation at 95°C for 30 sec; followed by 50 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec. The expression of TDAG8 and TLR4 mRNA was calculated using the 2−ΔΔCq method and GAPDH was used as an internal control.

TargetScan software assay

The current results revealed that the expression levels of miR-3663-3p and miR-6881-3p in patients with sepsis were significantly increased compared with healthy controls. In addition, our pre-experiment determined that TDAG8 was closely related to the regulation of the inflammatory response in patients with sepsis. That is, in the sepsis group, the correlation coefficients (r) of TDAG8 mRNA expression and IL-6 or CXCL8 concentration were 0.8455 or 0.7117, respectively, indicating that TDAG8 mRNA expression was positively correlated with IL-6 and CXCL8 levels. In the present study, TargetScan software (www.targetscan.org/vert_72/; TargetScanHuman 7.2) was applied to predict whether TDAG8 was the biological target of miR-3663 and miR-6881. After selecting ‘human’ as the species, the human gene TDAG8 (GPR65) was entered. The database was subsequently searched for miR-3663-3p and miR-6881-3p.

ELISA

Sepsis often leads to multiple organ failure as a result of an uncontrolled inflammatory response (24). In the present study, ELISA was performed to detect the concentrations of various proinflammatory cytokines, including IL-6 (cat. no. CSB-E04638h; Cusabio Technology LLC), IL-21 (cat. no. CSB-E11707h; Cusabio Technology LLC), C-X-C motif chemokine ligand-8 (CXCL8) (cat. no. CSB-E04641h; Cusabio Technology LLC) and monocyte chemoattractant protein-1 (MCP-1) (cat. no. CSB-E04655h; Cusabio Technology LLC) in the peripheral blood of patients with sepsis. All procedures were performed in accordance with the respective protocols of commercially available ELISA kits (R&D Systems, Inc.). Each sample was measured three times and an average value was calculated.

Statistical analysis

Data were obtained from three independent experiments and were expressed as the mean ± SD. All statistical analyses were performed using SPSS v19.0 software. The statistical differences between two groups were detected using unpaired Student's t-test. The correlation between inflammatory response and miRNA-3663-3p or TDAG8/TLR4 mRNA expression was determined using Pearson's correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Comparison of clinical characteristics between patients with sepsis and healthy controls

There were 21 males and 19 females in the sepsis group, aged between 20–80 years, with a mean age of 66.5±5.8 years. A total of 40 healthy individuals that donated samples following routine physical examinations were selected as the control group (20 males; 20 females; age range, 20–80 years; mean age, 67.2±4.2 years). There were no significant differences between the mean values of sex and age between the sepsis and healthy control groups (Table I).

Total RNA extracted from peripheral blood demonstrates good integrity

The integrity of total RNA was assessed using agarose gel electrophoresis and subsequent 18S and 28S RNA band staining for visualization. As presented in Fig. 1, the electrophoretic bands of 28S and 18S RNA were clear. In addition, the ratio of A260 to A280 in the extracted RNA was 1.8-2.0. Therefore, total RNA samples with high purity and good integrity were used for microarray analysis.

Figure 1.

Denaturing agarose gel electrophoresis of total RNA extracted from the peripheral blood of patients with sepsis and healthy controls. N, normal healthy controls; S, sepsis.

Scatter plot maps and DEM hierarchical clustering

To clarify the potential function of DEMs, microarray analysis was performed by Sangon Biotech Co., Ltd. Agilent GeneSpring was used for the analysis of DEM expression between patients with sepsis and healthy controls in order to identify characteristic DEMs. The significance of microarray analysis was denoted by FDR (FDR <0.05). As presented in Fig. 2A, the results revealed 305 miRNAs that demonstrated a >2-fold change in expression in patients with sepsis compared with in healthy individuals, including 212 upregulated and 93 downregulated DEMs. Among these, the top 18 up- or downregulated miRNAs, which exhibited significant differential expression (P<0.05; FC >2.0), were selected for further analysis. A total of 9 miRNAs demonstrated an increased expression, while 9 miRNAs exhibited a decreased expression (Table III). Hierarchical clustering of the top 18 DEMs was subsequently performed, the results of which are presented in Fig. 2B.

Figure 2.

Detection of DEMs between patients with sepsis and healthy controls. (A) Scatter plot of microarray analysis presents the gene expression levels in patients with sepsis compared with healthy controls. The x-axis demonstrates the fluorescence intensity of healthy controls, whereas the y-axis demonstrates the fluorescence intensity of patients with sepsis. Red and green dots indicate the up-(ratio >2) and downregulated DEMs (ratio <0.5), respectively (false discovery rate <0.05). Black coloration indicates the DEMs that demonstrated no difference between the two groups (0.5 < ratio <2). (B) Hierarchical clustering of DEMs in the peripheral blood of patients with sepsis. Red represents high expression while green represents low expression. (C) Reverse transcription-quantitative PCR validation of DEMs in the peripheral blood of patients with sepsis. *P<0.05 and **P<0.01 vs. the healthy control group. DEMs, differentially expressed microRNAs; N, normal healthy controls (n=80); S, patients with sepsis (n=80); miR, microRNA; hsa, Homo sapiens.

Table III.

Differentially expressed microRNAs obtained from microarray analysis.

Table III.

Differentially expressed microRNAs obtained from microarray analysis.

Systematic nameP-value (Corr)P-valueFC (abs)Expression
hsa-miR-3663-3p0.0004721.32098716.258206Upregulated
hsa-miR-4694-5p0.3724100.0205569.608086Upregulated
hsa-miR-6881-3p0.0868000.00166922.589320Upregulated
hsa-miR-5920.4524310.0500309.550354Upregulated
hsa-miR-491-5p0.3535730.0080579.395253Upregulated
hsa-miR-1260b0.3724100.0229815.556636Upregulated
hsa-miR-625-5p0.2389660.00075610.871430Downregulated
hsa-miR-892b0.4524310.0554295.355109Downregulated
hsa-miR-362-5p0.4908200.0996533.538647Downregulated
hsa-miR-6786-5p0.5196190.1151052.160317Downregulated
hsa-miR-3591-3p0.3545310.01500712.917550Upregulated
hsa-miR-6514-3p0.3724140.02592710.691710Upregulated
hsa-miR-491-3p0.4021060.0316328.345849Upregulated
hsa-miR-17-3p0.3216350.0156704.457891Downregulated
hsa-miR-501-3p0.2176340.0242452.678529Downregulated
hsa-miR-6756-5p0.0324560.0075643.678321Downregulated
hsa-miR-501-5p0.2134890.0123596.765479Downregulated
hsa-miR-6752-5p0.3167840.0456797.120635Downregulated

[i] miR, microRNA; hsa, Homo sapiens; FC (abs), fold change (absolute); (Corr), corrected.

DEM expression from RNA-sequencing data is validated by RT-qPCR

To validate microarray analysis data, DEM expression levels were detected by RT-qPCR. As presented in Fig. 2C, the results of RT-qPCR were almost consistent with those obtained through microarray analysis. Similar trends in the following miRNAs were detected: miR-625-5p, miR-6786-5p, miR-17-3p, miR-501-3p, miR-6756-5p, miR-501-5p, miR-6786-5p, miR-3663-3p, miR-4694-5p, miR-6881-3p, miR-592, miR-491-5p, miR-1260b, miR-3591-3p, miR-6514-3p and miR-491-3p. However, the expression levels of miR-892b and miR-362-5p differed to that of microarray analysis; therefore, a larger sample size for RT-qPCR analysis is required to validate these results. Integrated analysis of miRNA and mRNA expression profiles indicated that among the highly expressed miRNAs, the expression levels of miR-3663-3p, miR-6881-3p, miR-625-5p, miR-3591-3p and miR-6514-3p were significantly different compared with the control group [FC (abs) >10]. Notably, the expression levels of miR-3663-3p were significantly increased in the peripheral blood of patients with sepsis according to RT-qPCR. TargetScan software was used to evaluate the putative target genes of miR-3663-3p. The results revealed that TDAG8 was predicated to be a potential target gene of miR-3663-3p (data not shown), as evolutionary conservation was demonstrated. As the TLR4 signaling pathway has been reported to serve a role in sepsis (25,26) and TDAG8 has been reported to be involved in regulation of cell functions associated with airway inflammation (27), TDAG8 and TLR4 were selected for further experimentation.

Sepsis upregulates the expression of TDAG8 and TLR4 mRNA

To further clarify whether TDAG8 and TLR4 are involved in the occurrence and development of sepsis, the mRNA expression levels of TDAG8 and TLR4 were determined in human blood samples via RT-qPCR. As presented in Fig. 3, significant differences were demonstrated in both TDAG8 and TLR4 mRNA levels between healthy controls and patients with sepsis. More specifically, the expression levels of serum TDAG8 (1.0±0.02 vs. 2.7±0.13) and TLR4 (1.0±0.08 vs. 1.5±0.10) mRNA in patients with sepsis were significantly higher compared with healthy controls. The results indicated that TDAG8 and TLR4 mRNA expression is upregulated in patients with sepsis.

Figure 3.

Expression levels of TLR4 and TDAG8. Reverse transcription-quantitative PCR determination of (A) TLR4 and (B) TDAG8 mRNA expression in the serum of patients with sepsis and healthy controls. **P<0.01 and ***P<0.001 vs. healthy controls. TLR4, toll-like receptor 4; TDAG8, T-cell death-associated gene 8; NC, normal healthy controls.

Serum IL-6, IL-21, CXCL8 and MCP-1 content in patients with sepsis

Given the consideration that high expression levels of TLR4 can result in the production of chemokines and proinflammatory cytokines (28), serum IL-6, IL-21, CXCL8 and MCP-1 levels were determined in the current study by performing ELISA. As presented in Fig. 4, serum IL-6, IL-21, CXCL8 and MCP-1 levels in the healthy control group were 2.12±0.18, 48.50±7.9, 0.15±0.04 and 8.25±1.45 ng/l, while levels in patients with sepsis were 6.24±0.92, 137.0±29.20, 0.28±0.05 and 30.40±5.30 ng/l, respectively. The results demonstrated that proinflammatory cytokines IL-6 and IL-21 and CXCL8 and MCP-1 chemokines were significantly increased in patients with sepsis (t=6.89, 6.07, 11.8 and 9.03, respectively), suggesting an increased inflammatory response.

Figure 4.

Levels of serum cytokines/chemokines. ELISA determination of serum (A) IL-6, (B) IL-21, (C) CXCL8 and (D) MCP-1 content in patients with sepsis and healthy controls. **P<0.01 and ***P<0.001 vs. healthy controls. CXCL8, C-X-C motif chemokine ligand-8; MCP-1, monocyte chemoattractant protein-1; NC, normal healthy controls.

Correlation between the inflammatory response and miR-3663-3p or TDAG8/TLR4 mRNA expression

To clarify the relationship between miR-3663-3p and the secretion of proinflammatory cytokines, linear correlation analysis was performed. The results revealed that, in patients with sepsis, the correlation coefficients (r) of miR-3663-3p expression and IL-6, IL-21, CXCL8 and MCP-1 levels were 0.8352, 0.8976, 0.6633 and 0.7661, respectively. Furthermore, the correlation coefficients (r) of the same miRNA with TDAG8 and TLR4 mRNA expression levels were 0.7895 and 0.8622, respectively (Fig. 5A). The results indicated a positive correlation between miRNA-3663-3p and the inflammatory response. As the secretion of inflammatory factors is closely associated with the activation of TLR4 (29), correlation analysis was performed between the expression levels of TDAG8/TLR4 mRNA and the production of IL-6, IL-21, CXCL8 and MCP-1. As presented in Fig. 5B and C, the correlation coefficients (r) of TDAG8 mRNA with the contents of IL-6, IL-21, CXCL8 and MCP-1 were 0.856, 0.914, 0.515 and 0.902, respectively. Additionally, the correlation coefficients (r) of TLR4 mRNA with the contents of IL-6, CXCL8, IL-21 and MCP-1 were 0.940, 0.946, 0.715 and 0.890, respectively. The data indicated a positive correlation between TDAG8/TLR4 mRNA expression and proinflammatory cytokine/chemokine secretion. TDAG8 mRNA expression also revealed a positive correlation with TLR4 mRNA expression, with a correlation coefficient value (r) of 0.878).

Figure 5.

Relationship between miR-3663-3p expression and inflammation in sepsis. Correlation analysis of (A) miR-3663-3p expression with the serum levels of IL-6, IL-21, CXCL8 and MCP-1 and TDAG8 and TLR4 mRNA. Correlation analysis of (B) TLR4 and (C) TDGA8 mRNA expression with the serum contents of IL-6, IL-21, CXCL8 and MCP-1. (D) ROC curve analysis of miR-3663-3p expression, total serum IL-6, IL-21, CXCL8 and MCP-1 concentration and TDAG8 and TLR4 mRNA expression in patients with sepsis. (E) Expression levels of miR-3663-3p in human peripheral blood samples detected by reverse transcription-quantitative PCR. **P<0.01 vs. healthy controls. miR, microRNA; CXCL8, C-X-C motif chemokine ligand-8; MCP-1, monocyte chemoattractant protein-1; TDAG8, T-cell death-associated gene 8; TLR4, toll-like receptor 4; ROC, receiver operating characteristic; NC, normal control.

Significance of miRNA analysis in the diagnosis of sepsis

In the current study, miR-3663-3p and the expression of various cytokines/chemokines (IL-6, IL-21, CXCL8 and MCP-1) were selected for sensitivity and specificity analysis using a receiver operating characteristic (ROC) curve. ROC curves revealed that miR-3663-3p, IL-6, IL-21, CXCL8 and MCP-1 levels, along with TDAG8 and TLR4 mRNA had area under the curve values of 0.908, 0.912, 0.959, 0.944, 0.996, 0.952 and 0.815, respectively, when distinguishing patients with sepsis from healthy controls (Fig. 5D). When selecting a cut-off value of 0.02 for miR-3663-3p, as determined via ROC curve analysis, the diagnostic sensitivity and specificity were determined to be 100%. The cut-off points, diagnostic sensitivities and diagnostic specificities of IL-6, IL-21, CXCL8 and MCP-1 are listed in Table IV. The area under the ROC curve of IL-6, IL-21, CXCL8 and MCP-1 were >0.9, indicating that they may be used to provide an earlier warning of sepsis when combined with miR-3663-3p. To validate these findings, an additional 80 samples (40 samples for healthy controls and 40 samples for patients with sepsis) were obtained for RT-qRCR analysis. The results revealed that the expression levels of miR-3663-3p were significantly increased in patients with sepsis compared with healthy controls (P<0.01; Fig. 5E). The data indicated that miR-3663-3p could serve as a potentially powerful diagnostic and predictive biomarker for sepsis, and that miRNA analysis combined with the measurement of inflammatory cytokine secretion may be a reliable approach for the fast diagnosis and early identification of sepsis.

Table IV.

Diagnostic value of miR-3663-3p, IL-6, IL-21, CXCL8 and MCP-1 in patients with sepsis.

Table IV.

Diagnostic value of miR-3663-3p, IL-6, IL-21, CXCL8 and MCP-1 in patients with sepsis.

ParameterAUCCut-off valueSensitivity (%)Specificity (%)
miR-3663-3p0.9080.02100.0100.0
IL-60.9122.8467.791.7
IL-210.95957.4879.2100.0
CXCL80.94414.28100.095.8
MCP-10.99614.2897.5100.0
TDAG8 mRNA0.95291.29100.080.0
TLR4 mRNA0.815999.0067.5100.0

[i] miR, microRNA; CXCL8, C-X-C motif chemokine ligand-8; MCP-1, monocyte chemoattractant protein-1; TDAG8, T-cell death-associated gene 8; TLR4, toll-like receptor 4; AUC, area under the curve. P<0.001 for all analyses.

Discussion

The understanding of sepsis and its pathobiology has improved in recent years, which may improve the definition of sepsis (17). Severe stage blood-infection is characterized as sepsis, which may result in tissue damage, organ failure and death (6). Therefore, the fast diagnosis and early identification of sepsis (including sepsis, severe sepsis or septic shock) is crucial for the patient's survival and may be beneficial when applying the most appropriate treatment protocol. The regulatory roles of miRNAs make them suitable disease biomarkers, indicating that they may contribute to the improved prediction of survival in patients with sepsis (9,10,30).

Previous studies have demonstrated the association between the expression levels of miRNAs and the mortality of patients with sepsis (16,31,32). Furthermore, the altered levels of a miRNA may serve as a potentially powerful diagnostic and predictive biomarker of sepsis (33). The present study investigated the expression of various miRNAs in the context of sepsis. Considering the rapidity and accessibility of sampling miRNAs in liquid biopsies, total RNA was extracted from the peripheral blood of 40 patients with sepsis and 40 healthy controls to identify novel blood-specific biomarkers of sepsis. A total of 305 DEMs were identified in patients with sepsis, including 212 upregulated and 93 downregulated DEMs. Among these, the top 18 up- and downregulated miRNAs were selected and validated via RT-qPCR.

TLR4 plays a key role in the innate immune system and regulates the secretion of various proinflammatory cytokines, including TNF-α and IL-6 (29). The results of the present study confirmed that a significantly increased expression of TLR4 was detected in patients with sepsis. Once the TLR4 receptor is activated, its downstream signaling pathways, including NF-κB, MAPK and STAT, are subsequently activated. Following TLR4-NF-κB/MAPK/STAT signaling pathway activation, the abnormal secretion of certain proinflammatory cytokines, such as IL-6, CXCL8 and MCP-1, is observed (34–36). In the current study, serum IL-6, IL-21, CXCL8 and MCP-1 levels in patients with sepsis were significantly increased compared with healthy controls. TDAG8, which regulates macrophage extracellular acidification-induced inflammatory cytokine production, is a receptor with a pronounced immune cell-specific (macrophages, T cells and microglia) expression profile (37,38). In the present study, the highly upregulated expression of TLR4 and TDAG8 mRNA was detected in the peripheral blood of patients with sepsis, suggesting that TDAG8 and TLR4 expression was closely associated with the occurrence and development of sepsis. Given that the current results demonstrated an overproduction of certain proinflammatory cytokines and chemokines, including IL-6, IL-21, CXCL8 and MCP-1, accompanied by increased mRNA expressions of TDAG8 and TLR4, the correlation between the inflammatory response and miR-3663-3p or TDAG8/TLR4 mRNA expression was further analyzed. The results revealed a positive correlation between miR-3663-3p and the inflammatory response or TDAG8/TLR4 mRNA. In addition, the expression of TDAG8/TLR4 mRNA was also positively correlated with the secretion of proinflammatory cytokines and chemokines. Furthermore, ROC curve analysis demonstrated that miR-3663-3p had an area under the curve value of 0.908. With a cut-off point of 0.02, the diagnostic sensitivity and specificity of miR-3663-3p were 100%, indicating that miR-3663-3p is a potentially powerful diagnostic and predictive biomarker of sepsis. The ROC curve analysis of other biomarkers, such as IL-6, CXCL8 and MCP-1, also demonstrated that miRNA analysis combined with inflammatory cytokine secretion may be a reliable approach for the fast diagnosis and early identification of sepsis.

Taken together, the results of the current study focused on three structurally different types of biomarkers: Proteins (IL-6, IL-21 and CXCL-1, MCP-1), miRNAs (miR-3663-3p as an example) and mRNAs (TDAG8 and TLR4), as the combined detection of several biomarkers in a timely, specific and simultaneous way could ensure a more accurate diagnosis. The present study has certain limitations. For instance, further experiments should be conducted to verify whether miR-3663-3p or other identified DEMs serve a role in sepsis. Furthermore, Gene Ontology enrichment analysis of biological processes, cellular components and molecular functions should be investigated in future studies. However, the validity of the present results are not affected by these limitations.

The present study elucidated multiple blood-specific, highly regulated miRNAs that, to the best of our knowledge, have not yet been associated with sepsis. Most importantly, the current data demonstrated three structurally different types of biomarkers (proteins, miRNAs and mRNAs), the simultaneous and combined detection of which may provide a more accurate diagnosis for the occurrence and development of sepsis. In addition, the practicality and applicability of sampling miRNAs in liquid biopsies will enhance biomarker research and eventually the clinical management of sepsis.

Acknowledgements

Not applicable.

Funding

This study was supported by the Natural Science Research Foundation of Inner Mongolia (grant no. 2016ms0810).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The microarray datasets generated and/or analyzed during the current study are available in the NCBI GEO repository under accession no. GSE174507 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE174507).

Authors' contributions

XX, BB and HT performed the experiments. XX and BB analyzed the data and wrote the manuscript. RW and JY designed the present study and provided experimental materials. JY and XX confirmed the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The protocols of the current study were approved by the Local Ethics Committee of the Third Affiliated Hospital of Inner Mongolia Medical University (Baotou, China), and written informed consent was obtained from all subjects, who were permitted to withdraw from clinical observation at any time for any reason.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Papafilippou L, Claxton A, Dark P, Kostarelos K and Hadjidemetriou M: Nanotools for sepsis diagnosis and treatment. Adv Healthc Mater. 10:e20013782021. View Article : Google Scholar : PubMed/NCBI

2 

Rudd KE, Johnson SC, Agesa KM, Shackelford KA, Tsoi D, Kievlan DR, Colombara DV, Ikuta KS, Kissoon N, Finfer S, et al: Global, regional, and national sepsis incidence and mortality, 1990–2017: Analysis for the global burden of disease study. Lancet. 395:200–211. 2020. View Article : Google Scholar

3 

Cohen J, Vincent JL, Adhikari NK, Machado FR, Angus DC, Calandra T, Jaton K, Giulieri S, Delaloye J, Opal S, et al: Sepsis: A roadmap for future research. Lancet Infect Dis. 15:581–614. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Maslove DM and Wong HR: Gene expression profiling in sepsis: Timing, tissue, and translational considerations. Trends Mol Med. 20:204–213. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, Cohen J, Opal SM, Vincent JL and Ramsay G; International Sepsis Definitions Conference, : 2001 SCCM/ESICM/ACCP/ATS/SIS international sepsis definitions conference. Intensive Care Med. 29:530–538. 2003. View Article : Google Scholar : PubMed/NCBI

6 

American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference, . Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. Crit Care Med. 20:864–874. 1992. View Article : Google Scholar : PubMed/NCBI

7 

Yang R, Wang JM and Gao Y: Advances of microfluidic technologies applied in diagnosis and treatment of sepsis. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 31:789–792. 2019.(In Chinese). PubMed/NCBI

8 

Salmena L, Poliseno L, Tay Y, Kats L and Pandolfi PP: A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell. 146:353–358. 2011. View Article : Google Scholar

9 

Tsitsiou E and Lindsay MA: microRNAs and the immune response. Curr Opin Pharmacol. 9:514–520. 2009. View Article : Google Scholar

10 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Nana-Sinkam SP and Croce CM: Non-coding RNAs in cancer initiation and progression and as novel biomarkers. Mol Oncol. 5:483–491. 2011. View Article : Google Scholar

12 

Liu YY, Jiao WY, Li T and Bao YY: MiRNA-409-5p dysregulation promotes imatinib resistance and disease progression in children with chronic myeloid leukemia. Eur Rev Med Pharmacol Sci. 23:8468–8475. 2019.

13 

Slattery ML, Herrick JS, Pellatt DF, Stevens JR, Mullany LE, Wolff E, Hoffman MD, Samowitz WS and Wolff RK: MicroRNA profiles in colorectal carcinomas, adenomas and normal colonic mucosa: Variations in miRNA expression and disease progression. Carcinogenesis. 37:245–261. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Valsecchi V, Boido M, De Amicis E, Piras A and Vercelli A: Expression of muscle-specific MiRNA 206 in the progression of disease in a murine SMA model. PLoS One. 10:e01285602015. View Article : Google Scholar : PubMed/NCBI

15 

Han Y, Dai QC, Shen HL and Zhang XW: Diagnostic value of elevated serum miRNA-143 levels in sepsis. J Int Med Res. 44:875–881. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Wang H, Zhang P, Chen W, Feng D, Jia Y and Xie L: Serum microRNA signatures identified by Solexa sequencing predict sepsis patients' mortality: A prospective observational study. PLoS One. 7:e388852012. View Article : Google Scholar : PubMed/NCBI

17 

Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, et al: The third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA. 315:801–810. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Juul SE, Beyer RP, Bammler TK, McPherson RJ, Wilkerson J and Farin FM: Microarray analysis of high-dose recombinant erythropoietin treatment of unilateral brain injury in neonatal mouse hippocampus. Pediatr Res. 65:485–492. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Benjamini Y and Hochberg Y: Controlling the false discovery rate: A practical and powerful approach to multiple testing. J R Statist Soc B. 57:289–300. 1995.

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Lassen KG, McKenzie CI, Mari M, Murano T, Begun J, Baxt LA, Goel G, Villablanca EJ, Kuo SY, Huang H, et al: Genetic coding variant in GPR65 alters lysosomal pH and links lysosomal dysfunction with colitis risk. Immunity. 44:1392–1405. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Cochet F and Peri F: The role of carbohydrates in the lipopolysaccharide (LPS)/toll-like receptor 4 (TLR4) signalling. Int J Mol Sci. 18:23182017. View Article : Google Scholar

23 

Plociennikowska A, Hromada-Judycka A, Borzecka K and Kwiatkowska K: Co-operation of TLR4 and raft proteins in LPS-induced pro-inflammatory signaling. Cell Mol Life Sci. 72:557–581. 2015. View Article : Google Scholar

24 

Wang DW, Yin YM and Yao YM: Vagal modulation of the inflammatory response in sepsis. Int Rev Immunol. 35:415–433. 2016. View Article : Google Scholar

25 

Farah QY, Ali HA and Neihaya HZ: Using of TLR2 and TLR4 as biomarker for detection the severity of sepsis. Int J Psychosoc. 24:4431–4442. 2020.

26 

Stan RC, Soriano FG and de Camargo MM: A mathematical model relates intracellular TLR4 oscillations to sepsis progression. bioRxiv. 2018.https://doi.org/10.1101/164137

27 

Mogi C, Tobo M, Tomura H, Murata N, He XD, Sato K, Kimura T, Ishizuka T, Sasaki T, Sato T, et al: Involvement of proton-sensing TDAG8 in extracellular acidification-induced inhibition of proinflammatory cytokine production in peritoneal macrophages. J Immunol. 182:3243–3251. 2009. View Article : Google Scholar

28 

Miron J, Picard C, Frappier J, Dea D, Théroux L and Poirier J: TLR4 gene expression and pro-inflammatory cytokines in Alzheimer's disease and in response to hippocampal deafferentation in rodents. J Alzheimers Dis. 63:1547–1556. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Eidson LN, Inoue K, Young LJ, Tansey MG and Murphy AZ: Toll-like receptor 4 mediates morphine-induced neuroinflammation and tolerance via soluble tumor necrosis factor signaling. Neuropsychopharmacology. 42:661–670. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Ahmad S, Ahmed MM, Hasan PMZ, Sharma A, Bilgrami AL, Manda K, Ishrat R and Syed MA: Identification and validation of potential miRNAs, as biomarkers for sepsis and associated lung injury: A network-based approach. Genes (Basel). 11:13272020. View Article : Google Scholar

31 

Szilágyi B, Fejes Z, Pócsi M, Kappelmayer J and Nagy B Jr: Role of sepsis modulated circulating microRNAs. EJIFCC. 30:128–145. 2019.

32 

Huang J, Sun Z, Yan W, Zhu Y, Lin Y, Chen J, Shen B and Wang J: Identification of microRNA as sepsis biomarker based on miRNAs regulatory network analysis. Biomed Res Int. 2014:5943502014.

33 

Rahmel T, Schäfer ST, Frey UH, Adamzik M and Peters J: Increased circulating microRNA-122 is a biomarker for discrimination and risk stratification in patients defined by sepsis-3 criteria. PLoS One. 13:e01976372018. View Article : Google Scholar : PubMed/NCBI

34 

Zhang M, Wang C, Wu J, Ha X, Deng Y, Zhang X, Wang J, Chen K, Feng J, Zhu J, et al: The effect and mechanism of KLF7 in the TLR4/NF-κB/IL-6 inflammatory signal pathway of adipocytes. Mediators Inflamm. 2018:17564942018. View Article : Google Scholar : PubMed/NCBI

35 

Wu GJ, Lin YW, Chuang CY, Tsai HC and Chen RM: Liver nitrosation and inflammation in septic rats were suppressed by propofol via downregulating TLR4/NF-κB-mediated iNOS and IL-6 gene expressions. Life Sci. 195:25–32. 2018. View Article : Google Scholar

36 

Wang X, Jiang X, Deng B, Xiao J, Jin J and Huang Z: Lipopolysaccharide and palmitic acid synergistically induced MCP-1 production via MAPK-meditated TLR4 signaling pathway in RAW264.7 cells. Lipids Health Dis. 18:712019. View Article : Google Scholar : PubMed/NCBI

37 

Dai SP, Huang YH, Chang CJ, Huang YF, Hsieh WS, Tabata Y, Ishii S and Sun WH: TDAG8 involved in initiating inflammatory hyperalgesia and establishing hyperalgesic priming in mice. Sci Rep. 7:414152017. View Article : Google Scholar : PubMed/NCBI

38 

Tcymbarevich I, Richards SM, Russo G, Kühn-Georgijevic J, Cosin-Roger J, Baebler K, Lang S, Bengs S, Atrott K, Bettoni C, et al: Lack of the pH-sensing receptor TDAG8 [GPR65] in macrophages plays a detrimental role in murine models of inflammatory bowel disease. J Crohns Colitis. 13:245–258. 2019. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu X, Bu B, Tian H, Wu R and Yang J: MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis. Mol Med Rep 26: 334, 2022.
APA
Xu, X., Bu, B., Tian, H., Wu, R., & Yang, J. (2022). MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis. Molecular Medicine Reports, 26, 334. https://doi.org/10.3892/mmr.2022.12850
MLA
Xu, X., Bu, B., Tian, H., Wu, R., Yang, J."MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis". Molecular Medicine Reports 26.5 (2022): 334.
Chicago
Xu, X., Bu, B., Tian, H., Wu, R., Yang, J."MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis". Molecular Medicine Reports 26, no. 5 (2022): 334. https://doi.org/10.3892/mmr.2022.12850
Copy and paste a formatted citation
x
Spandidos Publications style
Xu X, Bu B, Tian H, Wu R and Yang J: MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis. Mol Med Rep 26: 334, 2022.
APA
Xu, X., Bu, B., Tian, H., Wu, R., & Yang, J. (2022). MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis. Molecular Medicine Reports, 26, 334. https://doi.org/10.3892/mmr.2022.12850
MLA
Xu, X., Bu, B., Tian, H., Wu, R., Yang, J."MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis". Molecular Medicine Reports 26.5 (2022): 334.
Chicago
Xu, X., Bu, B., Tian, H., Wu, R., Yang, J."MicroRNAs combined with the TLR4/TDAG8 mRNAs and proinflammatory cytokines are biomarkers for the rapid diagnosis of sepsis". Molecular Medicine Reports 26, no. 5 (2022): 334. https://doi.org/10.3892/mmr.2022.12850
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team