This article is mentioned in:

Introduction

Spinal cord injury (SCI) is known as a fatal neurological disorder characterized by motor, sensory, or autonomic function deficits and has led to a heavy economic burden on patients and society (1,2). As reported in 2016, there was a total of 282,000 individuals suffering from SCI in the United States and the rate of annual occurrence was found to be 54 cases per million individuals (~17,000 new cases per year) (3). Although great progress has been made in the development of strategies for neuroprotection and neuroregeneration with the development of drugs (1), surgery (4), stem cell transplantation (5) and tissue engineering technology (6), these strategies have not achieved satisfactory therapeutic efficacy clinically (7). This suggests that the understanding of the mechanisms of SCI progression remain to be elucidated.

The main pathogenesis of SCI is the inflammation dominated by activated microglia and astrocytes in the injured site after the primary mechanical injury (8). It has been reported that the levels of inflammatory factors, including TNF-α, IL-1β and IL-6 are elevated following SCI (9). Furthermore, the excessive production of pro-inflammatory cytokines can promote the generation of reactive oxygen species (ROS), leading to oxidative damage (10). On the other hand, the loss of blood supply to the injured site directly leads to an increase in ROS generation (11). This microenvironment composed of various inflammatory mediators leads directly to the apoptosis of functional cells, such as neurons (12). Therefore, a comprehensive understanding of the inflammatory mechanisms following SCI is necessary in order to providing a more theoretical basis for the treatment of SCI in the future.

S100A1, belonging to the S100 protein family, has been reported to regulate the release, uptake and transport of calcium by regulating calcium ATPase, leading to the activity of cellular signals (13). An imbalance in S100A1 has been revealed to induce the further impairment of myocardial viability and function on hypoxia-induced cell dysfunction in cardiovascular disease (13–15). Furthermore, S100A1 can bind to Toll-like receptor 4 (TRL4), which in turn activates the nuclear factor κB (NF-κB) and mitogen-activated protein kinases (MAPK) pathways, well-known drivers of inflammation, in cardiovascular and respiratory diseases (15,16), suggesting that S100A1 is a crucial inflammatory mediator, particularly under the conditions of ischemia and hypoxia. At the same time, S100A1 plays a critical role in the nervous system. A previous study demonstrated that S100A1 aggravated neuroinflammation and disease histopathology in a mouse model of Alzheimer's disease (17). In addition, the ablation of S100A1 in PC12 cells has been found to maintain cell viability and increase resistance to amyloid-β peptide-induced cell apoptosis (18). Extracellular signal-regulated kinase (ERK), downstream of NF-κB, has been reported to be a critical target of the apoptosis of nerve cells. Blocking the activity of ERK can attenuate neuroinflammation and neuroapoptosis (19). However, whether S100A1 can affect the function of neuronal cells through ERK activity remains to be fully determined.

In the present study, S100A1 expression was detected in a rat SCI model in vivo and a PC12 cell model in vitro of lipopolysaccharide (LPS)-induced inflammation. Next, it was determined whether ERK signaling activity was a downstream target of S100A1 by observing whether ERK signaling activity changed with S100A1 expression. Finally, whether S100A1 could affect the inflammation, oxidative stress and apoptosis of PC12 induced by LPS through ERK signaling pathway was explored. The present study revealed the expression and mechanism of S100A1 in SCI, providing a new reference for the study of SCI.

Materials and methods

Establishment of rat model of SCI

A total of 10 male Sprague-Dawley rats (age, 11–12 weeks; weight, 200–230 g) were obtained from the Experimental Animal Center of Harbin Medical University and were divided into the sham-operated (Sham; n=5) and SCI group (n=5). All rats were raised in the isolated ventilation cage at 22–26°C, 50% relative humidity with a 12/12-h light/dark cycle and had free access to sterile water and granular food. The rats in the sham group were only subjected to dorsal laminectomy of the T10 vertebral body, while the rats in the SCI group were subjected to spinal cord contusion surgery at the level of T10 as previously described (20). All rats were observed for health and behavior status once a day for seven consecutive days after surgery and were administered with penicillin (1 ml; 160,000 U/ml) and meloxicam (4 mg/kg) in the first three days to prevent infection and relieve pain. Uncontrollable inflammatory response at the wound site was set as the humane endpoints in the study (21). The study was reviewed and approved by the Ethics Committee of The First Affiliated Hospital of Harbin Medical University (Harbin, China; approval no. 2021080) and all experiments were carried out in accordance with the guidelines of Animal Care and Use Committee of the Harbin Medical University.

Euthanasia of experimental animals and sample handling

The animal experiment lasted for 7 days. On the 7th day after the surgery, all 10 rats had survived without infection/death and were anesthetized by an intraperitoneal injection of 1% sodium pentobarbital (40 mg/kg, MilliporeSigma). Death was confirmed by observing lack of heartbeat, breathing and pupils and nerve reflexes of the rats for 5 min (22). Then, 1 ml blood was collected through the orbital venous plexus for ELISA. Subsequently, the rats were euthanized via excessive anesthesia (3% sodium pentobarbital; 160 mg/kg), as previously described (23). After the whole body was perfused with cool saline, the site of injury was removed together with 5 mm of upper and lower spinal cord tissue. The samples used for western blot analysis and reverse transcription-quantitative PCR (RT-qPCR) were stored in liquid nitrogen, while the samples used for histochemistry were stored in 4% paraformaldehyde.

PC12 cell culture and treatment

LPS can induce inflammation in PC12 cells via TLR4 activity and it is widely used for SCI model in vitro (24–26). In the present study, the PC12 cells induced by LPS was used for the SCI model in vitro. PC12 cells, harvested from the pheochromocytoma of the rat adrenal medulla, no adrenaline secretion and comprised of eosinophilic and neuroblastic cells (27), were obtained from the Cell Resource Center of the Chinese Academy of Sciences (Shanghai Institute of Biological Sciences) and cultured in RPMI-1640 medium (HyClone; Cytiva) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) in 5% CO2 and a 37°C humidified atmosphere. The culture medium was changed every 2–3 days and the cells were sub-cultured when the cell density reached 90%. LPS, extracted from Escherichia coli 055:B5, at 1, 5 and 10 µg/ml (cat. no. L8880; Beijing Solarbio Science & Technology Co., Ltd.), configured one night in advance and stored overnight, was used to establish a PC12 cell model of inflammation for subsequent research.

RT-qPCR

The mRNA expression levels of S100A1, IL-1β, IL-6, IL-10 and TNF-α were evaluated using RT-qPCR. Total RNA from the spinal cord tissue and PC12 cells was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. A total of 1 µg RNA was used for cDNA reverse transcription with the reverse transcription kit (Takara Bio, Inc.) following the manufacturer's instructions. Lastly, the TB Green® Premix Ex Taq II kit (Takara Bio, Inc.) was used for qPCR with the following thermocycling conditions: Pre-heating at 95°C for 10 min, followed by 45 cycles at 95°C for 15 sec, at 60°C for 30 sec and at 72°C for 30 sec as previously described (22). The primer sequences used in the present study are listed in Table I. GAPDH was used as the internal reference. The relative expression levels of target genes were calculated using the 2−ΔΔCq formula (28).

Table I. Primers sequences used in reverse transcription-quantitative PCR.

Table I.

Primers sequences used in reverse transcription-quantitative PCR.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
S100A1	ggtcggcagtaaagacaggt	atttcagcagcacacggttg
IL-1β	gcacagttccccaactggta	ggagactgcccattctcgac
IL-6	acaagtccggagaggagact	acagtgcatcatcgctgttc
TNF-α	atgggctccctctcatcagt	gcttggtggtttgctacgac
IL-10	ttccctgggagagaagctga	gacacctttgtcttggagctta
CAT	gctccgcaatcctacaccat	ggacatcgggtttctgaggg
MnSOD	caccgaggagaagtaccacg	tgggttctccaccaccctta
GAPDH	gcatcttcttgtgcagtgcc	ggtaaccaggcgtccgatac

Western blot analysis

Briefly, total protein from the spinal cord tissue and PC12 cells was isolated using RIPA buffer (Beyotime Institute of Biotechnology) containing 1 mM PMSF (Dalian Meilun Biology Technology Co., Ltd.) on the ice for 30 min. After the protein concentration was detected using a BCA kit (Beyotime Institute of Biotechnology), 60–80 µg protein was loaded on 12.5 or 15% SDS-PAGE for separation, followed by transfer onto a PVDF membrane (Merck KGaA). The membrane was first blocked with 5% skimmed milk in 0.05% PBS-Tween 20 for 1 h at room temperature. The membranes were then incubated with primary antibodies for S100A1 (1:500; cat. no. 16027-1-AP; ProteinTech Group, Inc.), nuclear factor erythroid 2-related factor 2 (Nrf2; 1:1,000; cat. no. 80593-1-RR; ProteinTech Group, Inc.), ERK1/2 (1:1,000; cat. no. 4695), p-ERK1/2 (1:2,000; cat. no. 4370), cleaved caspase-3 (1:1,000; cat. no. 9664), Bax (1:1,000; cat. no. 2772), Bcl2 (1:1,000; cat. no. 3498) (all from Cell Signaling Technology, Inc.) and β-actin (1:1,000; cat. no. 20536-1-AP; ProteinTech Group, Inc.) overnight at 4°C followed by incubation with HRP-conjugated secondary antibody (1:10,000; cat. no. 7074, Cell Signaling Technology, Inc.) at room temperature for 1 h. Lastly, the bands were visualized using ECL reagent (Beyotime Institute of Biotechnology) as per the manufacturer's protocol with the ChemiDoc MP System (Bio-Rad Laboratories, Inc.). The semi-quantitative analysis was performed with Image-Pro Plus (version 6.0; Media Cybernetics, Inc.).

Cell transfection

S100A1 overexpression (ov-S100A1) plasmid (plasmid primer: Forward: 5′-GAAGATTCTAGAGCTAGCGAATTCATGGGCTCTGAGCTGGAG-3′; Reverse: 5′-CGCAGATCCTTGCGGCCGCGGATCCTCAACTGTTCTCCCAGAA-3′) encoding the full-length open reading frame of rat S100A1 and the S100A1 short-interfering (si) RNA plasmid targeting sequence (5′-UGGAGACCCUCAUCAAUGUdTdT-3′) for silencing S1001A (si-S100A1), as well as their corresponding blank plasmid vectors were prepared by Shanghai Genechem Co., Ltd. The overexpression and silencing of S100A1 in PC12 cells were carried out using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. At 48 h post-transfection, the PC12 cells with gene intervention were exposed to LPS and were used in other experiments. In addition, the cells transfected with ov-S100A1 plasmid were treated with the ERK inhibitor, MK-8353 (100 nM, MedChemExpress), 12 h prior to exposure to LPS, as previously described (29). The cell groups were designed as follows: The control group (without any treatment), LPS group (cells stimulated with 5 µg/ml LPS), LPS + si-S100A1, LPS + ov-S100A1 and ov-S100A1 with MK-8353 treatment (LPS + ov-S100A1 + MK) groups.

Hematoxylin and eosin (HE) staining

The HE staining was performed to compare the histomorphological differences between the SCI and Sham groups. Briefly, the spinal cord tissues were fixed with 4% paraformaldehyde at 4°C for 24 h and prepared as paraffin-embedded tissues after dehydration using xylene and gradient alcohol solution. Next, 5-µm paraffin sections were prepared, heated in the 60°C oven for 30 min and washed with xylene I and II, for 5 min each time at room temperature. After being treating with 100, 100, 95, 95 and 80% gradient alcohol at room temperature for 5 min each time, the sections were stained using the HE stain kit (Beijing Solarbio Science & Technology Co., Ltd.) according to the manufacturer's instructions. Firstly, the sections were treated with hematoxylin for 1 min at room temperature, followed by being differentiated in 1% hydrochloric acid for 30 sec at room temperature. Lastly, the sections were stained with eosin for 2 min at room temperature. Finally, the images were harvested by light microscope (Leica Microsystems GmbH).

Tissue immunofluorescence

Immunofluorescence assay was performed to explore the changes in S100A1 expression in SCI in vivo. The spinal cord tissues were fixed with 4% paraformaldehyde at 4°C for 24 h, then dehydrated by sucrose solution gradient and embedded in optimal cutting temperature compound to yield 5-µm-thick frozen sections. Following incubation with 0.3% H2O2 at room temperature for 30 min, 0.5% Triton X-100 was used for permeabilizing the sections. Normal goat serum (10%; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) was then used to incubate the sections at room temperature for 30 min. After the primary antibody of S100A1 (1:50; cat. no. 16027-1-AP; ProteinTech Group, Inc.) was used to incubate the sections overnight at 4°C, the fluorescent secondary antibody (1:500; cat. no. ab150113, Abcam) was used to incubate the sections for 1 h at room temperature. Lastly, the cell nuclei were stained with DAPI (Beijing Solarbio Science & Technology Co., Ltd.) for 5 min at room temperature and the sections were visualized using a fluorescence microscope (Olympus Corporation). Image-Pro Plus (version 6.0; Media Cybernetics, Inc.) was used for statistical analysis.

Cell immunofluorescence

In order to detect the changes in the expression of S100A1 in PC12 cells stimulated with various concentrations of LPS, a density of 2×105 cells/well was seeded in six-well plates and cultured overnight followed by stimulation with 1, 5 and 10 µg/ml LPS for 12 h at 37°C. The cells were then fixed with 4% paraformaldehyde for 30 min at room temperature and permeabilized with 0.5% Triton X-100 for 30 min at room temperature. Subsequently, the cells were blocked with 5% BSA for 30 min (Beijing Solarbio Science & Technology Co., Ltd.) at room temperature and incubated with S100A1 primary antibody (1:100; cat. no. 16027-1-AP; ProteinTech Group, Inc.) overnight at 4°C. The fluorescent secondary antibody (1:500; cat. no. ab150113, Abcam) and DAPI were used to treat the cells for 1 h and 5 min at room temperature, respectively. Images were obtained using a fluorescence microscope (Olympus Corporation). Image-Pro Plus (version 6.0; Media Cybernetics, Inc.) was used for analysis.

ELISA

ELISA was performed to examine the effects of S100A1 on inflammation levels in the PC12 cell culture supernatant. The cell supernatant among different groups was collected and the expression levels of IL-1β (cat. no. KE20005; ProteinTech Group, Inc.), IL-6 (cat. no. KET9004-96T; EliKine; Abbkine Scientific Co., Ltd.), TNF-α (cat. no. KE20001; ProteinTech Group, Inc.) and IL-10 (cat. no. KE20003; ProteinTech Group, Inc.) were detected using the respective kits according to the manufacturer's instructions.

ROS level evaluation

The levels ROS among different groups were evaluated using the 2′-7′-dichlorodihydrofluorescein-diacetate (DCFH-DA) kit (Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Briefly, the cells from the different groups were collected following trypsin digestion and incubated with serum-free medium (Gibco; Thermo Fisher Scientific, Inc.) containing DCFH-DA (10 µM) probes for 30 min in the dark at room temperature. The cells were then resuspended by PBS following centrifugation (201 × g) at room temperature for 5 min. The DCFH-DA-positive cells were detected using a flow cytometer (BD FACSCalibur; BD Biosciences).

Activity detection of catalase (CAT) and manganese superoxide dismutase (MnSOD)

The activities of CAT and MnSOD among different groups were evaluated using CAT and MnSOD Assay kits (Nanjing Jiancheng Bioengineering Institute) based on the cell lysate. Briefly, the cells from the different groups were harvested followed by resuspension with 0.3 ml PBS. Next, after the resuspended cells being broken by ultrasound (frequency, once every 2 sec) on ice for 1 min (Scientz-IID), the protein was harvested with centrifugation (13,887 × g for 25 min at 4°C). The total protein concentration was detected using a BCA kit (Beyotime Institute of Biotechnology). The contents of CAT and MnSOD in the samples were examined according to the corresponding manufacturer's instructions.

Apoptosis assay

The cellular apoptosis levels of the control, si-S100A1, ov-S100A1 and ov-S100A1 + MK groups were evaluated using an apoptosis kit (cat. no. CA1020 Beijing Solarbio Science & Technology Co., Ltd.) according to the manufacturer's instructions. First, the cells from the different groups were collected following trypsin digestion and incubated with solution containing propidium iodide and Annexin V for 10 min in the dark at room temperature. The sample was then resuspended in PBS following centrifugation (201 × g) at room temperature for 5 min and detected using a flow cytometer (BD FACSCalibur; BD Biosciences).

Statistical analysis

All experiments in the present study were conducted at least three times. The data were analyzed using GraphPad Prism 6.0 software (GraphPad Software, Inc.) and are presented as the mean ± standard deviation. An unpaired t-test was used for comparisons between two groups. For comparisons between multiple groups, when n<6, Kruskal Wallis test of multiple independent samples were performed. P<0.05 was considered to indicate a statistically significant difference.

Results

S100A1 expression is elevated in tissue from rats with SCI

With the aim of exploring the expression of S100A1 in SCI, a rat model of SCI was first established. Subsequently, the morphological examination revealed that there were evident tissue defects, hemorrhaging, necrosis and inflammatory cell infiltration, as well as nerve cell atrophy and vacuolization in the SCI group compared with the Sham group (Fig. 1A); this suggested that the model of SCI was successfully established. The mRNA and protein expression levels of S100A1 were found to be significantly upregulated in the SCI group compared with the Sham group (Fig. 1B and C). Furthermore, immunofluorescence staining confirmed that S100A1 was highly expressed in the tissue of rats with SCI, compared with that of the rats in the Sham group (Fig. 1D). Finally, the aforementioned results confirmed that S100A1 was significantly upregulated in the tissue of rats with SCI.

Figure 1. S100A1 expression in SCI. (A) Representative images of hematoxylin and eosin staining in the Sham and SCI group on the sagittal plane (scale bar, 1 mm). (B) mRNA expression of S100A1 in the Sham and SCI group examined using reverse transcription-quantitative PCR. (C) The protein expression of S100A1 in the Sham and SCI group was examined using western blot analysis. (D) The expression of S100A1 in the Sham and SCI group was verified using immunofluorescence staining (scale bar, 200 µm). n=5. ***P<0.001 vs. Sham group. SCI, spinal cord injury; Sham, sham-operated.

S100A1 expression is upregulated in the PC12 cell model of LPS-induced inflammation

PC12 cells are widely used in neural dysfunction-related research, including SCI (30). In the present study, S100A1 expression was detected in the PC12 cell model of LPS-induced inflammation. After the PC12 cells were stimulated with various concentrations of LPS (0, 1, 5 and 10 µg/ml) for 12 h, the mRNA and protein expression levels of S100A1 exhibited a significant increase in a concentration-dependent manner (Fig. 2A and B). The results of immunofluorescence staining also revealed that the expression of S100A1 was elevated with the increasing LPS concentration (Fig. 2C). On the whole, these results suggested that S100A1 expression was upregulated in the PC12 cell model of LPS-induced inflammation. Subsequently, 5 µg/ml LPS was used for PC12 cell model establishment to explore the biological function of S00A1 in LPS induced SCI model in vitro as the reported studies (30–32).

Figure 2. S100A1 expression in LPS-stimulated PC12 cells. (A) S100A1 mRNA expression was detected using reverse transcription-quantitative PCR in PC12 cells stimulated with various concentrations of LPS. (B) S100A1 protein expression was detected using western blot analysis in PC12 cells stimulated with various concentrations of LPS. (C) S100A1 protein expression was examined using immunofluorescence staining in PC12 cells stimulated with various concentrations of LPS (scale bar, 50 µm). n=3. *P<0.05, **P<0.01, ***P<0.001. LPS, lipopolysaccharide.

S100A1 expression mediates the activity of the ERK signaling pathway in PC12 cells stimulated with LPS

S100A1 expression was upregulated in the rats with SCI and in cells with stimulated with LPS in vitro. However, the potential function of S100A1 in PC12 cells stimulated with LPS remained unclear. Plasmids containing siRNA targeting S100A1 and the full length of S100A1 were used to silence and overexpress S100A1, respectively and the results were verified using western blot analysis. S100A1 expression was significantly decreased in the si-S100A1 group and significantly increased in the ov-S100A1 group, compared with the control group (Fig. 3A). The ERK signaling pathway has been verified to be associated with the inflammation process and blocking its activity can effectively attenuate inflammatory injury induced by oxygen-glucose deprivation and the reperfusion of PC12 cells (33–35). Similarly, in the present study, the silencing or overexpression of S100A1 was accompanied by the partially decreased or increased expression of p-ERK1/2, respectively, indicating that changes in S100A1 expression could mediate the activity of the ERK signaling pathway in PC12 cells (Fig. 3B).

Figure 3. S100A1 positively regulates the ERK signaling pathway. (A) S100A1 protein expression after the silencing and overexpression of S100A1 in PC12 cells was detected using western blot analysis. (B) Expression of p-ERK1/2 and total ERK1/2 expression in the Control, LPS, LPS with silencing and S100A1 overexpression groups. n=3. ***P<0.001 vs. Control group. ##P<0.01 vs. LPS group. LPS, lipopolysaccharide; si, short interfering; ov, overexpression; NC, negative control; p-, phosphorylated.

S100A1 regulates the inflammation of PC12 cells by mediating the ERK signaling pathway

As SCI is accompanied by the inflammatory cascade, effective strategies for suppressing inflammatory injury may contribute to functional recovery following SCI (8). Whether S100A1 could regulate the inflammation level of PC12 cells in vitro was explored. First, the mRNA and protein secretion levels of pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α), as well as anti-inflammatory cytokines (IL-10) were detected. As was expected, following stimulation with LPS, the expression levels of IL-1β, IL-6 and TNF-α in the LPS group were significantly higher in comparison with the control group, while the expression of IL-10 exhibited the opposite trend (Fig. 4A and B). However, the silencing of S100A1 partially attenuated the levels of inflammatory mediators in the cells and improved their anti-inflammatory ability (Fig. 4A and B). The overexpression of S100A1 aggravated the levels of inflammation and these effects were partially abolished by the ERK1/2 molecular inhibitor, MK-8353 (Fig. 4A and B). These results suggested that S100A1 could mediate the levels of inflammation of PC12 cells by targeting the ERK signaling pathway.

Figure 4. S100A1 regulates the level of inflammation in PC12 cells through the ERK signaling pathway. (A) The mRNA expression levels of inflammatory cytokines (IL-1β, IL-6 and TNF-α) and anti-inflammatory cytokines (IL-10) were detected using reverse transcription-quantitative PCR in the Control, LPS, LPS with S100A1 silencing/overexpression, LPS with S100A1 overexpression and EKR inhibitor groups. (B) The protein levels of inflammatory cytokines (IL-1β, IL-6 and TNF-α) and anti-inflammatory cytokines (IL-10) were detected using ELISA in the Control, LPS, LPS with S100A1 silencing/overexpression, LPS with S100A1 overexpression and EKR inhibitor groups. n=3. *P<0.05, **P<0.01, ***P<0.001 vs. Control group. #P<0.05, ##P<0.01, ###P<0.001 vs. LPS group. &P<0.05, &&P<0.01 vs. LPS + si-S100A1 group. $P<0.05, $$P<0.01 vs. LPS + ov-S100A1 group. LPS, lipopolysaccharide; ov, overexpression; si, short interfering.

S100A1 regulates the oxidative-stress damage of PC12 cells by mediating the ERK signaling pathway

Oxidative stress-induced damage is highly associated with inflammation and tissue ischemia and necrosis caused by SCI are the common causes of oxidative stress-induced injury (36). In the present study, as expected, the levels of ROS were found to be significantly elevated in the LPS group (Fig. 5A and B). At the same time, the silencing of S100A1 partially decreased the level of ROS and the overexpression of S100A1 promoted the generation of ROS. Similarly, the ERK1/2 inhibitor, MK-8353, partially prevented the promoting effects of the overexpression of S100A1 on ROS generation (Fig. 5A and B). Furthermore, the effects of S100A1 on the antioxidant capacity of cells were evaluated. The enzymatic activities, CAT and MnSOD, decreased significantly in the LPS group. The silencing expression of S100A1 promoted the gene expression and enzyme activity of CAT and MnSOD, while the overexpression of S100A1 further decreased the levels of CAT and MnSOD. In addition, MK-8353 partially counteracted the inhibitory effects of S100A1 overexpression on CAT and MnSOD levels (Fig. 5C and D). Nrf2, is a transcription factor of anti-oxidative stress element and its increased expression can transfer it to the nucleus and participate in the transcription of CAT and SOD, leading to the enhancement of cell antioxidant capacity (37). Herein, the protein expression of Nrf2 was detected among the groups and found that Nrf2 expression decreased significantly in the LPS group. Silencing and overexpression of S100A1 accompanied by up- and down-regulated Nrf2 expression. MK-8353 partially counteracted the inhibitory effects of S100A1 overexpression on Nrf2 level (Fig. 5E) Thus, these results suggested that S100A1 regulated the oxidative stress levels in PC12 cells by targeting the ERK signaling pathway.

Figure 5. S100A1 regulates the oxidative stress levels of PC12 cells through the ERK signaling pathway. (A and B) ROS levels in the Control, LPS, LPS + S100A1 silencing/overexpression, LPS with S100A1 overexpression and EKR inhibitor groups. (C) mRNA and enzyme activity of CAT in the different groups. (D) mRNA and enzyme activity of MnSOD in the different groups. (E) The protein expression of Nrf2 in differnet groups, n=3. **P<0.01, ***P<0.001 vs. Control group. #P<0.05, ##P<0.01, ###P<0.001 vs. LPS group. &P<0.05, &&P<0.01, &&&P<0.001 vs. LPS + si-S100A1. $P<0.05, $$P<0.01 vs. LPS + ov-S100A1 group. LPS, lipopolysaccharide; ROS, reactive oxygen species; CAT, catalase; MnSOD, manganese superoxide dismutase; ov, overexpression; si, short interfering; Nrf2, nuclear factor erythroid 2-related factor 2.

S100A1 regulates the apoptosis of PC12 cells by mediating the ERK signaling pathway

Retaining a sufficient number of viable cells is the crucial factor limiting the progression of SCI (38). Thus, the present study investigated the effects of S100A1 on the level of apoptosis. It was found that the level of apoptosis was elevated by LPS stimulation. The silencing and overexpression of S100A1 significantly decreased and increased apoptosis level, respectively. In addition, MK-8353 partly abolished the promoting effects of S100A1 overexpression on apoptosis (Fig. 6A and B). Subsequently, the effects of S100A1 on apoptosis related proteins were also detected. The ratio of Bax/Bcl2 was increased in the LPS group, whereas it was partially decreased in the LPS + si-S100A1 group and further increased in the LPS + ov-S100A1 group (Fig. 6C). In addition, the expression of cleaved caspase-3 also exhibited a similar trend of Bax/Bcl2 (Fig. 6D). As was expected, MK-8353 partially abolished the promoting effect of S100A1 overexpression on the expression of Bax/Bcl2 and cleaved caspase-3 (Fig. 6C and D). These results suggested that S100A1 regulated the apoptosis of PC12 cells by targeting the ERK signaling pathway.

Figure 6. S100A1 regulates the apoptosis of PC12 cells through the ERK signaling pathway. (A and B) The apoptosis levels in the Control, LPS, LPS with S100A1 silencing/overexpression, LPS with S100A1 overexpression and EKR inhibitor groups. (C and D) The protein levels of Bax, Bcl2 and cleaved caspase-3 in the different groups. n=3. *P<0.05, ***P<0.001 vs. Control group. #P<0.05, ###P<0.001 vs. LPS group. &&P<0.01, &&&P<0.001 vs. LPS + si-S100A1. $P<0.05, $$P<0.01, $$$P<0.001 vs. LPS + ov-S100A1 group. LPS, lipopolysaccharide; ov, overexpression; si, short interfering.

Discussion

With the development of modern medical technology, SCI remains a significant source of mortality and is associated with increasing costs for society, as a result of long-term disability. Although there some preclinical studies on stem cells (39), gene therapy (40) or tissue engineering technology (41) for neuroprotection and regeneration have been performed, few investigations have reached clinic practice (35). Thus, a more in-depth understanding of the molecular basis of SCI is still required. In the present study, S100A1 was found to be significantly highly expressed in the damaged spinal cord tissue. In addition, S100A1 was also found to be highly expressed in the PC12 cell model of LPS induced-inflammation. Furthermore, silencing the expression of S100A1 partially inhibited inflammation, oxidative stress-induced damage and apoptosis via the ERK signaling pathway in PC12 cells stimulated with LPS.

The main pathological structures of SCI include primary injury followed by the secondary injury. The primary injury involves mechanical compression and damage caused by fractured and/or displaced bone fragments. Current clinical approaches towards primary injury mainly include early surgical decompression and stabilization (42). The spinal cord tissue squeezed by external forces is followed by ischemia, hypoxia and the excessive release of inflammatory cytokines and prostaglandins, resulting in oxidative stress-induced injury and more severe tissue apoptosis and necrosis (43,44). Nevertheless, at present, there are no available effective treatments for the inflammatory process of SCI (42), even though a number of research teams have verified that anti-inflammatory treatment can exert an effective neuroprotective effect in animal experimental models (45–47). However, the majority of research results are still far from real clinical transformation. Thus, the investigation of the inflammatory pathological process of SCI is still necessary so as to develop practical and effective treatments.

S100A1 is a member of the S100 protein family and serves as an alarmin in injured tissue, such as the heart or/and cardiomyocytes (15). S100A1 is mainly involved in the regulation of sarcoplasmic reticulum Ca2+ activity, as well as mitochondrial function and participates in cellular activities (48). In a previous study, S100A1 was found to be released from the ischemic myocardium to the circulation of patients and mice with acute ST-segment (15). At the same time, S100A1 plays an early immunomodulatory role in cardiac fibroblasts of injured hearts (15). In addition, the inhibition of S100A1 expression has been shown to mitigate oxidative stress and the apoptosis of cardiomyocytes (49,50). However, the expression of S100A1 in the injured spinal cord and its regulatory effects on inflammation, oxidative stress and apoptosis remain to be elucidated.

In the present study, S100A1 was verified to be highly expressed in vivo and in PC12 cells stimulated with LPS in vitro, accompanied by increased levels of inflammation, oxidative stress-induced damage and apoptosis. The silencing of S100A1 partially reduced the LPS-induced inflammation, oxidative stress and apoptosis, whereas the overexpression of S100A1 aggravated inflammation, oxidative stress and the apoptosis of PC12 in vitro.

ERK1/2 signaling, as a crucial component of the MAPK pathway, is an evolutionary conserved signaling cascade, responsible for transmitting signals from the cell surface to inside the cells (33). Furthermore, it has been reported that ERK1/2 signaling can mediate the development process of the neuronal system and can participate in certain neurological activities by regulating nerve growth, elastic properties, neurological and cognitive processing in nerve injuries (51). In addition, the inhibition of ERK1/2 can block the cellular inflammatory and apoptosis response of PC12 (33). However, whether S100A1 can regulate the ERK signaling pathway in PC12 cells remains unclear.

In the present study, it was found that the stimulation of PC12 cells with LPS activated the ERK signaling pathway. The silencing of S100A1 partially reduced the activity of ERK and the overexpression of S100A1 promoted the activation of the ERK signaling pathway, suggesting that S100A1 can regulate the activity of ERK signaling as upstream signal. In addition, the ERK inhibitor, MK-8353 partly abolished the promoting effects of the overexpression of S100A1 on inflammation, oxidative stress and the apoptosis of PC12 cells. These results verified that S100A1 regulated the inflammation, oxidative stress and apoptosis of PC12 cells via the ERK signaling pathway.

It is worth noting that although MK-8353 application significantly reduced the levels of inflammation, oxidative stress and apoptosis compared with LPS + ov-S100A1 group, MK-8353 application did not decrease these phenotypes levels of cells like LPS + si-S100A1 group, suggesting the increase of S100A1 leaded to the increase of inflammation, oxidative stress and apoptosis of PC12 cells partly through ERK signaling pathway. As expected for the ERK signaling pathway in the present study, PI3K, Wnt/β-catenin, NF-κB signaling and others are all reported to be involved in SCI development (52–54). MK-8353 application blocked the activity of ERK but did not block other possible mechanisms that were potential regulated by SA100A1. This may be the reason why the application of MK-8353 can only partially reduce the inflammation, oxidative stress and apoptosis levels of cells. The typical downstream mechanisms of S100A1 will continue to be explored in subsequent studies.

There were still some limitations in the present study. First, LPS was used to induce PC12 cells to simulate SCI in vitro. LPS causes inflammatory reaction by activating TLR4 molecules in cells (55). Although TLR4 activation is also a mechanism of SCI (56), the LPS induced cell model does not fully represent the mechanism of SCI in vivo. In addition, the results of the present study have not been supplemented in vivo, which is another limitation of the study.

In conclusion, in the present study, S100A1 expression was upregulated in rats with SCI and in LPS-stimulated PC12 cells. The overexpression of S100A1 was accompanied by an increase in inflammation, oxidative stress injury and apoptosis. The silencing of S100A1 attenuated inflammation, oxidative stress and apoptosis by blocking the ERK signaling pathway. Thus, the present study revealed the expression and mechanisms of S100A1 in SCI. These findings may provide more references for the future theoretical research of SCI.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YB and ZB were substantially responsible for the experiment conception and design. YB, NG, ZX and YC contributed to data acquisition and statistical analysis. YB, WZ and QC were responsible for the interpretation of the experimental data, drafting the manuscript and revising it critically for important intellectual content. YB and ZB confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

The present study obtained the approval of the ethics committee of The First Affiliated Hospital of Harbin Medical University (grant no. 2021080).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References