Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2023 Volume 27 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2023 Volume 27 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data1.pdf
    • Supplementary_Data2.pdf
Article Open Access

hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway

  • Authors:
    • Yifan Wang
    • Shanshan Liu
    • Feifei Lv
    • Wenjing Zhai
    • Weina Wang
    • Yanhao Duan
    • Yongle Qiu
  • View Affiliations / Copyright

    Affiliations: Department of Stomatology, Affiliated Hospital of Hebei University, Baoding, Hebei 071000, P.R. China, Department of Stomatology, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Department of Stomatology, People's Hospital of Shijiazhuang, Shijiazhuang, Hebei 050000, P.R. China, Department of Cardiology, Zhangjiakou First Hospital, Zhangjiakou, Hebei 075000, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 128
    |
    Published online on: May 16, 2023
       https://doi.org/10.3892/mmr.2023.13015
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Oral cancer is one of the leading causes of death worldwide, with a reported 5‑year survival rate of ~50% after treatment. The treatment measures for oral cancer are very expensive and affordability is low. Thus, it is necessary to develop more effective therapies to treat oral cancer. A number of studies have found that miRNAs are invasive biomarkers and have therapeutic potential in a variety of cancers. The present study included 30 oral patients and 30 healthy controls. Clinicopathological characteristic and miR‑216a‑3p/β‑catenin expression level of 30 oral cancer patients were analyzed. In addition, two oral cancer cell lines (HSC‑6 and CAL‑27) were used for mechanism‑of‑action study. The expression level of miR‑216a‑3p was higher in oral cancer patients compared with healthy controls and positively associated with tumor stage. Inhibition of miR‑216a‑3p potently suppressed cell viability and induced apoptosis of oral cancer cells. It was found that effects of miR‑216a‑3p on oral cancer were through Wnt3a signaling. It was also found that the expression level of β‑catenin was higher in oral cancer patients compared with healthy controls and positively associated with tumor stage; the effects of miR‑216a‑3p on oral cancer were through β‑catenin. In conclusion, miR‑216a‑3p and the Wnt‑β‑catenin signaling pathway may be interesting candidates to develop effective therapies for oral cancers.

Introduction

Oral cancer is one of the leading causes of mortality worldwide, with a reported 5-year survival rate of ~50% after treatment (1). Of the total oral malignancies ~90% are squamous cell carcinomas and the etiological basis of oral cancer is tobacco intake, smoking, smokeless tobacco (snuff or chewing tobacco), alcohol and areca nut intake, excessive sunlight exposure, passive smoking and human papillomavirus (HPV) (2). The management of oral cancer is a multidisciplinary endeavor, as each patient presents with a unique set of challenges, the management of which influences both overall survival and quality of life (2). The treatment measures for oral cancer are expensive and affordability is therefore low. Thus, it is necessary to develop more effective therapies to treat this difficult disease.

MicroRNAs (miRNAs) have emerged as a stimulating area of basic and translational biomedical study, owing to their influence on gene expression, robust presence in bodily tissues and fluids and their potential usefulness as disease biomarkers (3). A number of cancer studies have found that miRNAs are invasive biomarkers and have therapeutic potential for a variety of cancers. For example, miR106a was reported to promote the growth of breast cancer and suppress the sensitivity of transplanted tumors to cisplatin (4). miR-126 was found to regulate angiogenesis in breast cancer by targeting VEGF-A-mRNA, which was proposed as a novel therapeutic approach in breast cancer treatment (5). Therefore, it is worthwhile to investigate the effects of miRNAs for the development of novel biomarkers and anticancer drugs.

miRNAs are found to regulate different signaling pathways. As one of the important signaling pathways controlling a variety of cellular activities, the phosphoinositide-3 kinase (PI3K)/AKT/mammalian target of rapamycin (mTOR) signaling pathway serves an important role in various aspects of cancer initiation and progression, including proliferation, apoptosis, metastasis, angiogenesis and drug resistance interacting with different miRNAs (6). The Notch signaling pathway serves an essential role in differentiation and development and is found to cross-regulate with miRNAs in cancer initiation/progression via regulating the expression of multiple oncogenes and tumor suppressor genes (7). Wnt signaling pathway is well-known to be involved in numerous fundamental processes essential for embryonic development and normal adult homeostasis (8). Dysfunctional Wnt signaling has been related to the evolution of and maintenance of leukemic stem cells as well as a number of other different cancers (9). In chronic lymphocytic leukemia, it was found that miRNAs and signaling cascades of Wnt pathway had strong interaction (10). Therefore, it is worthwhile to explore the interaction of miRNAs and Wnt signaling and its effects on oral cancer.

As one member of miRNAs, miR-216a-3p has been explored in various diseases. Wang et al (11) found that miR-216a-3p serves an important role in Parkinson's disease. Chang and Kan (12) found that mesenchymal stem cell originated exosomal circular RNA circFBXW7 could obviously reduce cell proliferation, migration and inflammation via interacting miR-216a-3p in rheumatoid arthritis. Regarding tumors, a previous study found that miR-216a-3p markedly inhibited the proliferation and invasion of cervical cancer via suppressing ACTL6A-mediated YAP signaling (13). Moreover, Wang et al (14) found that miR-216a-3p significantly suppressed the proliferation of colorectal cancer cell proliferation via regulating genes including COX-2 and ALOX5. Thus, it is attractive to explore the effects of miR-216a-3p on oral cancer.

In the present study, two oral cancer lines, HSC-6 and CAL-27, were used to investigate the effects of rapamycin on oral cancer growth. It was found that expression level of miR-216a-3p was higher in oral cancer patients and positively correlated with tumor stages and inhibition of miR-216a-3p potently suppressed cell viability and induced apoptosis of oral cancer cells. In principle, it was found that effects of miR-216a-3p on oral cancer were through Wnt3a. It was also found that the expression level of β-catenin was higher in oral cancer patients and positively correlated to tumor stages and effects of miR-216a-3p on oral cancer were through β-catenin. The findings of the present study may provide important insight for treating oral cancers.

Materials and methods

Ethical statement

All patients agreed to participate in the study and provided written informed consent. The present study was approved by the ethical board of The Fourth Hospital of Hebei Medical University (Shijiazhuang, China; approval no. 2022KY392).

Patients' basic information and peripheral blood mononuclear cells (PBMC) isolation

PBMCs were isolated from whole blood that was obtained from the blood biobank of Fourth Affiliated Hospital, Hebei Medical University. In total, there were 30 patients with oral cancer and 30 healthy controls included in the study. Blood (~5 ml) was obtained from patients before they received any intervention. The clinicopathological characteristics of the patients with oral cancer are listed in Table SI.

Cell culture

The two oral cancer cell lines, HSC-6 and CAL-27, were purchased from Tianjin IB Biology (https://www.innovationbiotechnology.com.cn/; Tianjin, China). The two cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM; cat. no. D6429-500ML; MilliporeSigma) supplemented with 10% fetal bovine serum (FBS; cat. no. MFCD00132239; MilliporeSigma), 1% L-glutamine (cat. no. 25030081; Invitrogen; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin solution (cat. no. V900929-100ML; MilliporeSigma) at 37°C in a 5% CO2 incubator. The cells were sub-cultured when they were 80% confluent. The HSC-6 cell line and CAL-27 cell line were regularly tested for Mycoplasma by using the MycoAlert Plus kit (Lonza Group, Ltd.) to make sure they were mycoplasma negative.

Western blot analysis

RIPA lysis buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) was used to lyse the cells using SDS/PAGE sample buffer [50 mM Tris-HCl (pH 6.8), 2% SDS, 0.1% bromophenol blue, 10% glycerol and 1 mM dithiothreitol]. Five microliters of the lysates were removed for protein concentration measurement (Bio-Rad Protein Assay Dye Reagent Concentrate; Bio-Rad Laboratories, Inc.). Samples were boiled at 95°C for denature for 10 min. Subsequently, total protein (30 µg per lane) was separated by 10% SDS-PAGE. Post transferring, PVDF membranes (Beyotime Institute of Biotechnology) were blocked by 5% non-fat milk TBST buffer containing 0.5 ml/l TWEEN 20 for 45 min at room temperature, followed by incubation with primary antibodies (1:1,000 dilution), including anti-pro-caspase-3 (cat. no. ab32499; Abcam), anti-Caspase-3 (cat. no. ab2302; Abcam), anti-Wnt3a antibody [EPR21889] (cat. no. ab219412; Abcam), anti-β catenin antibody (IGX4794R-3; cat. no. ab223075; Abcam) and anti-β actin antibody (cat. no. mAbcam 8226; Abcam) at 4°C overnight. After incubation with horseradish-peroxidase-coupled secondary antibodies (1:5,000 dilution; HRP-labeled goat anti-rabbit IgG H+L; cat. no. A0208; Beyotime Institute of Biotechnology) at room temperature for 1 h, the immunoblots were visualized using BeyoECL Plus (cat. no. P0018S; Beyotime Institute of Biotechnology). Densitometry was measured using ImageJ software (version: ImageJ bundled with 64-bit Java 8; National Institutes of Health).

Flow cytometric analysis of Annexin V/propidium iodide (PI) staining

HSC-6 or CAL-27 cells were seeded in 6 well plates (Costar; Corning, Inc.; 150,000 cells/well). When the confluence reached 60–70%, cells were treated with miR-216a-30 inhibitor 1 for 24 h in the cell culture incubator (37°C, 5% CO2). After the treatment, cells were harvested with trypsin/EDTA and stained for 15 min at room temperature using FITC Annexin V apoptosis Detection kit I (cat. no. 556547; BD Pharmingen). Results were analyzed by a FACSCanto II (BD Biosciences). As illustrated in the Results section below, PI+ Quadrants Q1 and Q2 respectively represent necrosis and late-stage apoptosis/secondary necrosis; Quadrant Q4 represents viability (AnnV−/PI−) and Quadrant Q3 (AnnV+/PI−) represents early-stage apoptosis.

RNA isolation and reverse transcription-quantitative (RT-q)PCR

TRIzol (Beyotime Institute of Biotechnology) was used for total RNA isolation from both cell lines (seeded on 96-well plates, seeding density of 6,000 cells per well) following the manufacturer's protocol. The BeyoRT First Strand cDNA Synthesis kit (cat. no. D7166; Beyotime Institute of Biotechnology) was used for cDNA synthesis from total RNA. RT-qPCR was performed using BeyoFast SYBR Green qPCR Mix (2X; cat. no. D7260-25 ml; Beyotime Institute of Biotechnology) on a 7500 Fast Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was performed at 50°C for 2 min and 95°C for 2 min, followed by 40 cycles at 95°C for 15 sec, 60°C for 1 min and extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. GAPDH was used as an internal control. The relative gene expression levels were calculated using the 2−ΔΔCq method (15). Primers used in the study are listed in Table I. This experiment was repeated three times.

Table I.

Primers of reverse transcription-quantitative PCR used in the present study.

Table I.

Primers of reverse transcription-quantitative PCR used in the present study.

GenePrimerSequenceProduct length (nt)
Caspase 3Sense TGAGGCGGTTGTAGAAGAGTTTCG153
Anti-sense TTATTAACGAAAACCAGAGCGCC
Wnt3ASense ATAGGCTCCTTCCTGTGGGT188
Anti-sense GAACCTTACAGGGGGTTGGG
β-cateninSense CTGAGGAGCAGCTTCAGTCC161
Anti-sense CCATCAAATCAGCTTGAGTAGCC
miR-216Sense CTCAGCTGGCAACTGTG
Anti-sense GAACATGTCTGCGTATCTC
GAPDHSense AATGGGCAGCCGTTAGGAAA168
Anti-sense GCGCCCAATACGACCAAATC

[i] miR, microRNA.

Small interfering (si)RNA-based knockdown assay

Gene knockdown was performed using the siRNA approach. The sequence of siRNAs against mTOR was designed using siRNA-Target-Finder (GeneScript), followed by being synthesized and purchased from Synbio Technologies. The sequence of the empty vector siRNA-negative control (NC) was as 5′-UUCUCCGAACGUGUCACGU-3′, that of siRNA-WNT3a was 5′-GCTTCTGCAGGAACTACGTGGAGAT-3′ and the sequence of siRNA-β-catenin was 5′-CAGTTATGGTCCATCAGCTTTCTAA-3′. The sequences of Wnt3a and β-catenin primers, respectively, were as follows: Forward, 5′-AAGACATGCTGGTGGTCGCAA-3′ and reverse, 5′-AACCGCCACAACAACGAGGCT-3′; and forward, 5′-AAGTAGCTGATATTGATGGAC-3′ and reverse, 5′-AAGCTCATCATACTGGCTAGT-3′.

The siRNAs (non-targeting Control siRNA and target siRNA) were transiently transfected into the HSC-6 and CAL-27 cell lines and 3D spheroids using FuGENE HD Transfection Reagent (cat. no. E2311; Promega Corporation) according to the manufacturer's instructions in the cell culture incubator (37°C, 5% CO2). The time of transfection of siRNA was 24 h before the subsequent experiments. The knockdown efficiency was evaluated using RT-qPCR and western blot assay following protocols described in this study.

Immunohistochemistry (IHC)

The β-catenin protein expression levels in paraffin-embedded hepatocellular carcinoma tissues were examined by IHC as described previously (16). Briefly, IHC was performed on 4-µm sections. Following deparaffinization and rehydration, the endogenous peroxidase activity was blocked using 3% H2O2 (reagent A; UltraSensitive SP IHC kit; Maxim Biotech Inc.). Next, antigen retrieval was performed and normal serum (reagent B; UltraSensitive SP IHC kit; Maxim Biotech Inc.) was applied to the sections to block non-specific binding. Sections were then incubated at 4°C overnight with the primary antibodies, including an anti-β-catenin antibody (E247)-ChIP grade (1:300 dilution; cat. no. ab32572; Abcam). Subsequently, the sections were incubated with the secondary antibody (reagent C; UltraSensitive SP IHC kit; Maxim Biotech Inc.) for 15 min, followed by incubation with streptavidin-peroxidase (reagent D, UltraSensitive SP IHC kit; Maxim Biotech Inc.) and 3,3-diaminobenzidine (DAB) was used to stain the sections for 30 sec at room temperature. Finally, sections were counterstained with hematoxylin for 5 min at room temperature and mounted. Sections of oral cancer tissue showing strong staining with the respective proteins during antibody optimization served as the positive controls.

Measurement of cytotoxicity using Cell Counting Kit-8 (CCK8) assay

The Cell Counting Kit-8 (cat no. C0037; Beyotime Institute of Biotechnology) was used to measure cytotoxicity of both cell lines, according to the manufacturer's instructions. Briefly, the HSC-6 cell line and CAL-27 cell line were seeded into 96-well plates at a cell density of 5×104/ml) overnight. After 24 h, the cell culture medium was replaced by indicated concentrations of chemicals and the treatment was continued for 48 h. CCK8 solution (0.5 mg/ml; 100 µl) was added into each well and incubated for 3 h at 37°C, followed by detection of optical density (OD) values at 450 nm using an Infinite M200 PRO Multimode Microplate Reader (Tecan Group, Ltd.). The percentage of live cells was calculated relative to the control.

Target genes of miRNA analysis using TargetScan

Target genes of miRNA analysis were evaluated using an online bioinformatics tool, i.e. TargetScan (https://www.targetscan.org/vert_80/).

Statistical analysis

All data were presented as mean ± standard error of the mean. One-way ANOVA and Tukey's post-hoc test were used for statistical analysis of continuous variables and categorical variables were analyzed by Fisher's exact tests. Correlation analysis (Pearson) and statistical analysis were performed with GraphPad Prism 5.0 software (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Expression level of miR-216a-3p is higher in oral cancer patients and positively associated with tumor stage

To evaluate the effects of miR-216a-3p on oral cancer, the expression level of miR-216a-3p in oral cancer patients and healthy controls was measured using RT-qPCR. It was found that the expression level of miR-216a-3p in oral cancer patients was much higher than in healthy controls (P<0.0001; Fig. 1A). Of note, the expression level of miR-216a-3p was positively correlated with the oral cancer stage (correlation coefficient R=0.5969, P=0.0005; Fig. 1B). No significant difference was found between healthy and oral cancer patients regarding expression level of RNU-6 (Fig. 1C). Furthermore, the association between the expression level of miR-216a-3p and clinicopathological factors, including sex, age and smoking status, was examined using Fisher's exact tests (Table II). It was found that the expression level of miR-216a-3p was significantly associated with sex (P=0.0494) and oral cancer stage (P=0.0028) and two complications, including difficulty swallowing (P=0.0494) and speech problems (P=0.0608). However, the expression level of miR-216a-3p had no significant correlation with the smoking status and free bleeding in the mouth.

Figure 1.

Expression level of miR-216a-3p is higher in oral cancer patients and positively correlated to tumor stages. (A) Expression level of miR-216a-3p in oral cancer patients was much higher than in healthy controls. (B) Expression level of miR-216a-3p was positively correlated with oral cancer stage (correlation coefficient R=0.5969; P=0.0005). (C) No significant difference was found between healthy controls and patients with oral cancer regarding the expression level of RNU-6. ****P<0.0001. miR, microRNA.

Table II.

Association of the expression level of miR-216a-3p and clinicopathological factors including sex, age and smoking status using Fisher's exact test.

Table II.

Association of the expression level of miR-216a-3p and clinicopathological factors including sex, age and smoking status using Fisher's exact test.

Variablen=30Expression level of miR-216a-3p (fold)P-value
Sex 0.0494
  Male200.022323192
  Female100.027622647
Oral cancer stage 0.0028
  I100.021805101
  II170.020385862
  III30.058574635
Age, years 0.1429
  <5020.01580415
  50-60150.027476579
  >60130.025532913
Smoking status 0.5100
  Yes130.021847226
  No170.031098617
Complications
  Difficulty swallowing 0.0002
  (Dysphagia)
  Yes80.042074396
  No220.019958622
Speech problems 0.0608
  Yes100.028519873
  No200.024314014
Free bleeding in the mouth 0.3981
  Yes150.030593512
  No150.021118813

[i] miR, microRNA.

Inhibition of miR-216a-3p potently suppresses cell viability and induces apoptosis of oral cancer cells

To further investigate the effects of miR-216a-3p on oral cancer, inhibitors of miR-216a-3p were used. It was found that two miR-216a-3p inhibitors (cat. no. miR2150818102526-1-5; Guangzhou RiboBio Co., Ltd.) could significantly inhibit miR-216a-3p level on HSC-6 cells (P<0.01; Fig. 2A). Moreover, it was found that two miR-216a-3p inhibitors could significantly increase expression levels of apoptosis marker caspase3 in the HSC-6 cells (P<0.05; Fig. 2B). It was also found that the two miR-216a-3p inhibitors could significantly increase the protein level of apoptosis marker cleaved caspase3 in HSC-6 cells and decrease the protein level of pro-caspase 3 in HSC-6 cells (Fig. 2C). The two miR-216a-3p inhibitors could significantly decrease cell viability of HSC-6 cells (P<0.001; Fig. 2D). Apoptosis was also evaluated using flow cytometry, which indicated that miR-216a-3p inhibitor increased apoptosis in HSC-6 cells (Fig. 2E). Similarly, it was found that the two miR-216a-3p inhibitors significantly inhibited miR-216a-3p level on CAL-27 cells (P<0.01; Fig. 2F). It was found that the two miR-216a-3p inhibitors could significantly increase expression level of apoptosis marker caspase3 in CAL-27 cells (P<0.05; Fig. 2G); the two miR-216a-3p inhibitors could significantly increase the protein level of apoptosis marker cleaved caspase3 and decrease the protein level of pro-caspase 3 in CAL-27 cells (Fig. 2H); the two miR-216a-3p inhibitors could significantly decrease the cell viability of CAL-27 cells (P<0.001; Fig. 2I). Apoptosis was also evaluated using flow cytometry and indicated that miR-216a-3p inhibitor increased apoptosis in CAL-27 cells (Fig. 2J). Thus, inhibition of miR-216a-3p potently suppressed cell viability and induced apoptosis of oral cancer cells.

Figure 2.

Inhibition of miR-216a-3p potently suppresses cell viability and induces apoptosis of oral cancer cells. (A) Two miR-216a-3p inhibitors significantly inhibited miR-216a-3p level in HSC-6 cells. (B) Two miR-216a-3p inhibitors significantly increased expression level of apoptosis marker caspase3 in the HSC-6 cell line. (C) miR-216a-3p inhibitors significantly increased the protein level of apoptosis marker cleaved caspase 3 in HSC-6 cells and decreased the protein level of pro-caspase 3 in HSC-6 cells. (D) miR-216a-3p inhibitors significantly decreased cell viability of cells of the HSC-6 cell line. (E) Following incubation with miR-216a-3p inhibitor 1, HSC-6 cells were stained with Annexin V-FITC and propidium iodide before fluorescence analysis by flow cytometry. The percentage of cells in the four different quadrants was calculated and the results present in different histograms where viable cells are Annexin V-/PI-, apoptotic cells Annexin V+/PI- and necrotic cells are PI+. miR-216a-3p inhibitor 1 significantly increased apoptosis in HSC-6 cells. (F) miR-216a-3p inhibitors significantly inhibited miR-216a-3p levels in CAL-27 cells. (G) miR-216a-3p inhibitors could significantly increase the expression level of apoptosis marker caspase 3 in the CAL-27 cell line. (H) miR-216a-3p inhibitors could significantly increase the protein level of apoptosis marker caspase 3 in the CAL-27 cell line. (I) miR-216a-3p inhibitors could significantly decrease the viability of cells of the CAL-27 cell line. (J) Following incubation with miR-216a-3p inhibitor 1, CAL-27 cells were stained with Annexin V-FITC and PI before fluorescence analysis by flow cytometry. The percentage of cells in the four different quadrants was calculated and the results present in different histograms where viable cells are Annexin V−/PI−, apoptotic cells Annexin V+/PI− and necrotic cells are PI+. miR-216a-3p inhibitor 1 significantly increased apoptosis in CAL-27 cells. *P<0.05; **P<0.01; ***P<0.001 vs. control. miR, microRNA; PI, propidium iodide.

Effects of miR-216a-3p on oral cancer through Wnt3a

To evaluate the mechanism of action of miR-216a-3p on oral cancer, an in silico method of TargetScan (https://www.targetscan.org/vert_80/) was used to analyze the target gene of miR-216a-3p, which showed that Wnt3a was a target gene of miR-216a-3p (Fig. 3A). To investigate effects of Wnt3a on oral cancer, two siRNAs against Wnt3a were used to knockdown the gene and it was found that siRNAs could successfully inhibit mRNA level of Wnt3a in HSC-6 cell line (P<0.05; P<0.01; Fig. 3B). siRNAs could successfully inhibit the protein level of Wnt3a in HSC-6 cell line (Fig. 3C). Wnt3a knockdown attenuated induction of miR-216a-3p inhibitors on apoptosis of oral cancer cells in the HSC-6 cell line (P<0.05; P<0.01; Fig. 3D). It was also found that Wnt3a knockdown attenuated the inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in HSC-6 cells (P<0.01; Fig. 3E). The two Wnt3a siRNAs successfully inhibited the mRNA level of Wnt3a in the CAL-27 cell line (P<0.05; Fig. 3F). siRNAs could successfully inhibit the protein level of Wnt3a in CAL-27 cells (Fig. 3G). Wnt3a knockdown attenuated induction of miR-216a-3p inhibitors on apoptosis of oral cancer cells in CAL-27 cells (P<0.05; P<0.01; Fig. 3H). Further, Wnt3a knockdown attenuated the inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in CAL-27 cells (P<0.01; Fig. 3I). While miR126 does not affect mRNA expression of WNT3a in both HSC-6 (Fig. S1A) and CAL-27 cells (Fig. S1B), knockdown of WNT3a significantly inhibits cell viability of HSC-6 cells (Fig. S1C) and CAL-27 cells (Fig. S1D), thus, the effects of miR-216a-3p on oral cancer was through Wnt3a.

Figure 3.

Effects of miR-216a-3p on oral cancer via Wnt3a. (A) Wnt3a was a target gene of miR-216a-3p as verified with the in silico method of TargetScan (https://www.targetscan.org/vert_80/). (B) siRNAs could successfully inhibit mRNA level of Wnt3a in the HSC-6 cell line. (C) siRNAs could successfully inhibit protein levels of Wnt3a in the HSC-6 cell line; (D) Wnt3a knockdown attenuated induction of miR-216a-3p inhibitors on apoptosis of oral cancer cells in the HSC-6 cell line. (E) Wnt3a knockdown attenuated inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the HSC-6 cell line. (F) Wnt3a siRNAs successfully inhibited mRNA level of Wnt3a in CAL-27 cell line. (G) siRNAs could successfully inhibit protein level of Wnt3a in the CAL-27 cell line. (H) Wnt3a knockdown attenuated induction of miR-216a-3p inhibitors on apoptosis of oral cancer cells in the CAL-27 cell line. (I) Wnt3a knockdown attenuated inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the CAL-27 cell line *P<0.05; **P<0.01; ***P<0.001 vs. CTR. miR, microRNA; si, small interfering; CTR, control.

Expression level of β-catenin is higher in oral cancer patients and positively correlated with tumor stage

The present study measured the expression level of miR-216a-3p in oral cancer patients and healthy controls using RT-qPCR. The protein level of β-catenin in oral cancer patients was much higher than in healthy controls, as measured using IHC method (Fig. 4A). The mRNA expression level of β-catenin in oral cancer patients was much higher than in healthy controls (P<0.0001; Fig. 4B). Of note, it was found that the expression level of β-catenin positively correlated with oral cancer stage (correlation coefficient R=0.3552, P=0.045; Fig. 4C).

Figure 4.

Expression of β-catenin is higher in patients with oral cancer and positively correlated with the tumor stages. (A) Protein level of β-catenin in oral cancer patients was much higher than in healthy controls measured using immunohistochemistry. Scale bar, 50 µm. (B) mRNA expression level of β-catenin in oral cancer patients was higher than in healthy controls (****P<0.0001). (C) Expression level of β-catenin was positively correlated to oral cancer stages (correlation coefficient R=0.3552, P=0.045).

Effects of miR-216a-3p on oral cancer through β-catenin

To further investigate the effects of β-catenin on oral cancer, siRNAs against β-catenin were used and it was found that siRNAs could successfully inhibit mRNA level of β-catenin in the HSC-6 cell line (P<0.05; P<0.01; Fig. 5A). siRNAs could successfully inhibit the protein level of β-catenin in HSC-6 cells (Fig. 5B). β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on mRNA level of caspase3 in HSC-6 cells (*P<0.05; Fig. 5C). β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on the protein level of cleaved caspase3 in HSC-6 cells and decrease the protein level of pro-caspase 3 in HSC-6 cells (Fig. 5D). Moreover, β-catenin knockdown attenuated the inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the HSC-6 cell line (P<0.01; Fig. 5E). The two β-catenin siRNAs successfully inhibited the mRNA level of β-catenin in the CAL-27 cell line (P<0.01; Fig. 5F). Two β-catenin siRNAs successfully inhibited the protein level of β-catenin in CAL-27 cells (Fig. 5G). β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on mRNA level of caspase3 in CAL-27 cells (P<0.01; Fig. 5H). β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on protein level of cleaved caspase3 and decrease the protein level of pro-caspase 3 in CAL-27 cells (Fig. 5I). Furthermore, β-catenin knockdown attenuated the inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the CAL-27 cell line (P<0.05; P<0.01; Fig. 5J), while miR-126 does not affect mRNA expression of β-catenin in HSC-6 cells (Fig. S1E) and CAL-27 cells (Fig. S1F).

Figure 5.

Effects of miR-216a-3p on oral cancer through β-catenin. (A) siRNAs successfully reduced the mRNA levels of β-catenin in the HSC-6 cell line. (B) siRNAs successfully reduced the protein levels of β-catenin in the HSC-6 cell line. (C) β-catenin knockdown attenuated the inhibitory effects of miR-216a-3p inhibitors on the increase of caspase 3 mRNA levels in the HSC-6 cell line. (D) β-catenin knockdown attenuated inhibitory effects of miR-216a-3p inhibitors on the increase of caspase3 protein levels in the HSC-6 cell line. (E) β-catenin knockdown attenuated inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the HSC-6 cell line. (F) β-catenin siRNAs successfully reduced the mRNA levels of β-catenin in the CAL-27 cell line. (G) β-catenin siRNAs successfully reduced the protein levels of β-catenin in CAL-27 cell line. (H) β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on increase of caspase3 mRNA level in CAL-27 cell line. (I) β-catenin knockdown attenuated induction of miR-216a-3p inhibitors on increase of caspase3 protein level in the CAL-27 cell line. (J) β-catenin knockdown attenuated inhibitory effects of miR-216a-3p inhibitors on cell viability of oral cancer cells in the CAL-27 cell line. *P<0.05; **P<0.01 vs. CTR. miR, microRNA; si, small interfering; CTR, control.

Discussion

Oral cancer is a severe public health concern and is widespread in a number of countries, especially developing countries (17). More efforts are needed to uncover the underlying pathogenesis and develop novel drugs for treatment. miRNAs are considered important targets for developing anti-cancer drugs. The Wnt signaling pathway serves an important role in activities of cancer stem cells (18). In the present study, two oral cancer lines, iHSC-6 and CAL-27, were used. Effects of miR-216a-3p on oral cancer and the corresponding mechanism were investigated.

As small single-stranded non-coding RNA molecules, miRNAs have been confirmed to exert various functions such as cell growth, apoptosis, development, differentiation and inflammation, via RNA silencing and post-transcriptional regulation of gene expression (19). An increasing number of studies have confirmed that miRNAs are essential to regulate the activities of a variety of tumors. Terkelsen et al (20) found that miR-146a and miR-494 are richly expressed in the tumor interstitial fluid of breast cancer patients and several miRNAs are associated with tumor grade. In another study, authors found that 8 of the 10 miRNAs (miR-139-5p, miR-10b-5p, miR-486-5p, miR-455-3p, miR-107, miR-146b-5p, miR-324-5p and miR-20a-5p) are highly correlated with prognosis of breast cancer (21). Grzelczyk et al (22) found that the levels of serum expression of miR-31, miR-141, miR-149a, miR-182, LET-7a, miR-4853p, miR-122 and miR-33 are upregulated, which might be used to diagnose laryngeal squamous cell carcinoma with high sensitivity and specificity. For oral cancer, Li et al (23) found that miR-34a-5p binds to its direct downstream target AXL to suppress oral squamous cell carcinoma cell proliferation and metastasis. Cai et al (24) found that exosome-enclosed miR-29a-3p promotes tumor growth in nude mice with xenograft of oral squamous cell carcinoma. Similarly, the present study found that the expression level of miR-216a-3p was much higher in oral cancer patients than healthy controls and positively correlated with tumor grades. Thus, it appears that miR-216a-3p is a potential biomarker for oral cancer. Notably, it was also found that inhibition of miR-216a-3p potently inhibited cell viability and induced apoptosis in oral cancer cell lines. The results showed the important role of miR-216a-3p in oral cancer.

The Wnt signaling pathway is one of important pathways controlling various biological activities (17). In cancer studies, accumulating evidence has indicated that Wnt signaling serves an important role in regulating cancer activities. In colorectal cancer (CRC) with mutations of activated KRAS and SLC25A22, which indicates increased DNA methylation, activation of Wnt signaling to β-catenin increased expression of LGR5, proliferation, stem cell features and resistance to 5-fluorouracil (25). In hepatocellular carcinoma, it was found that activation of autophagy can induce MCT1 expression by activating Wnt/β-catenin signaling to promote metastasis and glycolysis (26). Regarding breast carcinomas, it was found that increased relative mRNA expression levels of Wnt3 were found in 54% cases (27). Deng et al (28) found that activation of Wnt signaling can facilitate pancreatic cancer progression. The present study found that Wnt was the target gene of miR-216a-3p. More importantly, it was found that the effects of miR-216a-3p on oral cancer were via Wnt3a. Li et al (29) found that serum β-catenin levels in the CRP and CRC patients are significantly higher compared with those in the healthy control group. Xu et al (30) found that β-catenin expression is higher in hepatocellular carcinoma patients compared with that in healthy controls and increased β-catenin expression is closely correlated with tumor differentiation, tumor size, serum α-fetoprotein level and transarterial chemoembolization treatment frequency. The present study found that the expression level of β-catenin was much higher in oral cancer patients compared with in healthy controls and positively correlated with tumor stages. The effect of miR-216a-3p on oral cancer was via β-catenin. Therefore, the Wnt-β-catenin signaling pathway probably serves an important role in oral cancer.

In conclusion, the present study demonstrated that the expression level of miR-216a-3p was higher in oral cancer patients compared with healthy controls and positively correlated with tumor stage. Inhibition of miR-216a-3p could potently inhibit the growth of oral cancer cells and this effect was through the Wnt-β-catenin signaling pathway. β-Catenin expression level was higher in oral cancer patients compared with healthy controls and positively correlated with tumor stage. Therefore, miR-216a-3p and Wnt-β-catenin signaling pathway might be appealing candidates for the development of effective therapies for oral cancers. It is considered that the findings of the present study will provide useful insights for developing novel therapies of oral cancer.

Supplementary Material

Supporting Data
Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was supported by Medical Science Research Project of Hebei Provincial Healthcare Commission (grant no. 20221256).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YW, SL, YD, YQ, FL, WZ and WW performed the experiments. WZ and WW designed the research. YW and SL wrote the manuscript and YD and YQ supervised the project. YW and YQ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All procedures performed involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Approval was obtained from the ethical board of The Fourth Hospital of Hebei Medical University (approval no. 2022KY392). Informed consent was obtained from all volunteers.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Montero PH and Patel SG: Cancer of the oral cavity. Surg Oncol Clin N Am. 24:491–508. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Neville BW and Day TA: Oral cancer and precancerous lesions. CA Cancer J Clin. 52:195–215. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Wu M, Wang G, Tian W, Deng Y and Xu Y: MiRNA-based therapeutics for lung cancer. Curr Pharm Des. 23:5989–5996. 2018. View Article : Google Scholar : PubMed/NCBI

4 

You F, Li J, Zhang P, Zhang H and Cao X: miR106a promotes the growth of transplanted breast cancer and decreases the sensitivity of transplanted tumors to cisplatin. Cancer Manag Res. 12:233–246. 2020. View Article : Google Scholar : PubMed/NCBI

5 

Alhasan L: MiR-126 modulates angiogenesis in breast cancer by targeting VEGF-A-mRNA. Asian Pac J Cancer Prev. 20:193–197. 2019. View Article : Google Scholar : PubMed/NCBI

6 

Akbarzadeh M, Mihanfar A, Akbarzadeh S, Yousefi B and Majidinia M: Crosstalk between miRNA and PI3K/AKT/mTOR signaling pathway in cancer. Life Sci. 285:1199842021. View Article : Google Scholar : PubMed/NCBI

7 

Majidinia M, Darband SG, Kaviani M, Nabavi SM, Jahanban-Esfahlan R and Yousefi B: Cross-regulation between Notch signaling pathway and miRNA machinery in cancer. DNA Repair (Amst). 66–67. 30–41. 2018.PubMed/NCBI

8 

Gajos-Michniewicz A and Czyz M: WNT signaling in melanoma. Int J Mol Sci. 21:48522020. View Article : Google Scholar : PubMed/NCBI

9 

Polakis P: WNT signaling in cancer. Cold Spring Harb Perspect Biol. 4:a0080522012. View Article : Google Scholar : PubMed/NCBI

10 

Bhattacharya M, Sharma AR, Sharma G, Patra BC, Lee SS and Chakraborty C: Interaction between miRNAs and signaling cascades of Wnt pathway in chronic lymphocytic leukemia. J Cell Biochem. 121:4654–4666. 2020. View Article : Google Scholar : PubMed/NCBI

11 

Wang H, Zhang M, Wei T, Zhou J, Zhang Y and Guo D: Long non-coding RNA SNHG1 mediates neuronal damage in Parkinson's disease model cells by regulating miR-216a-3p/Bcl-2-associated X protein. Ann Transl Med. 9:8512021. View Article : Google Scholar : PubMed/NCBI

12 

Chang L and Kan L: Mesenchymal stem cell-originated exosomal circular RNA circFBXW7 attenuates cell proliferation, migration and inflammation of fibroblast-like synoviocytes by targeting miR-216a-3p/HDAC4 in rheumatoid arthritis. J Inflamm Res. 14:6157–6171. 2021. View Article : Google Scholar : PubMed/NCBI

13 

Zhao J, Li L and Yang T: MiR-216a-3p suppresses the proliferation and invasion of cervical cancer through downregulation of ACTL6A-mediated YAP signaling. J Cell Physiol. 235:9718–9728. 2020. View Article : Google Scholar : PubMed/NCBI

14 

Wang D, Li Y, Zhang C, Li X and Yu J: MiR-216a-3p inhibits colorectal cancer cell proliferation through direct targeting COX-2 and ALOX5. J Cell Biochem. 119:1755–1766. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Yin Y, Bijvelds M, Dang W, Xu L, van der Eijk AA, Knipping K, Tuysuz N, Dekkers JF, Wang Y, de Jonge J, et al: Modeling rotavirus infection and antiviral therapy using primary intestinal organoids. Antiviral Res. 123:120–131. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Warnakulasuriya S: Global epidemiology of oral and oropharyngeal cancer. Oral Oncol. 45:309–316. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Zhan T, Rindtorff N and Boutros M: Wnt signaling in cancer. Oncogene. 36:1461–1473. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Divisato G, Piscitelli S, Elia M, Cascone E and Parisi S: MicroRNAs and stem-like properties: The complex regulation underlying stemness maintenance and cancer development. Biomolecules. 11:10742021. View Article : Google Scholar : PubMed/NCBI

20 

Terkelsen T, Russo F, Gromov P, Haakensen VD, Brunak S, Gromova I, Krogh A and Papaleo E: Secreted breast tumor interstitial fluid microRNAs and their target genes are associated with triple-negative breast cancer, tumor grade, and immune infiltration. Breast Cancer Res. 22:732020. View Article : Google Scholar : PubMed/NCBI

21 

Hong HC, Chuang CH, Huang WC, Weng SL, Chen CH, Chang KH, Liao KW and Huang HD: A panel of eight microRNAs is a good predictive parameter for triple-negative breast cancer relapse. Theranostics. 10:8771–8789. 2020. View Article : Google Scholar : PubMed/NCBI

22 

Grzelczyk WL, Szemraj J, Kwiatkowska S and Józefowicz-Korczyńska M: Serum expression of selected miRNAs in patients with laryngeal squamous cell carcinoma (LSCC). Diagn Pathol. 14:492019. View Article : Google Scholar : PubMed/NCBI

23 

Li YY, Tao YW, Gao S, Li P, Zheng JM, Zhang SE, Liang J and Zhang Y: Cancer-associated fibroblasts contribute to oral cancer cells proliferation and metastasis via exosome-mediated paracrine miR-34a-5p. EBioMedicine. 36:209–220. 2018. View Article : Google Scholar : PubMed/NCBI

24 

Cai J, Qiao B, Gao N, Lin N and He W: Oral squamous cell carcinoma-derived exosomes promote M2 subtype macrophage polarization mediated by exosome-enclosed miR-29a-3p. Am J Physiol Cell Physiol. 316:C731–C740. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Wong CC, Xu J, Bian X, Wu JL, Kang W, Qian Y, Li W, Chen H, Gou H, Liu D, et al: In colorectal cancer cells with mutant KRAS, SLC25A22-mediated glutaminolysis reduces DNA demethylation to increase WNT signaling, stemness, and drug resistance. Gastroenterology. 159:2163–2180.e6. 2020. View Article : Google Scholar : PubMed/NCBI

26 

Fan Q, Yang L, Zhang X, Ma Y, Li Y, Dong L, Zong Z, Hua X, Su D, Li H and Liu J: Autophagy promotes metastasis and glycolysis by upregulating MCT1 expression and Wnt/β-catenin signaling pathway activation in hepatocellular carcinoma cells. J Exp Clin Cancer Res. 37:92018. View Article : Google Scholar : PubMed/NCBI

27 

Michelli M, Zougros A, Chatziandreou I, Michalopoulos NV, Lazaris AC and Saetta AA: Concurrent Wnt pathway component expression in breast and colorectal cancer. Pathol Res Pract. 216:1530052020. View Article : Google Scholar : PubMed/NCBI

28 

Deng J, Zhang J, Ye Y, Liu K, Zeng L, Huang J, Pan L, Li M, Bai R, Zhuang L, et al: N6-methyladenosine-mediated upregulation of WTAPP1 promotes WTAP translation and Wnt signaling to facilitate pancreatic cancer progression. Cancer Res. 81:5268–5283. 2021. View Article : Google Scholar : PubMed/NCBI

29 

Li S, Huang M, Liu Q, Wang D, Wu R, Zhang X, Chen W and Duan L: Serum expression of β-catenin is a potential detection marker in patients with colorectal cancer. Dis Markers. 2019:50705242019. View Article : Google Scholar : PubMed/NCBI

30 

Xu X, Gao D, Yuan X, Liu LI, Zhang X, Liang X, Chen S, Ai M, Chen BO, Shi D, et al: β-Catenin expression correlates with prognosis in hepatocellular carcinoma patients treated with transcatheter arterial chemoembolization. Anticancer Res. 39:1129–1134. 2019. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Liu S, Lv F, Zhai W, Wang W, Duan Y and Qiu Y: hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway. Mol Med Rep 27: 128, 2023.
APA
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., & Qiu, Y. (2023). hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway. Molecular Medicine Reports, 27, 128. https://doi.org/10.3892/mmr.2023.13015
MLA
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., Qiu, Y."hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway". Molecular Medicine Reports 27.6 (2023): 128.
Chicago
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., Qiu, Y."hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway". Molecular Medicine Reports 27, no. 6 (2023): 128. https://doi.org/10.3892/mmr.2023.13015
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Liu S, Lv F, Zhai W, Wang W, Duan Y and Qiu Y: hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway. Mol Med Rep 27: 128, 2023.
APA
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., & Qiu, Y. (2023). hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway. Molecular Medicine Reports, 27, 128. https://doi.org/10.3892/mmr.2023.13015
MLA
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., Qiu, Y."hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway". Molecular Medicine Reports 27.6 (2023): 128.
Chicago
Wang, Y., Liu, S., Lv, F., Zhai, W., Wang, W., Duan, Y., Qiu, Y."hsa‑miR‑216a‑3p regulates cell proliferation in oral cancer via the Wnt3a/β‑catenin pathway". Molecular Medicine Reports 27, no. 6 (2023): 128. https://doi.org/10.3892/mmr.2023.13015
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team