This article is mentioned in:

Introduction

Bone is one of the few tissues that heals without forming a fibrous scar (1). The term ‘bone fracture’ is used to describe the destruction of bone continuity or breakdown of the bone structural integrity (2). Bone heals over a period of time (1); however, open fractures are vulnerable to complications, such as malunion, delayed union, non-union and refracture (3,4). In total, ~5–10% of fractures will show delayed healing (5). At present, the incidence of traumatic fracture continues to increase, current estimates for traumatic fractures are 23.3% for men and 11.2% for women (6), and this markedly affects the quality of life of patients (7,8). Fracture healing is a dynamic process. The initial stage includes the hematoma, which generates an inflammatory environment. Next, endochondral ossification, removal and calcification of the endochondral cartilage indicate the fracture healing has reached the middle to late stage (9). Then, the chronic remodeling concludes the healing process (9).

The ubiquitin-proteasome system is a major pathway of protein post-translational modification, mediated by E1, E2 and E3 ubiquitin ligases, in addition to deubiquitinating enzymes (10). Ubiquitination is a reversible process; whereby deubiquitinating enzymes remove ubiquitin from poly-ubiquitin chains and targeted proteins (11). Otubain (OTUB)2 is a member of the OTUB superfamily of deubiquitinylases that inhibits the ubiquitination of substrates and enhance protein stability (12,13). Dysregulation of the OTUB protein family may lead to bone dysplasia (13). Stanišić et al (14) reported that OTUB1 weakens the stability of estrogen receptor α (14), which serves an essential role in skeletal formation (15). Thus, OTUB proteins may act as a vital part in the pathophysiology of bone development and homeostasis, which refers to the balance between osteoblast-mediated bone formation and osteoclast-mediated bone resorption (16). Results of the previous study revealed that osteoblast activity and osteogenesis were enhanced during fracture healing. In addition, osteoclast function and bone resorption were reduced, promoting the formation of an external callus used to stabilize bone fragments (17). Li et al (18) reported that OTUB2 knockdown reverses Shh- or Smo-induced upregulation of runt related transcription factor 2 (RUNX2), bone morphogenetic protein 2 and tissue nonspecific alkaline phosphatase (TNAP), key regulators of bone formation (18). Thus, OTUB2 may exhibit potential in osteogenesis and bone fracture healing (18). Results of a previous study demonstrate that fracture healing may also be mediated by the ubiquitination of genes associated with osteogenesis (19).

The present study aimed to investigate the effects of OTUB2 on bone fracture healing both in vivo and in vitro. A model of open fracture was established in the femora of Sprague Dawley rats, as previously described (4). Notably, bone callus formation requires the osteoblastic differentiation of bone marrow mesenchymal stem cells (BMSCs) (20,21) and previous studies demonstrate that this differentiation promotes bone fracture healing (22,23). Thus, BMSCs were obtained from the rat marrow cavity of femurs and tibiae and subsequently subjected to osteogenic differentiation in vitro (24). The functions of OTUB2 in bone fracture healing, histological damage, bone formation and mineralization were further explored.

Materials and methods

Animal experiments

Animal experiments were approved by the Laboratory Animal Ethical and Welfare Committee of Hebei Medical University (Hebei, China; approval no. IACUC-Hebmu-2021007), following The Guideline for the Care and Use of Laboratory Animals (25).

Bioinformatics analysis

Proteins that interact with OTUB2 were analyzed using the STRING database (https://cn.string-db.org/). Gene Ontology (GO) enrichment analysis of proteins that interacted with OTUB2 was carried out using the DAVID database (https://david.ncifcrf.gov/home.jsp).

Lentivirus preparation and infection

A 2nd generation lentiviral vector system was used. For OTUB2 overexpression, OTUB2 cDNA was amplified and subcloned into the lentivirus vector (LV), pLVX–IRES-Puro (Unibio) and referred to as LV-OTUB2. pLVX–IRES-Puro with no cDNA insertion was used as the negative control (NC) for LV-OTUB2 and referred to as LV-NC. For TNF-receptor associated factor 3 (TRAF3) knockdown, TRAF3 short hairpin RNA (shRNA) was synthetized and subcloned into pLVX-shRNA1 (Unibio). shNC, a non-targeting shRNA, was subcloned into pLVX-shRNA1 and used as the NC for LV-shTRAF3. Subsequently, pLVX-OTUB2/pLVX-shTRAF3/NC, pSPAX2 and pMD2.G vectors were mixed at a ratio of 4:3:1 (14.0:10.5:3.5 µg in a 10 cm culture flask) and transfected into 293T cells (iCell Bioscience). Following transfection, recombinant virus-containing supernatants were collected and filtered using a 0.45-µm membrane. In the logarithmic phase of growth (multiplicity of infection, 20) BMSCs were infected with LV-NC, LV-OTUB2, LV-shNC or LV-shTRAF3, as previously described (26). Sequences of shTRAF3 and shNC were as follows: shTRAF3, 5′-ccgCGAAGACAGTGGAGGACAAGTttcaagagaACTTGTCCTCCACTGTCTTCGttttt-3′; and shNC, 5′-ccgTTCTCCGAACGTGTCACGTttcaagagaACGTGACACGTTCGGAGAAttttt-3′. Cells were further subjected to the osteogenic differentiation at 72 h post-transfection.

Fracture model

Male Sprague Dawley rats (age, 12 weeks; weight, 410±10 g) were obtained from Liaoning Changsheng Biotechnology. Rats were housed with food and water ad libitum in a humidity (50±10%) and temperature-controlled (22±1°C) environment for a week of acclimation under a 12/12 h light/dark cycle. The fracture model was established as previously described (4), Briefly, animals were subjected to inhalation of isoflurane for anesthesia, using an induction rate of 5% and a maintenance rate of 2%, as previously described (27). An incision was made on the middle lateral thigh of rats, followed by the blunt dissection of muscle around the femur. The femur was cut and a sterile Kirschner wire was inserted to stabilize the fracture. Subsequently, rats were randomly divided into three groups: i) Control; ii) LV-NC; and iii) LV-OTUB2. Rats in the LV-NC and LV-OTUB2 groups were injected with 1×108 transducing units/ml (50 µl/injection) of LV-NC or LV-OTUB2 at the fracture site and this was repeated once a week for 2, 4 or 8 weeks. Fractures of rats in the control group were left untreated. Rats were sacrificed with 70% vol/min CO2 at each time point unless they met a prior humane endpoint. All animals were evaluated, weighted and scored daily with set criteria as previously described (28,29). Briefly, any finding listed as a humane endpoint, a score of 3 in two or more categories and a total score >9 led to the animal being euthanised. The categories including general appearance, activity, hydration, respiration, ambulation, surgical complications and weight loss. Following euthanasia, cardiac and respiratory arrest, as well as fixed and dilated pupils were observed in the rats for ~10 min before the animals were confirmed as deceased. A total of 162 rats were used in the present study. Among them, 36 rats [18 rats for western blotting; 18 rats for X-radiography and reverse transcription-quantitative PCR (RT-qPCR); n=6 rats/group] were used at 2 weeks post fracture. A total of 54 rats (18 rats for western blotting; 18 rats for X-radiography and RT-qPCR; 18 rats for pathological staining; n=6 rats/group) were used at 4 weeks post fracture. A total of 72 rats (18 rats for western blotting; 18 rats for X-radiography and RT-qPCR; 18 rats for micro-CT and pathological staining; 18 rats for TNAP activity detection; n=6 rats/group) were used at 8 weeks post fracture.

Reverse transcription-quantitative (RT-q) PCR

Total RNA was extracted from the callus tissue of the femur of rats using TRIpure lysis solution (BioTeke Corporation) according to the manufacturer's protocols. Subsequently, total RNA was reverse transcribed into cDNA using the BeyoRT II kit (Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Briefly, total RNA, oligo (dT), reaction buffer, RNase inhibitor, dNTP Mix and BeyoRT II M-MLV reverse transcriptase were used to form a reaction system. According to the manufacturers' instructions, the system was incubated at 42°C for 50 min, followed by incubation at 80°C for 10 min. Subsequently, cDNA was amplified using 2X Taq PCR MasterMix and SYBR Green PCR Master Mix (Beijing Solarbio Science & Technology Co., Ltd.) in accordance with manufacturer's instructions. The reaction system included 1 µl cDNA, 1 µl primer, 0.3 µl SYBR Green, 10 µl 2X Taq PCR MasterMix and 7.7 µl ddH2O. The thermocycling conditions used were as follows: 94°C for 5 min, followed by 40 cycles of 94°C for 15 sec, 60°C for 25 sec and 72°C for 30 sec. The relative expression of targeted genes was quantified using six independent measurements and the 2−ΔΔCq method (30). β-actin was used as the internal reference gene. Primer sequences are listed in Table I. The experiments were repeated thrice.

Table I. Sequences of primers used in reverse transcription-quantitative PCR.

Table I.

Sequences of primers used in reverse transcription-quantitative PCR.

Gene	Sequence (5′-3′)
Otubain 2	F: TCAATCCGAAAGACCAAA
	R: TGTGAGGAGGCGTAAGAA
Tissue nonspecific alkaline phosphatase	F: AGTCCGTGGGCATCGTG
	R: CCTCTGGCGGCATCTCA
Runt related transcription factor 2	F: CCATAACGGTCTTCACAAATC
	R: GAGGCGGTCAGAGAACAAACT
Osteoprotegerin	F: TCCCTTGCCCTGACTAC
	R: CCTGAGAAGAACCCATCC
Receptor activator of nuclear factor-κB ligand	F: CATCGGGTTCCCATAAAG
	R: GAAGCAAATGTTGGCGTA
β-actin	F: TGGCACCACACTTTCTACAATGAGC
	R: GGGTCATCTTTTCACGGTTGG

[i] F, forward; R, reverse.

Western blotting analysis

Total protein was extracted from BMSCs or the callus tissue in the femur of rats using Radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology) mixed with phenylmethanesulfonyl fluoride (100:1; Beyotime Institute of Biotechnology). Samples were centrifuged at 10,000 × g for 5 min at 4°C and supernatants were collected. Total protein was quantified using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. A total of 20 µg of protein was separated by SDS-PAGE s with a 5% stacking gel and a 10% running gel. Separated proteins were transferred onto PVDF membranes and blocked with 5% skimmed milk diluted in tris-buffered saline tween-20 for 1 h at room temperature. Following blocking, membranes were incubated with the following primary antibodies at 4°C overnight: Polyclonal rabbit anti-OTUB2 (1:500; Sabbiotech), polyclonal rabbit anti-TNAP (1:1,000; ABclonal Biotech, Co., Ltd.), polyclonal rabbit anti-RUNX2 (1:500; Proteintech Group, Inc.), polyclonal rabbit anti-osteoprotegerin (OPG; 1:1,000; Affinity Biosciences, Ltd.), polyclonal rabbit anti-receptor activator of nuclear factor-κB ligand (RANKL; 1:500; Affinity Biosciences, Ltd.), polyclonal rabbit anti-TRAF3 (1:1,000; ABclonal Biotech, Co., Ltd.), polyclonal rabbit anti-Flag (ABclonal Biotech, Co., Ltd.), polyclonal rabbit anti-ubiquitin (Proteintech Group, Inc.) and monoclonal mouse anti-β-actin (1:1,000; Santa Cruz Biotechnology, Inc.). Following primary incubation, membranes were incubated with the following secondary antibodies at 37°C for 45 min: Goat anti-rabbit horseradish peroxidase-conjugated IgG (1:5,000; Beyotime Institute of Biotechnology) and goat anti-mouse horseradish peroxidase-conjugated IgG (1:5,000; Beyotime Institute of Biotechnology). Protein bands were visualized using ECL reagent (Beyotime Institute of Biotechnology) on the WD-9413B gel imaging system (Liuyi Biotechnology). Six independent measurements were obtained using callus tissue samples and three independent measurements were obtained using BMSC samples. The band densities were quantified with the Gel-Pro-Analyzer software (version 4.0; Media Cybernetics, Inc.).

X-radiography and micro-computed tomography (CT) analysis

Fractured femurs were imaged using the CSM-2R X-ray apparatus (Softex) at 2-, 4- and 8-weeks post-fracture. Radiographic fracture healing was scored from Grade 1–6, as previously described (3). Briefly, fracture healing was scored as follows: i) Grade 1, no calcification; ii) Grade 2, patchy calcification; iii) Grade 3, calcification takes on the appearance of a callus; iv) Grade 4, callus bridging across the fracture gap; v) Grade 5, continuity of bone trabeculae; and vi) Grade 6, remodeling to normal bone.

Fractured femurs were scanned using the Quantum GX micro-CT imaging system (PerkinElmer, Inc.). Briefly, fractured femurs were scanned at 90 kV and 88 µA using a 50-µm voxel. Using the fracture line as the center, 50 slices were measured between the distal and proximal edges. The callus was segmented from the background as a region of interest. Subsequently, bone volume fraction (BV/TV) and bone mineral density (BMD) were auto-obtained using micro-CT analysis and 3D images were captured (31,32).

Histological analysis

Tissues were fixed in 10% formalin solution at 4°C for 48 h. The fixed tissues were rinsed in running water for 4 h at room temperature. Samples were dehydrated in gradient ethanol (50–100 %), embedded in paraffin and then cut into 5 µm sections using a microtome (cat. no. RM 2235; Leica Microsystems, Inc.). Paraffin-embedded sections of fracture callus were deparaffinized in xylene and rehydrated in an ethanol gradient with distilled water. Formation of callus was examined using H&E staining (33). Cartilaginous ossification was analyzed using safranine O-fast green staining. Briefly, sections were stained with safranine O for 5 min at room temperature, followed by rinsing with ethanol gradient. Sections were subsequently stained with fast green for 1 min at room temperature and imaged using a BX53 microscope in bright-field mode (Olympus Corporation).

Isolation and osteogenic differentiation of BMSCs

Isolation and osteogenic differentiation of BMSCs were performed as previously described (24). Briefly, femurs and tibiae were collected from rats and muscles surrounding the bone were removed. The marrow cavity was flushed with DMEM (Wuhan Servicebio Technology Co., Ltd.) for cell harvesting and cells were centrifuged at 300 × g for 7 min at room temperature. Subsequently, cells were cultured in DMEM supplemented with 10% fetal bovine serum (Sijiqing Biological Engineering Materials Co., Ltd.) at 37°C in an incubator with 5% CO2. BMSCs were cultured until the third passage was reached and used in subsequent experiments after ~2 weeks. BMSC phenotype was confirmed via flow cytometry with surface antigens.

Osteogenic differentiation was performed at 72 h post-transfection, as previously described (34). Briefly, cell medium was removed and replaced with medium for inducing osteogenic differentiation [100 nM dexamethasone (MilliporeSigma), 50 µM vitamin C (Sinopharm Chemical Reagent Co., Ltd.) and 10 mM β-sodium glycerophosphate (MilliporeSigma)]. Differentiation medium was changed every 2 days. At 3 days post-induction, total protein was extracted for western blotting analysis (35). At 7 days post-induction, TNAP activity was detected and at 14 days post-induction, Alizarin Red S staining was performed to assess calcium deposition, as previously described (35,36).

Flow cytometry

Following centrifugation at 300 × g for 7 min at 4°C, BMSCs were rinsed and suspended with 100 µl phosphate buffer saline. In total, 1×106 cells were incubated with 0.25 µg fluorescein isothiocyanate (FITC)-conjugated anti-CD45 (MultiSciences Biotech), 1 µg FITC-conjugated anti-CD29 (BioLegend, Inc.), 0.06 µg FITC-conjugated anti-CD90 (BioLegend, Inc.) and 0.25 µg PE-Cyanine 7-conjugated anti-CD31 (Thermo Scientific, Inc.) at 4°C in the dark. Subsequently, cells were analyzed via NovoCyte flow cytometry (ACEA Biosciences), using three independent measurements. Data was analyzed using NovoExpress software (version 1.4.1; Agilent Technologies, Inc.).

Alizarin Red S staining

Cells were fixed with 4% paraformaldehyde at room temperature for 15 min and stained with Alizarin Red for 30 min at room temperature. Images were captured using a microscope (IX53l; Olympus Corporation). Calcium deposits were quantified following the addition of 10% cetylpyridinium chloride (Shanghai Macklin Biochemical Co., Ltd.) for 15 min at room temperature. Absorbance was measured at a wavelength of 570 nm (37).

Detection of TNAP

The levels of TNAP were assessed using the TNAP Detection Kit (Wanleibio Co., Ltd.) according to the manufacturer's instructions. Briefly, ultrasonic cell disruption (300 W; ultrasonication for 3 sec with an interval of 30 sec repeated 5 times) was carried out in an ice bath and cells were subsequently centrifuged at 421 × g for 10 min at 4°C. In total, three independent supernatant samples were used for the detection of TNAP levels.

Callus tissues were homogenized with normal saline (1:9; g/v). The tissue homogenate was centrifuged at 421 × g at room temperature for 10 min. The resulting supernatant was obtained for the detection of TNAP levels. A total of six independent supernatant samples were used for the detection of TNAP levels.

Co-immunoprecipitation

Wild-type fragments of OTUB2 cDNA, wild-type TRAF3 cDNA and OTUB2 fragments with a point mutation at C51S were synthetized by General Biotech (Anhui) Co., Ltd. Subsequently, wild-type OTUB2 fragments and OTUB2 fragments with a point mutation were inserted into pcDNA3.1(+)_myc-His A vectors (General Biotech (Anhui) Co., Ltd.). Wild-type fragments of TRAF3 were inserted into p3×FLAG-CMV-10 vectors (General Biotech (Anhui) Co., Ltd.). All constructs were verified using enzyme digestion and sequencing. Subsequently, Lipofectamine® 3000 was used to transiently transfect OTUB2-Myc/OTUB2-Myc (C51S) and TRAF3-Flag plasmids into 293T cells. One day prior to transfection, cells were cultured in 6 well-plates until 80% confluence was reached. In addition, cells were starved for 2 h prior to transfection and subsequently incubated with OptiMEM containing 5 µl Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), 5 µl P3000 reagent and 2 µg plasmids. Following 48 h of transfection, 293T cells were lysed with radioimmunoprecipitation assay buffer mixed with phenylmethanesulfonyl fluoride (100:1), followed by mixing in liquid nitrogen. Cells were centrifuged at 10,000 × g for 5 min at 4°C and the supernatant was collected and subjected to immunoprecipitation using a co-immunoprecipitation kit (cat. no. 26149; Thermo Fisher Scientific, Inc.). Briefly, 20 µl of resin slurry was used to pre-clear the lysates, which were further incubated with 1 µg of immobilized antibodies (Flag-tag or Myc-tag). Following elution and centrifugation (1,000 × g for 5 min at 4°C) to obtain the precipitates, proteins were used for subsequent western blot analysis.

Molecular docking analysis

OTUB2 and TRAF3 sequences were obtained from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/) and crystal structures were obtained via homology modeling on the SWISS-MODEL database (https://swissmodel.expasy.org/). Interactions between proteins were forecasted using the GRAMM database (https://gramm.compbio.ku.edu/request) and a graphic representation of the protein-protein interaction was established using PyMOL software (version 2.0; Schrodinger). Grey was indicative of the OTUB2 protein, purple was indicative of the TRAF3 protein and stick structures of red and blue were indicative of binding. Notably, the yellow dotted line was indicative of a hydrogen bond.

Statistical analysis

Data are presented as the mean ± standard deviation, or as box and whisker plots, with the ‘box’ depicting the median, 1st quartile and 3rd quartile and the ‘whisker’ depicting the standard deviation. Data were analyzed using GraphPad Prism software (version, 8.0; GraphPad; Dotmatics). In vitro experiments were independently repeated three times and in vivo experiments were independently repeated six times (6 rats/group). Differences between multiple groups were analyzed using one-way ANOVA followed by Tukey's post hoc test and comparisons between two groups were analyzed using an unpaired Student's t-test. Effect size was calculated to determine the power of the analysis, due to the small sample size included in the present study, as previously described (38). The sample size of animals was chosen according to the results of power analysis. The priori/post-hoc power analysis was carried out using G*power 3.1.9.7 software (Franz Faul). It was found appropriate to complete the study with at least 6 samples for each group (α err probe was 0.05; effect size was 0.9; power was 0.8). Previous studies reported that Student's t-tests are suitable when sample size is small and effect size is large (39,40). In addition, bone fracture healing scores were analyzed using a Kruskal-Wallis test followed by Dunn's post hoc analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

OTUB2 accelerates bone fracture healing

To investigate the potential effects of OTUB2 on bone fracture healing, a fracture model was established through the injection of lentivirus targeting OTUB2 around the fracture sites of rats (Fig. 1A). At 2-, 4- and 8-weeks post-fracture, mRNA and protein expression levels of OTUB2 were elevated in the fracture callus of rats in the LV-OTUB2 group (Fig. 1B and C). The effects of OTUB2 overexpression were subsequently investigated using X-radiography and micro-CT analysis. Results of the present study revealed that the speed of fracture healing was increased and fracture healing remodeling was improved in the LV-OTUB2 group at 8 weeks post-fracture, when compared with the LV-NC group (Fig. 1D and E). In addition, the elevated callus area was observed at the fracture sites (Fig. 1D). Results of the present study also revealed that specimens exhibited severe loss and erosion of the femur following bone fracture; however, this was alleviated following OTUB2 overexpression. Representative micro-CT 3D images of fractured femur are displayed in Fig. 1F. In addition, quantification of the micro-CT 3D analysis demonstrated that BMD and BV/TV were increased following OTUB2 overexpression, indicative of accelerated bone fracture healing and bone formation (Fig. 1G). These results highlighted that OTUB2 may promote bone fracture healing.

Figure 1. OTUB2 enhances the bone fracture healing. (A) Schematic diagram of the rat fracture model, which was established by cutting the femur. The rats were further injected with LV-NC or LV-OTUB2 around the fracture site. The image of SD rat was from SciDraw platform (10.5281/zenodo.7368720). (B) mRNA and (C) protein levels of OTUB2 in bony callus of mice at week 2, 4 and 8 post-fracture were evaluated by reverse transcription-quantitative PCR and western blotting, respectively. (D) Representative radiographs of femurs. (E) Fracture healing score. (F) Micro-CT images of rat femora at week 8. (G) BMD and BV/TV. Data shown as box- and whiskers plot, with the box depicting the median and the 25 and 75th quartiles and the whisker revealing the standard deviation in B, C and G. n=6; *P<0.05, **P<0.01 vs. LV-NC. OTUB2, otubain 2; LV, lentivirus vector; NC, negative control; SD, Sprague Dawley; CT, computed tomography; BMD, bone mineral density; BV/TV, bone volume fraction.

OTUB2 regulates bone callus formation, cartilaginous ossification and bone remodeling

The potential effects of OTUB2 on bone callus formation and cartilaginous ossification were further investigated in the present study. Results of the H&E staining analysis demonstrated that OTUB2 overexpression was associated with improved recovery at the fracture sites, with the formation of woven bone at 4- and 8-weeks post-fracture, compared with the LV-NC group (Fig. 2A). In addition, OTUB2 overexpression promoted soft callus formation at 4- and 8-weeks post-fracture. OTUB2 overexpression was associated with the domination of woven bone at the fracture sites at 8 weeks post-fracture and this was close to union (Fig. 2A). Results of the safranine O-fast green staining analysis revealed that the cartilage area of rats in the OTUB2 overexpression group was reduced at 4- and 8-weeks post-fracture, compared with the LV-NC group (Fig. 2B). At week 8, a few calcified cartilages and a limited number of uncalcified cartilages were observed in the fracture calluses of rats in the OTUB2 overexpression group (Fig. 2B), with ossification of the cartilage callus. Collectively, these data suggested that OTUB2 may potentiate fracture callus formation and cartilaginous ossification.

Figure 2. OTUB2 regulates the bony callus formation, cartilage calcification and bone remodeling. A rat fracture model was established by cutting the femur and the rats were further injected with LV-NC or LV-OTUB2 around the fracture site. (A) H&E staining of the fracture callus sections. Scale bar, 500 µm. (B) Safranine O-fast green staining of the fracture callus sections. Scale bar, 500 µm. Red arrow indicates uncalcified cartilage and green arrow indicates calcified cartilage. (C) TNAP activities. (D-F) The mRNA expression of TNAP, RUNX2 and the ratio between OPG and RANKL. (G and H) Protein levels of TNAP, RUNX2, OPG, RANKL and TRAF3. Data was shown as box- and whiskers plot, with the box depicting the median and the 25 and 75th quartiles and the whisker revealing the standard deviation. n=6; **P<0.01 vs. LV-NC. OTUB2, otubain 2; LV, lentivirus vector; NC, negative control; wb, woven bone; cc, cartilage callus; TNAP, alkaline phosphatase; RUNX2, runt related transcription factor 2; OPG osteoprotegerin; RANKL, receptor activator of nuclear factor-kappa B ligand; TRAF3, TNF-receptor associated factor 3.

Bone formation and mineralization, cartilage maturation and bone mass play vital roles in the bone remodeling of fracture. Thus, genes and proteins associated with bone fracture were investigated at 2 weeks post-fracture. Results of the present study revealed that OTUB2 overexpression was associated with increased TNAP activity (Fig. 2C). In addition, OTUB2 overexpression was associated with increased TNAP and RUNX2 mRNA expression levels and an increase in the ratio between OPG and RANKL expression (Fig. 2D-F). Notably, results of the western blot analysis were comparable with those obtained using RT-qPCR (Fig. 2G and H).

OTUB2 facilitates the osteogenic differentiation and mineralization of BMSCs

Results of the present study revealed that OTUB2 exhibited protective effects on bone fracture healing in vivo. Thus, it was hypothesized that OTUB2 may play a similar role in vitro. In the present study, a model of osteogenic differentiation was established using BMSCs (Fig. 3A). BMSCs were isolated from rats and the phenotype was identified using flow cytometry with surface antigens. Results of the present study exhibited positivity for antigens CD29 and CD90 and negativity for antigens CD45 and CD31, indicative of a high cell purity (Fig. 3B). Notably, OTUB2 expression was increased in BMSCs infected with LV-OTUB2 (Fig. 3C). Results of the Alizarin Red S staining analysis revealed that OTUB2 potentiated the mineralization of BMSCs, with an increased number of calcified nodules that were bright red in color (Fig. 3D and E). In addition, OTUB2 overexpression was associated with increased TNAP expression levels (Fig. 3F), increased RUNX2 and OPG expression levels and reduced RANKL expression levels (Fig. 3G and H). Collectively, these results suggested that OTUB2 may facilitate the osteogenic differentiation and mineralization of BMSCs.

Figure 3. OTUB2 facilitates the osteogenic differentiation and bone mineralization. (A) A schematic diagram of the model of osteogenic differentiation of BMSCs in vitro. BMSCs were harvested from marrow cavity of rat femurs and tibiae and then subjected to LV-OTUB2/LV-NC infection and osteogenic differentiation. The image of SD rat was from SciDraw platform (10.5281/zenodo.7368720). (B) BMSCs surface antigen identification by flow cytometry. (C) Protein expression of OTUB2 in BMSCs was detected by western blotting. (D) Alizarin Red S staining of BMSCs. Scale bar, 200 µm. (E) Quantification of Alizarin Red S staining by the measurement of absorbance at 570 nm. (F) TNAP activities of BMSCs. (G and H) Protein levels of RUNX2, OPG, RANKL and TRAF3. Data was shown as mean ± standard deviation. n=6; **P<0.01 vs. LV-NC. OTUB2, otubain 2; BMSCs, bone marrow mesenchymal stem cells; LV, lentivirus vector; NC, negative control; SD, Sprague Dawley; TNAP, alkaline phosphatase; RUNX2, runt related transcription factor 2; OPG osteoprotegerin; RANKL, receptor activator of nuclear factor-kappa B ligand; TRAF3, TNF-receptor associated factor 3.

OTUB2 deubiquitinates the TRAF3 protein

The present study aimed to determine the specific mechanisms underlying the OTUB2-induced increases in osteogenesis and mineralization. Notably, deubiquitinase OTUB2 interacts with substrate proteins to remove covalently-attached ubiquitin, thereby controlling substrate abundance. Thus, it was hypothesized that the protective role of OTUB2 may be mediated by the stability of downstream substrates and proteins that interacted with OTUB2 were analyzed using the STRING database. As displayed in Fig. 4A, results of the present study revealed 10 proteins that interacted with OTUB2. To further investigate the specific functions of these proteins, GO enrichment analysis was performed (Fig. 4B). Results of the present study revealed that the OTUB2-interacting proteins were enriched in ‘protein deubiquitination’, ‘ubiquitin-dependent protein catabolic process’ and ‘protein modification by small protein conjugated or removal’. These enriched terms provided direction for further investigation of the mechanisms downstream of OTUB2 and TRAF3, a protein enriched in ‘regulation of protein polyubiquitination’ was selected for subsequent analyses (Fig. 4C). As a member of the TRAF family, TRAF3 plays a role in promoting bone formation and remodeling (41). Thus, it was hypothesized that the protective effects of OTUB2 in fracture healing and the osteogenic differentiation of BMSCs may be associated with TRAF3. In the present study, co-immunoprecipitation analysis was used to verify the physical interaction between OTUB2 and TRAF3 in 293T cells (Fig. 4D and E). Results of the protein molecular docking analysis revealed a hydrogen bond between OTUB2 and the TRAF3 protein, indicative of binding (Fig. 4F). In addition, results of the present study revealed that OTUB2 reduced the ubiquitination of TRAF3 (Fig. 4G). Subsequently, HEK293 cells expressing inactive enzyme mutant OTUB2 C51S were generated and results of the present study revealed that the OTUB2 mutation enhanced the ubiquitination of TRAF3 (Fig. 4H). These results highlighted that OTUB2 may repress TRAF3 ubiquitination and this is dependent on the deubiquitinase activity.

Figure 4. OTUB2 deubiquitinates TRAF3 protein. (A) Interacted proteins of OTUB2 were analyzed by STRING platform (https://cn.string-db.org/). (B) GO analysis of the OTUB2-inertacted proteins. (C) Sankey diagram of the GO items with the related proteins. (D) Interaction of OTUB2 and TRAF3 was evaluated by Co-immunoprecipitation. 293T cells expressing TRAF3-Flag, OTUB2-Myc or both were lysed. The protein extract was immunoprecipitated with anti-Flag antibodies, followed by western blotting using anti-Flag or anti-Myc antibodies. (E) Protein extract was immunoprecipitated with anti-Myc antibodies, followed by western blotting using anti-Flag or anti-Myc antibodies. (F) Molecular docking model of OTUB2 and TRAF3. (G) Anti-Flag immunoprecipitation was subjected to western blotting with anti-Ubi or anti-Flag antibodies, showing the deubiquitination of TRAF3 by OTUB2. (H) 293T cells expressing TRAF3-Flag, OTUB2-Myc/OTUB2-Myc (C51S) or both were lysed. Protein extract was immunoprecipitated with anti-Flag antibodies, followed by western blotting using anti-Flag, anti-Ubi or anti-Myc antibodies. n=3. OTUB2, otubain 2; TRAF3, TNF-receptor associated factor 3; GO, Gene Ontology; Ubi, ubiquitin.

TRAF3 knockdown represses the osteogenic differentiation and mineralization of BMSCs

As displayed in Fig. 2G and 3G, TRAF3 protein expression levels were increased following OTUB2 overexpression in vivo and in vitro. As a downstream factor of OTUB2, the role of TRAF3 attracted our interest. It was found that TNAP activity was reduced following TRAF3 knockdown (Fig. 5A) and the mineralization of BMSCs was markedly repressed (Fig. 5B and C). Results of the present study also revealed that TRAF3 knockdown reduced the expression levels of RUNX2 and OPG and promoted RANKL expression (Fig. 5D and E). Collectively, these results demonstrated that TRAF3 knockdown may reduce the osteogenic differentiation of BMSCs.

Figure 5. Downregulation of TRAF3 repressed the osteogenesis of BMSCs. BMSCs were harvested from marrow cavity of rat femurs and tibiae and then subjected to LV-shTRAF3/LV-shNC infection and osteogenic differentiation. (A) TNAP activities of BMSCs. (B) Quantification of the Alizarin Red S staining by the measurement of absorbance at 570 nm. (C) Alizarin Red S staining of BMSCs. Scale bar, 200 µm. (D and E) Protein levels of RUNX2, OPG, RANKL and TRAF3. Data was shown as mean ± standard deviation. n=3. **P<0.01 vs. LV-shNC. TRAF3, TNF-receptor associated factor 3; BMSCs, bone marrow mesenchymal stem cells; LV, lentivirus vector; sh, short hairpin; NC, negative control; TNAP, alkaline phosphatase; RUNX2, runt related transcription factor 2; OPG osteoprotegerin; RANKL, receptor activator of nuclear factor-kappa B ligand.

OTUB2 promotes the osteogenic differentiation and mineralization of BMSCs through increased TRAF3 expression

In the present study, TRAF3 expression was reduced following transfection with LV-shTRAF3 (Fig. 6A). Results of the present study revealed that TNAP expression levels were reduced and the mineralization of BMSCs with OTUB2 overexpression was repressed following TRAF3 downregulation (Fig. 6B-D). Collectively, these results demonstrated that OTUB2 may promote the osteogenic differentiation and mineralization of BMSCs through upregulation of TRAF3 (Fig. 6E).

Figure 6. OTUB2 promoted osteogenesis of BMSCs by the deubiquitination of TRAF3 protein. (A) Protein levels of TRAF3 in BMSCs, which were infected with LV-shTRAF3 and subjected to osteogenic differentiation. (B) Activities of TNAP in BMSCs co-infected with LV-OTUB2 and LV-shTRAF3. (C) Quantification of the Alizarin Red S staining by the measurement of absorbance at 570 nm. (D) Alizarin Red S staining of BMSCs. Scale bar, 300 µm. (E) Schematic diagram of the potential underlying mechanism of OTUB2 on promoting bone fracture healing. Data was shown as mean ± standard deviation. n=3; *P<0.05, **P<0.01 vs. LV-shNC or LV-OTUB2 + LV-shNC. OTUB2, otubain 2; BMSCs, bone marrow mesenchymal stem cells; TRAF3, TNF-receptor associated factor 3; LV, lentivirus vector; sh, short hairpin; TNAP, alkaline phosphatase; NC, negative control; Ub, ubiquitin.

Discussion

At present, the increasing incidence of traumatic fracture markedly affects the quality of life of patients. Notably, elderly patients who have experienced a fracture exhibit other comorbidities, including pulmonary embolism, infection and heart failure, which may lead to an increased risk of mortality (42). Results of the present study highlighted that further investigations are required to determine the specific mechanisms underlying fracture. To the to the best of the authors' knowledge, the present study was the first to demonstrate the protective effects of OTUB2 in bone fracture healing. Notably, OTUB2 may serve a role in facilitating bone callus formation, cartilaginous ossification and bone remodeling, both in vitro and in vivo. Results of the present study revealed that OTUB2 facilitated the osteogenic differentiation and mineralization of BMSCs and this was mediated by the deubiquitination of the TRAF3 protein.

Bone formation and mineralization, cartilage maturation and bone mass serve a vital role in bone remodeling of fracture, thus, genes and proteins associated with bone fracture were investigated. Notably, OPG and RANKL are expressed by osteoblasts and RANKL regulates osteoclastogenesis through binding to RANK secreted by osteoclasts (43). On the other hand, OPG is a decoy receptor of RANKL that protects cells from osteoclast formation (43). Thus, the ratio between OPG/RANKL is crucial in determining bone mass. Results of the present study revealed that OTUB2 enhanced the OPG/RANKL ratio both in vivo and in vitro, leading to an increase in bone mass and ossification.

Fracture healing is a complex and long-term process involving callus formation and multiple dynamic stages. The initial stage involves a hematoma, which generates an inflammatory environment. In addition, middle-to-late-stage fracture healing involves endochondral ossification and removal and calcification of the endochondral cartilage. The final stage of bone fracture healing involves chronic remodeling (9). Results of the pathological analysis demonstrated that a few calcified cartilages and minimal levels of uncalcified cartilage existed in the fracture calluses of rats with OTUB2 overexpression at 8 weeks post-fracture. Notably, the cartilage callus had undergone ossification and woven bone had formed. Comparable results were obtained using in vitro experiments. In addition, bone formation depends on the amount and activity of osteoblasts during bone remodeling, which are differentiated from osteoprogenitor cells and BMSCs. The osteogenic differentiation of BMSCs involves pre-osteoblasts, osteoblasts, mature osteoblasts and the deposition and mineralization of the extracellular matrix (44). Several factors have been found to regulate BMSC osteogenic differentiation. Of these, RUNX2 serves an essential role. The onset of osteogenic differentiation is characterized by the increased expression of the RUNX2 protein (45,46). Results of a previous study reveal that RUNX2 induces TNAP activity (45), which promotes bone mineralization (47). Notably, the loss of OTUB2 may inhibit TNAP activity and reduce RUNX2 expression during the osteogenesis of BMSCs (18). These results are comparable with those obtained in the present study. The present study found that OTUB2 may promote the osteogenic differentiation of BMSCs via the facilitation of TNAP activity and upregulation of RUNX2 expression.

Results of the present study revealed that OTUB2 overexpression accelerates fracture healing in vivo and promotes the osteogenic differentiation of BMSCs in vitro. As a downstream protein of OTUB2, it is possible that TRAF3 may exert a similar role in bone repair and formation. As a member of the TRAF family, TRAF3 serves a crucial role in the development of an immune response (48,49). Results of previous studies revealed that TRAF3 may promote bone formation and bone remodeling and reduce bone destruction (41,50). In addition, Yao et al (51) reveal that TRAF3 knockdown in myeloid cells inhibits bone formation in a mouse osteoporosis model. A previous study demonstrates that TRAF3 knockdown in mesenchymal progenitor cells leads to the early onset of osteoporosis in mice, due to decreased bone formation and enhanced bone destruction. Collectively, these results demonstrate that TRAF3 positively regulates the differentiation of mesenchymal progenitor cells into osteoblasts and promotes osteogenesis (49). In addition, TRAF3 overexpression facilitates the osteogenic differentiation and suppresses the adipocytic differentiation of rat BMSCs (50). Results of previous studies also demonstrate that increased TRAF3 expression mediates the inhibition of osteoclastogenesis (52–54). Collectively, these results highlight the therapeutic potential of TRAF3 in bone-regulated diseases. Results of the present study revealed that downregulation of TRAF3 repressed the osteogenic differentiation and mineralization of BMSCs, which are the key process in bone healing. Based on results of the OTUB2-induced deubiquitination of TRAF3, it was hypothesized that the protective role of OTUB2 was at least partly mediated by the deubiquitination and accumulation of TRAF3. It is possible that TRAF3 might also act as a part in bone fracture healing. Lack of verifying experiments is a limitation of the present study.

Results of the co-immunoprecipitation analysis demonstrated that OTUB2 interacted with TRAF3. Deubiquitinases possess ubiquitin-binding sites that guide the ubiquitin C terminus and the scissile bond into the active site for hydrolysis (55). Thus, it was hypothesized that the interaction between TRAF3 and OTUB2 may be associated with the deubiquitination of TRAF3. Results of the present study revealed that OTUB2 overexpression reduced the ubiquitination of TRAF3. To further determine whether OTUB2 directly deubiquitinates TRAF3, HEK293 cells expressing inactive enzyme mutant OTUB2 C51S were generated. Results of the co-immunoprecipitation analysis revealed that the OTUB2 mutation reversed the OTUB2 wild-type mediated deubiquitination of TRAF3, indicating that OTUB2 repressed TRAF3 ubiquitination and this was dependent on its deubiquitinase activity. Thus, results of the present study revealed that OTUB2 may induce the deubiquitination of TRAF3, leading to the accumulation of TRAF3 in cells. Notably, these results are comparable with those of a previous study (56). In addition, results of the present study revealed that TRAF3 knockdown inhibited OTUB2-mediated osteogenic differentiation. Thus, OTUB2-mediated TRAF3 deubiquitination may serve a vital role in the process of bone healing.

In conclusion, results of the present study revealed that OTUB2 may promote bone fracture healing through the deubiquitination of TRAF3. Thus, OTUB2 may exhibit potential as a novel therapeutic target in the treatment of fracture and the use of OTUB2 in clinical practice may improve patient outcomes.

Acknowledgements

Not applicable.

Funding

The present study was funded by the Key R&D Program of the China Ministry of Science and Technology (grant no. 2024YFC2510600) and Natural Science Foundation of Hebei Province (grant no. H2022206432).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

LZ, JG, SF, YuZ, HW, HM, WC, YiZ and ZH conceived and designed the research. LZ performed experiments, wrote the manuscript and obtained funding. JG and SF performed experiments and bioinformatics analysis. YuZ and HW performed data acquisition, analysis and interpretation. HM, WC and YiZ conducted statistical analysis and provided substantial intellectual input during the drafting and revision of the manuscript. ZH oversaw the research program, obtained funding and reviewed the manuscript. LZ and ZH confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Animal experiments were approved by Laboratory Animal Ethical and Welfare Committee of Hebei Medical University (approval no. IACUC-Hebmu-2021007) following The Guideline for the Care and Use of Laboratory Animals.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

References