Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
November-December 2011 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-December 2011 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer

  • Authors:
    • Jin Won Choi
    • Suzie E. Ahn
    • Deivendran Rengaraj
    • Hee Won Seo
    • Whasun Lim
    • Gwonhwa Song
    • Jae Yong Han
  • View Affiliations / Copyright

    Affiliations: WCU Biomodulation Major, Department of Agricultural Biotechnology and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Republic of Korea
  • Pages: 1047-1051
    |
    Published online on: August 19, 2011
       https://doi.org/10.3892/ol.2011.391
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Matrix metalloproteinases (MMPs) are involved in the degradation of the extracellular matrix and basement membranes. Due to this, MMPs have been thought to promote invasion and metastasis of cancer cells and angiogenesis in tumors. Even though the chicken is a useful animal model for studying human ovarian cancer, no reports exist of the MMP expression pattern in chicken ovarian cancer. Therefore, we investigated the expression pattern of MMPs in chicken ovarian cancer. Results of RT-PCR and quantitative RT-PCR analyses showed MMP3 to be over‑expressed in cancerous hen ovaries. In situ hybridization analysis of cancerous chicken ovaries showed that MMP3 mRNA was predominantly localized in the stroma, which is similar to MMP3 expression in human cancers. The results suggest that the expression pattern of MMP3 mRNA in chicken ovarian cancer is similar to that in various types of human cancer. Moreover, MMP3 potentially plays a significant role in developing ovarian cancer in chickens. The cell type‑specific expression of MMP3 makes this gene a unique marker for ovarian cancer in chickens.

Introduction

Of all the gynecologic cancers, ovarian cancer has the highest mortality rate. Even though the survival rate following early detection of the disease is relatively high, a diagnosis of ovarian cancer often occurs at a late stage in the disease. The mechanisms responsible for ovarian cancer are not completely known, and research is minimal due to a lack of suitable animal models (1).

The laying hen is a suitable animal model for human ovarian cancer due to the similarities between human and chicken ovarian cancers. Most human ovarian cancers arise spontaneously in cells derived from the ovarian surface epithelium (2,3). This is consistent with chicken ovarian cancer, which originates from ovarian epithelial cells (4). Support for the hypothesis regarding incessant ovulation that explains ovarian cancer in humans (2,3) is the fact that hens ovulate almost daily, resulting in genomic damage to the ovarian surface epithelium and increasing the likelihood of mutations that lead to the development of spontaneous ovarian adenocarcinoma (5). Moreover, anti-tumor antibodies common to human and chicken cancer carcinomas include cancer antigen 125, cytokeratin, pan cytokeratin, proliferating cell nuclear antigen (PCNA), carcinoembryonic antigen, cytokeratin AE1/AE3, epidermal growth factor receptor, ERBB2, Lewis Y, selenium-binding protein 1 and tumor-associated glycoprotein 72 (6–8). Despite these similarities, further characterization of chicken ovarian cancer is crucial for a comparative study of ovarian cancers in humans and chickens.

Proteases are involved in controlling multiple biological processes and multiple diseases, including cancer (9). It was recently reported that cysteine proteases, known as cathepsins, were involved in chicken ovarian cancer (10). One of the protease groups, matrix metalloproteinases (MMPs), is involved in the degradation of the extracellular matrix and basement membranes. Due to their function, MMPs have long been considered to play an essential role in cancer progression by promoting tumor cell invasion, angiogenesis and metastasis of cancer cells (11–13). In human ovarian cancer, certain MMPs are abundantly expressed in epithelial ovarian cancer cells (14,15). However, the expression of MMPs in cancerous chicken ovaries has yet to be investigated. We therefore examined the expression patterns of MMPs in cancerous and normal chicken ovaries, with a particular emphasis on MMP3.

Materials and methods

Animals

The care and experimental use of White Leghorn (WL) hens (Gallus gallus domesticus) was approved by the Institute of Laboratory Animal Resources, the Seoul National University (SNU-070823-5), Korea. The hens were maintained in a standard management program at the University Animal Farm at Seoul National University. The procedures used for animal management, reproduction and embryo manipulation followed the standard operating protocols of our laboratory.

Tissue samples

Cancerous (n=5) ovaries were obtained from 2- and 3-year-old WL hens with spontaneously developed ovarian cancer. Normal (n=3) ovaries were obtained from 2- and 3-year-old healthy WL hens without any histological changes in the ovaries. Sections of these ovaries were frozen or embedded in paraffin for further analysis. For diagnosis, paraffin-embedded tissues were sectioned at 5 μm and stained with hematoxylin and eosin.

RT-PCR analysis

Total RNA was extracted from frozen tissues by TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using AccuPower® RT PreMix (Bioneer, Daejeon, Korea). Specific primer sets were used for RT-PCR (Table I). PCR amplification was performed as follows: 95°C for 3 min; followed by 30 cycles of 95°C for 20 sec, 60°C for 40 sec and 72°C for 1 min; and a final extension of 72°C for 5 min. PCR products were analyzed on a 1% agarose gel stained with ethidium bromide.

Table I

Primer sequences used for RT-PCR and cloning.

Table I

Primer sequences used for RT-PCR and cloning.

GeneSequence (5′-3′): forward and reverseGene bank accession no.Product size (bp)
MMP1 CTAATGGGCTGCTGGCTCA
GACCTCTCAGGATGTTTGCG
XM_417176406
MMP2 GTGGCAATGGTGATGGACAG
TCCTGAGAAAGGCGGAAGTT
NM_204420460
MMP3 CACTGGGATAGGAGGGGATG
TCTGTGGGTGCCATTTCTGT
XM_417175.2348
MMP7 CCTCCTACTTTGTGCTGCCA
ATGATGTCTGCCTGTCCCG
NM_001006278.1453
MMP9 CGGCTTAGAGGTGAAGACCC
GGAAGGTGAAGGGGAAGACA
NM_204667.1416
MMP11 CCAGCCAGACCTTGAAACAA
CAATCTCCTGTGGGACACCA
XM_001232776491
MMP13 CGGGTGCTGTGGAAGAAATA
TTGGTGTAGTTGGGGCAGAC
XM_001235204407
MMP15 GACGCTGGAAAACACGGAC
ACCACTTGCCCTTGAACACA
XM_413995422
MMP16 CAACTGACCCCAGAATGTCG
AAAAATCCTCCCTCCCCATC
NM_205197454
MMP17 TTTGGGTATCTGCCTCCTCC
CCTGCTGTGTGATGGTCTCC
XM_415092482
MMP23B CGTAGTGGCTTTGCTGGCTA
CAAGTTCCCCTGTTGTTCCA
XM_417569425
MMP24 CGACTCTTCCTGTTCGCAGA
TCGCTCTCTTGTCCTCGTTG
XM_417326498
MMP27 CAGGAAAACCAGACACCGAG
GAGCAGCAACCAGGAACAAA
NM_205000423
MMP28 CAGCACCTACTACTGCCACTCC
AATAGCGGTCATCCCGAAAG
XM_415771500
GAPDH CACAGCCACACAGAAGACGG
CCATCAAGTCCACAACACGG
NM_204305443
Quantitative RT-PCR analysis

Quantitative RT-PCR was performed using SYBR-Green (Sigma, St. Louis, MO, USA) and a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA). Relative quantification of gene expression was calculated using the formula 2−ΔΔCt, where ΔΔCt= (Cttarget gene − CtGAPDH)cancerous tissue − (Cttarget gene − CtGAPDH)normal tissue. The information for the primer sets is shown in Table II.

Table II

Primer sequences used for quantitative RT-PCR.

Table II

Primer sequences used for quantitative RT-PCR.

GeneSequence (5′-3′): forward and reverseGene bank accession no.Product size (bp)
MMP3 ACCTGGGCTTTCCCAGAAGT
CTGAAGGGCAGCATCAACGA
XM_417175.2194
GAPDH ACACAGAAGACGGTGGATGG
GGCAGGTCAGGTCAACAACA
NM_204305193
In situ hybridization

In situ hybridization was conducted as previously described (16). For hybridization probes, PCR products were generated from ovarian cancer cDNA with the primers used in RT-PCR analysis. Products were then gel-extracted and cloned into pGEM-T Easy Vector (Promega, Madison, WI, USA). Following the verification of sequences, a DIG-labeled RNA probe was prepared using a DIG RNA labeling kit (Roche Applied Science, Indianapolis, IN, USA). Frozen sections (10 μm) were mounted on slides pretreated with 3-aminopropyltriethoxysilane (Sigma), dried on a 50°C slide warmer, fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS), treated with 1% Triton X-100 in PBS for 20 min, washed three times in PBS and incubated with a prehybridization mixture [50% formamide and 5X standard saline citrate (SSC)] for 15 min at room temperature. Following prehybridization, sections were incubated in a hybridization mixture (50% formamide, 5X SSC, 10% dextran sulfate sodium salt, 0.02% bovine serum albumin, 250 μg/ml yeast tRNA and denatured DIG-labeled cRNA probes) for 18 h at 55°C in a humidified chamber. Sections were then washed for stringency in a series of solutions containing formamide and SSC. Following blocking with 1% blocking reagent (Roche), sections were incubated overnight with sheep anti-DIG antibody conjugated to alkaline phosphatase (Roche). Following incubation, a visualization solution (0.4 mM 5-bromo-4-chloro-3-indolyl phosphate, 0.4 mM nitroblue tetrazolium, and 2 mM levamisole; Sigma) was used. Sections were counterstained with 1% (w/v) methyl green (Sigma). Images were captured with a Zeiss Axiophot light microscope equipped with an AxioCam HRc camera (Carl Zeiss, Inc., NY, USA).

Statistical analysis

Statistical analysis was performed using the Student’s t-test using the SAS program (SAS Institute, Cary, NC, USA). P<0.05 was considered to be statistically significant.

Results

Pathological characteristics of chicken ovarian cancer

Normal ovaries had typically developing follicles surrounded by stroma (Fig. 1A). The morphology of cancerous ovaries was entirely different, showing gland-like growth of cancer cells invading stromal tissues (Fig. 1B). The difference between normal and cancerous ovaries was similar to that reported previously (17,18).

Figure 1

Hematoxylin and eosin staining of (A) normal and (B) cancerous hen ovary. Scale bar, 100 μm.

Increased expression of MMP3 in cancerous ovaries

We initially performed RT-PCR analysis to determine the expression of MMPs that have been identified in chickens. MMP3 mRNA was markedly expressed in cancerous ovaries but almost undetectable in normal ovaries (Fig. 2A), whereas the expression of the remaining MMPs were weak or undetectable in cancerous and normal ovaries (data not shown). Therefore, further study was focused on MMP3.

Figure 2

Increased expression of MMP3 mRNA in normal and cancerous chicken ovaries. (A) RT-PCR analysis of ovaries. (B) Relative mRNA expression of MMP3 between normal and cancerous ovaries from chickens indicated that MMP3 mRNA was greater in cancerous ovaries (mean ± SEM, P<0.05).

To measure relative mRNA levels between normal and cancerous ovaries, we performed quantitative RT-PCR. As expected, MMP3 mRNA expression in cancerous ovaries was approximately 16-fold higher than that in normal ovaries (P<0.05, Fig. 2B).

Localization of MMP3 mRNA in normal and cancerous ovaries

The expression pattern for MMP3 was further analyzed by the localization of MMP3 mRNA by in situ hybridization. The results indicated an absence of the cell-specific expression of MMP3 mRNA in normal ovaries (Fig. 3A and D), whereas abundant MMP3 mRNA was observed in the stroma between the gland-like areas in the cancerous ovaries (Fig. 3B, C, E and F).

Figure 3

In situ hybridization analysis of MMP3 mRNA in normal and cancerous chicken ovaries. (A) No cell-specific localization of MMP3 mRNA was observed in normal ovaries. (B and C) MMP3 mRNA was markedly expressed in the stroma of cancerous ovaries. (D-F) Negative controls with the sense probe. Scale bar, 100 μm (A, B, D and E) and 25 μm (C and F).

Discussion

MMP3 (also known as stromelysin-1) plays significant roles in regulating extracellular matrix remodeling and in activating other MMPs (19). Over-expression of MMP3 has also been demonstrated in various types of cancer (20). In human cancer, MMPs are also commonly expressed in the stromal cells rather than in the tumor cells: expression of MMPs in stromal cells has been reported in breast, colorectal, lung, prostate, and pancreatic cancers (20). Our results also show that MMP3 mRNA is localized in stromal cells in chicken ovarian cancer suggesting that the roles of MMP3 in cancer are conserved between chickens and humans, and the expression of MMP3 may be regulated by similar mechanisms in the two species. In humans, cancer cells induce MMP1, 2 and 3 expression by secreting signaling molecules known as extracellular matrix metalloproteinase inducers (21,22). However, further studies are necessary to determine the detailed mechanism(s) of tumorigenesis in chicken ovaries.

Although the role of MMP3 in cancer has not been fully elucidated, certain studies have revealed its tumorigenic functions. Sternlicht et al showed that MMP3 over-expression in transgenic mice leads to enhanced mammary carcinogenesis (23), and Witty et al showed that MMP3 targets relevant substrates to promote apoptosis in neighboring epithelial cells, which is relevant for cancer (24). In addition to their ability to degrade major protein components of the extracellular matrix or the basement membrane, MMPs play a role in the early stages of tumorigenesis by stimulating cell proliferation and modulation of angiogenesis (25). A focus on the early stages of ovarian cancer in chickens may reveal new roles for MMPs in the early developmental stages of cancer and thus improve the ability of medical professionals to make an early diagnosis.

In conclusion, this study has demonstrated the over-expression of MMP3 in chicken ovarian cancer. The expression pattern of MMP3 is relatively similar to that of MMPs in human cancer. The cell type-specific expression of the MMP3 gene renders this gene a unique marker for epithelial chicken ovarian cancer and suggests the crucial role MMP3 plays in its development.

Acknowledgements

This study was supported by the Mid-career Researcher Program through an NRF grant funded by the MEST (No. 2009-0083687) and the World Class University program (R31-10056) through the National Research Foundation of Korea funded by the Science and Technology Ministry of Education. The authors would like to express their appreciation to Dr Fuller W. Bazer (Texas A&M University, USA; and Seoul National University, Korea) for assistance with manuscript preparation and helpful discussions.

References

1 

Orsulic S: Ovarian cancer. Mouse Models of Human Cancer. Holland EC: Whiley-Liss, Inc; New Jersey: pp. 171–187. 2004

2 

Auersperg N, Edelson MI, Mok SC, Johnson SW and Hamilton TC: The biology of ovarian cancer. Semin Oncol. 25:281–304. 1998.

3 

Fathalla MF: Incessant ovulation-a factor in ovarian neoplasia? Lancet. 2:1631971. View Article : Google Scholar : PubMed/NCBI

4 

Fredrickson TN: Ovarian-tumors of the hen. Environ Health Perspect. 73:35–51. 1987. View Article : Google Scholar : PubMed/NCBI

5 

Murdoch WJ, Van Kirk EA and Alexander BM: DNA damages in ovarian surface epithelial cells of ovulatory hens. Exp Biol Med. 230:429–433. 2005.PubMed/NCBI

6 

Zhuge Y, Lagman JA, Ansenberger K, et al: CYP1B1 expression in ovarian cancer in the laying hen Gallus domesticus. Gynecol Oncol. 112:171–178. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Stammer K, Edassery SL, Barua A, et al: Selenium-binding protein 1 expression in ovaries and ovarian tumors in the laying hen, a spontaneous model of human ovarian cancer. Gynecol Oncol. 109:115–121. 2008. View Article : Google Scholar

8 

Rodriguez-Burford C, Barnes MN, Berry W, Partridge EE and Grizzle WE: Immunohistochemical expression of molecular markers in an avian model: a potential model for preclinical evaluation of agents for ovarian cancer chemoprevention. Gynecol Oncol. 81:373–379. 2001. View Article : Google Scholar

9 

Lopez-Otin C and Bond JS: Proteases: Multifunctional enzymes in life and disease. J Biol Chem. 283:30433–30437. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Ahn SE, Choi JW, Rengaraj D, et al: Increased expression of cysteine cathepsins in ovarian tissue from chickens with ovarian cancer. Reprod Biology and Endocrinol. 8:1002010. View Article : Google Scholar : PubMed/NCBI

11 

Wolf K, Wu YI, Liu Y, et al: Multi-step pericellular proteolysis controls the transition from individual to collective cancer cell invasion. Nat Cell Biol. 9:893–904. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Bartolome RA, Ferreiro S, Miquilena-Colina ME, et al: The chemokine receptor CXCR4 and the metalloproteinase MT1-MMP are mutually required during melanoma metastasis to lungs. Am J Pathol. 174:602–612. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Bergers G, Brekken R, McMahon G, et al: Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat Cell Biol. 2:737–744. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Stadlmann S, Pollheimer J, Moser PL, et al: Cytokine-regulated expression of collagenase-2 (MMP-8) is involved in the progression of ovarian cancer. Eur J Cancer. 39:2499–2505. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Kenny HA and Lengyel E: MMP-2 functions as an early response protein in ovarian cancer metastasis. Cell Cycle. 8:683–688. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Rengaraj D, Kim DK, Zheng YH, Lee SI, Kim H and Han JY: Testis-specific novel transcripts in chicken: in situ localization and expression pattern profiling during sexual development. Biol Reprod. 79:413–420. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Giles JR, Shivaprasad HL and Johnson PA: Ovarian tumor expression of an oviductal protein in the hen: a model for human serous ovarian adenocarcinoma. Gynecol Oncol. 95:530–533. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Hales DB, Zhuge Y, Lagman JAJ, et al: Cyclooxygenases expression and distribution in the normal ovary and their role in ovarian cancer in the domestic hen (Gallus domesticus). Endocrine. 33:235–244. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Kucukali CI, Aydin M, Ozkok E, et al: Do schizophrenia and bipolar disorders share a common disease susceptibility variant at the MMP3 gene? Prog Neuro-Psychopharmacol Biol Psychiatry. 33:557–561. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Nelson AR, Fingleton B, Rothenberg ML and Matrisian LM: Matrix metalloproteinases: biologic activity and clinical implications. J Clin Oncol. 18:1135–1149. 2000.PubMed/NCBI

21 

Kataoka H, DeCastro R, Zucker S and Biswas C: Tumor cell-derived collagenase-stimulatory factor increases expression of interstitial collagenase, stromelysin, and 72-kDa gelatinase. Cancer Res. 53:3154–3158. 1993.

22 

Biswas C, Zhang Y, Decastro R, et al: Human tumor cell-derived collagenase stimulatory factor (renamed Emmprin) is a member of the immunoglobulin superfamily. Cancer Res. 55:434–439. 1995.PubMed/NCBI

23 

Sternlicht MD, Lochter A, Sympson CJ, et al: The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98:137–146. 1999. View Article : Google Scholar : PubMed/NCBI

24 

Witty JP, Lempka T, Coffey RJ and Matrisian LM: Decreased tumor-formation in 7,12-dimethylbenzanthracene-treated stromelysin-1 transgenic mice is associated with alterations in mammary epithelial-cell apoptosis. Cancer Res. 55:1401–1406. 1995.PubMed/NCBI

25 

Egeblad M and Werb Z: New functions for the matrix metallo proteinases in cancer progression. Nat Rev Cancer. 2:161–174. 2002. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Choi J, Ahn SE, Rengaraj D, Seo H, Lim W, Song G and Han J: Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer. Oncol Lett 2: 1047-1051, 2011.
APA
Choi, J., Ahn, S.E., Rengaraj, D., Seo, H., Lim, W., Song, G., & Han, J. (2011). Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer. Oncology Letters, 2, 1047-1051. https://doi.org/10.3892/ol.2011.391
MLA
Choi, J., Ahn, S. E., Rengaraj, D., Seo, H., Lim, W., Song, G., Han, J."Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer". Oncology Letters 2.6 (2011): 1047-1051.
Chicago
Choi, J., Ahn, S. E., Rengaraj, D., Seo, H., Lim, W., Song, G., Han, J."Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer". Oncology Letters 2, no. 6 (2011): 1047-1051. https://doi.org/10.3892/ol.2011.391
Copy and paste a formatted citation
x
Spandidos Publications style
Choi J, Ahn SE, Rengaraj D, Seo H, Lim W, Song G and Han J: Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer. Oncol Lett 2: 1047-1051, 2011.
APA
Choi, J., Ahn, S.E., Rengaraj, D., Seo, H., Lim, W., Song, G., & Han, J. (2011). Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer. Oncology Letters, 2, 1047-1051. https://doi.org/10.3892/ol.2011.391
MLA
Choi, J., Ahn, S. E., Rengaraj, D., Seo, H., Lim, W., Song, G., Han, J."Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer". Oncology Letters 2.6 (2011): 1047-1051.
Chicago
Choi, J., Ahn, S. E., Rengaraj, D., Seo, H., Lim, W., Song, G., Han, J."Matrix metalloproteinase 3 is a stromal marker for chicken ovarian cancer". Oncology Letters 2, no. 6 (2011): 1047-1051. https://doi.org/10.3892/ol.2011.391
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team