Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
August-2015 Volume 10 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2015 Volume 10 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer

  • Authors:
    • Stefan Hartmann
    • Roman C. Brands
    • Nora Küchler
    • Andreas Fuchs
    • Christian Linz
    • Alexander C. Kübler
    • Urs D.A. Müller-Richter
  • View Affiliations / Copyright

    Affiliations: Department of Oral and Maxillofacial Plastic Surgery, University Hospital of Würzburg, Würzburg, Franconia D-97070, Germany
  • Pages: 1211-1217
    |
    Published online on: June 9, 2015
       https://doi.org/10.3892/ol.2015.3345
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Melanoma-associated antigen (MAGE) has been identified in a variety of types of cancer. The expression of several MAGE subgroups is correlated with poor prognosis and chemotherapeutic resistance. One target of chemotherapeutic treatment in head and neck cancer is the epidermal growth factor receptor (EGFR). The efficacy of tyrosine kinase inhibitors (TKI) in the context of melanoma-associated antigens is discussed in the present study. Five human squamous cell carcinoma cell lines were treated with the EGFR TKIs, erlotinib and gefitinib. The efficacy of these agents was measured using a crystal violet assay. Furthermore, the expression levels of MAGE-A1, -A5, -A8, -A9, -A11 and -A12 were determined by reverse transcription-quantitative polymerase chain reaction. The association between TKI efficacy and MAGE-A expression was analyzed by linear regression. The cell lines revealed inhomogeneous expression patterns for the MAGE-A subgroups. Four of the five cell lines demonstrated a good response to erlotinib and gefitinib. However, treatment with erlotinib induced better results than those of gefitinib, and revealed a concentration-dependent effect. The expression of MAGE-A5 and -A11 were significantly correlated with lower efficacy of erlotinib and gefitinib. By contrast, MAGE-A12 was associated with a superior response to these two drugs. One cell line, which expressed all investigated MAGE-A subgroups, was entirely resistant to the two TKIs. These results revealed a notable correlation between MAGE-A5 and -A11 and lower efficacy of EGFR TKIs. Pretreatment analysis of MAGE-A status may therefore aid improvement of chemoprevention using erlotinib and gefitinib in head and neck cancer.

Introduction

Over 20 years ago, the melanoma-associated antigens (MAGEs) were identified by van der Bruggen et al (1). MAGEs belong to the group of cancer/testis antigens (CTA), which includes multiple proteins, for example NY-ESO-1, sinovial sarcoma X and G antigen 1 (2). It is known that these proteins are found in adult male germ cells, fetal keratinocytes, the placenta and a variety of human malignancies, including head and neck cancer (3–6). At present, the large group of MAGE tumor antigens consists of ~60 proteins. Their specific expression in the majority of malignancies, coupled with their immunogenicity, makes these proteins promising targets for anticancer therapies (7). However, little is known about the function of MAGE-A tumor antigens. Studies by Doyle et al (8) and Yang et al (9) demonstrated the negative effect of MAGE expression on p53 levels. Notably, studies by Ries et al (10,11) provided clear evidence that MAGE-A expression serves as predictor of malignant transformation in oral leukoplakia. Furthermore, there is evidence that MAGE-A is expressed in dysplastic leukoplakia and carcinoma in situ, but not in oral lichen planus, oral ulcers or leukoplakia without dysplasia (12). Another study revealed that MAGE-A tumor antigens are the most frequently expressed CTAs in head and neck cancer (13). Notably, there is no correlation between MAGE-A expression and clinicopathological characteristics in head and neck cancer. Recently, Laban et al (14) published data indicating a marked correlation between poor prognosis in a subset of patients with head and neck cancer and the expression of MAGE-A antigens. In addition, a previous study by our group identified a correlation between MAGE-A5 and -A8 expression and poorer responses to anti-epidermal growth factor receptor (EGFR) therapy in vitro (15). Of note, MAGE-A11 expression is also correlated with poorer responses to cisplatin, 5-fluorouracil, docetaxel and paclitaxel (16).

In head and neck cancer, targeted therapy has an expanding role. This therapeutic approach is largely based on the EGFR and its associated pathways. Downstream signaling molecules of the EGFR, mediate the invasion, growth, progression and survival of tumor cells (17). The majority of head and neck cancer specimens demonstrate overexpression of the EGFR, and alterations in the copy number of this receptor are associated with poor prognosis (18). In general, EGFR-targeted therapies for head and neck cancer are performed with cetuximab, a chimeric antibody directed against the EGFR. Targeting the EGFR by tyrosine kinase inhibitors is another well-studied field of oncology, particularly in the case of EGFR-mutated non-small cell lung cancer (NSCLC), in which erlotinib and gefitinib serve as useful drugs that aid the improvement of progression-free survival and overall survival (19). Unfortunately, in an unselected cohort of head and neck cancer patients, erlotinib failed to improve progression-free survival when used in combination with cisplatin and radiotherapy (20). The role of erlotinib in head and neck cancer may be more efficacious in the field of chemoprevention. Using a combined approach of erlotinib and sulindac, data from Shin et al (21) demonstrated effective chemoprevention in preclinical and clinical models. These findings are discussed in a study recently published by Gross et al (22).

The present study therefore aimed to investigate whether the expression of MAGE-A tumor antigens was associated with poor efficacy of erlotinib and gefitinib.

Materials and methods

Cell lines

The cell lines used in the present study (Table I) were established at the Cancer Institute of the University of Pittsburgh (Pittsburgh, PA, USA) (23). As described previously (15,24), the cells were cultured in a humidified atmosphere of 5% CO2/95% air at 37°C and were fed 2–3 times per week with Dulbecco's Modified Eagle's Medium (DMEM; Life Technologies, GmbH, Darmstadt, Germany) with low glucose, 10% fetal calf serum (Life Technologies, GmbH), 1% penicillin/streptomycin (Life Technologies, GmbH) and 1% L-glutamine (Biochrom KG, Berlin, Germany).

Table I.

Name, origin and TNM status of the five cell lines used in the present study.

Table I.

Name, origin and TNM status of the five cell lines used in the present study.

Cell lineOriginPatient genderTNM
PCI-1Laryngeal carcinoma of the glottismalepT2N00M0G2
PCI-9Primary carcinoma at the base of the tonguemalepT4N3M0G2
PCI-13Oral squamous cell carcinoma of the retromolar trianglemalepT4pN1M0G3
PCI-52Primary carcinoma of the aryepiglottic foldmalepT2N0M0G2
PCI-68Primary tongue carcinomamalepT4N0M0G1
RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of MAGE-A

The protocol and quantification of MAGE-A expression by RT-qPCR was conducted as previously described by our group (15,16).

RNA isolation was executed using the NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's instructions. Isolated RNA was stored at −80°C prior to reverse transcription. Complementary (c)DNA was synthesized from identical quantities of total RNA (1 µg) with the M-MLV RT RNase H(–) point mutant using the buffer system provided (Promega Corp., Mannheim, Germany), according to the manufacturer's instructions.

MAGE-A expression profiles were quantitatively analyzed by RT-qPCR using the FastStart DNA Master Plus SYBR-Green I (Roche Diagnostics GmbH, Mannheim, Germany). Each reaction mixture (20 µl) was comprised of 0.5 µl cDNA, 1 µl forward primer (20 µM), 1 µl reverse primer (20 µM) (both from TIB MOLBIOL GmbH, Berlin, Germany), 4 µl LightCycler DNA Master SYBR-Green I, 1 µl dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO, USA) and 12.5 µl water. The cycling conditions for RT-qPCR in the LightCycler 2.0 (Roche Diagnostics, Mannheim, Germany) were as follows: Initial denaturation at 95°C for 10 min, followed by 45 cycles of amplification with denaturation at 95°C for 10 sec, primer annealing at 62–67°C for 3–4 sec and elongation at 68–72°C for 3–4 sec (specific temperature and elongation indicated in Table II). Following completion of this protocol, a melting range analysis was conducted. The protocol comprised one cycle at 95°C for 20 sec, followed by one cycle at 60°C for 20 sec with continuously measured fluorescence. The values measured were analyzed by the LightCycler Relative Quantification Software 1.0 (Roche Diagnostics GmbH), which provided efficiency-corrected, calibrator-normalized relative quantification results. The relative concentrations were normalized to β-actin messenger RNA levels.

Table II.

Sequences, base pair lengths, annealing temperatures and elongation times of the primers used.

Table II.

Sequences, base pair lengths, annealing temperatures and elongation times of the primers used.

GeneSequence, 5-3Base pairsAnnealing, °C/secElongation, °C/sec
β-actinF: CCAACCGCGAGAAGATGA9765/368/4
R: CCAGAGGCGTACAGGGATAG
MAGE-A1F: GGCCGAAGGAACCTGACC6967/372/4
R: GTCCTCTGGGTTGGCCTGT
MAGE-A5F: GCCCTAGAGGAGCACCAAAG8062/472/3
R: CGCAACAGGCAGGAGTGT
MAGE-A8F: AAAGGTTCGCAGAGAACAGG11965/372/3
R: GTCAGGGCAGCAGGAGAGT
MAGE-A9F: GGCCTTGGTCTGAGACAGTG9765/372/3
R: GTCCTCCTGGTTAGCCTGT
MAGE-A11F: ACAGGAGTCCCAGGAGAACC8167/372/4
R: CTGTGGGAAATATCTGGGTGA
MAGE-A12F: GTCGGTGGAGGGAAGCAG10465/372/3
R: AGGGCAGCAGGTAGGAGTG

[i] MAGE, melanoma-associated antigen; F, forward; R, reverse.

Drug treatment and crystal violet assay

Cells of each cell line were seeded at 10,000 cells/well, respectively. Erlotinib and gefitinib were purchased from Selleckchem (distributed by Absource Diagnostics GmbH, München, Germany) and stored according to the manufacturer's instructions. The concentrations used in the present study (4.94, 1.65, 0.55, 0.18 and 0.06 µM) were derived from a log 3 dilution starting at 400 µM (data not shown). The control cells were cultured in medium as described above (without TKIs). These concentrations were chosen based on the clinically relevant maximum serum concentration of the selected tyrosine kinase inhibitors (TKIs), of ~1 µM (25). Following 24 h of incubation in standard medium, erlotinib or gefitinib was added, and the cultures were incubated for a further 72 h. Crystal violet (1 g; Carl Roth GmbH, Karlruhe, Germany) was dissolved in 1 l double-distilled water containing 20% methanol. Following the removal of the drug-containing medium, 50 µl crystal violet was added to each well and incubated for 15 min. The 96-well plates were then washed with distilled water and the optical density (OD) was measured at 595 nm using a RainBow microplate reader (Tecan, Maennedorf, Swiss). All experiments were performed in triplicate. The mean was calculated from at least three independent experiments and used in further analyses.

Statistical analysis

The association between chemosensitivity and MAGE-A expression status was analyzed using a linear regression model. This model allows evaluation of the correlation between the viable fraction of the cell culture and the concentration of the drug, as well as the expression level of MAGE-A subgroups during drug treatment. However, since the linear regression model based on 6 MAGE-A subgroups is only able to include 4 possible variables, MAGE-A1 and -A9 were excluded by SPSS. P≤0.05 was considered to indicate a statistically significant difference. Statistical analysis of the data was performed using Microsoft Excel 2010 (Microsoft, Redmond, WA, USA) and SPSS Statistics 22 (IBM SPSS, Armonk, NY, USA) and was supported by the Department of Statistics, University of Würzburg. GraphPad Prism 6.04 (GraphPad Software Inc., La Jolla, CA, USA) was used to generate graphical illustrations.

Results

MAGE-A expression varies between squamous cell carcinoma cell lines

MAGE-A expression was detected in all five of the cell lines. The minimum number of expressed subgroups was two (in PCI-68). The lowest quantities of MAGE-A tumor antigens were also detected in PCI-68. In contrast to PCI-68, all MAGE-A tumor antigen subgroups examined were expressed by PCI-52. Furthermore, the highest expression of the subgroups -A1, -A9 and -A11 was also detected in PCI-52. The highest expression of MAGE-A5 was detected in PCI-9, while PCI-13 exhibited the highest levels of MAGE-A8, and the greatest expression of MAGE-A12 was identified in the PCI-1 cell line (Fig. 1).

Figure 1.

Effects of erlotinib and gefitinib on cell viability and MAGE-A subgroup expression profiles of head and neck squamous cell carcinoma cell lines. Fraction of viable cells compared with that of the control (100%) following 72 h of (A) erlotinib or (B) gefitinib treatment. With the exception of the PCI-52 cell line, all cell lines demonstrated a marked decrease in viable cells following drug treatment. Standard deviation is illustrated by error bars extending above and below the data points. (C) Cell-specific MAGE-A subgroup expression profile of each cell line, relative to β-actin expression. MAGE, melanoma-associated antigen.

Efficacy of erlotinib treatment varies between squamous cell carcinoma cell lines

Four of the five cell lines (PCI-1, PCI-9, PCI-13 and PCI-68) exhibited a concentration-dependent response to 72 h of erlotinib treatment (Fig. 1). At the minimum concentration of 0.06 µM, the fraction of viable cells ranged from 69.51 (PCI-1) to 91.71% (PCI-68), compared with that of the control. The intermediate concentration (0.55 µM) of erlotinib resulted in a viable fraction of 54.07% in the PCI-1 cell line, whereas this concentration resulted in a viable fraction of 83.93% in PCI-9 cells. The maximum concentration of erlotinib (4.94 µM) resulted in a viable fraction of 42.15% in PCI-1 cells, while in PCI-9 cells, this concentration resulted in a viable fraction of 74.90%. By contrast, the PCI-52 cell line demonstrated no concentration-dependent response to erlotinib. Erlotinib concentrations of 0.06, 0.18, 0.55 and 1.65 µM yielded no significant effect on viability (resulting in 102.78, 102.85, 101.14 and 102.60%, respectively). Only the highest concentration of 4.94 µM erlotinib resulted in a small decrease in viability compared with that of the control (94.03%).

Erlotinib treatment efficacy is affected by MAGE-A expression

A linear regression model was produced using erlotinib concentration and MAGE-A expression levels as independent variables (Table III), with the viable fraction compared with the control as the dependent variable. The model produced an r-value of 0.848, indicating a notable adaptation. MAGE-A1 and -A9 were excluded as independent variables. However, potential effects of MAGE-A1 and -A9 may be determined using a larger regression model with more cell lines. Negative values of the standardized coefficients represent an inhibitory effect on the fraction of viable cells. By contrast, positive values of the standardized coefficients indicate a beneficial effect on the fraction of viable cells. Increasing concentrations of erlotinib significantly decreased the viability of cells (P<0.001). MAGE-A12 was also associated with a decrease in the viable fraction during erlotinib treatment (P=0.009), while MAGE-A5 (P=0.015) and -A11 (P<0.001) were correlated with a higher fraction of viable cells following erlotinib treatment.

Table III.

Linear regression of erlotinib/MAGE-A subgroup following 72 h of treatment.

Table III.

Linear regression of erlotinib/MAGE-A subgroup following 72 h of treatment.

Independent variableStandardized coefficientP-value
MAGE-A5   0.299   0.015
MAGE-A8   0.168   0.274
MAGE-A11   0.574 <0.001
MAGE-A12−0.398   0.009
Erlotinib concentration−0.482 <0.001

[i] Bold text indicates statistically significant results. MAGE, melanoma-associated antigen.

Efficacy of gefitinib treatment varies between squamous cell carcinoma cell lines

Analogously with the results described for erlotinib treatment, four of the five cell lines (PCI-1, PCI-9, PCI-13 and PCI-68) exhibited a concentration-dependent response to 72 h of gefitinib treatment (Fig. 1). The minimum concentration of 0.06 µM resulted in cell viabilities of 57.56% in PCI-1, 81.57% in PCI-9, 69.77% in PCI-13 and 76.38% in PCI-68 cells, indicating a markedly greater efficacy of gefitinib than that of the lowest concentration of erlotinib. At the intermediate concentration (0.55 µM) of gefitinib, the fraction of viable cells ranged from 50.34% in PCI-1 cells to 80.87% in PCI-9 cells. Compared with the control, the maximum concentration of 4.94 µM gefitinib resulted in viable fractions of 48.87 and 75.51% in PCI-1 and PCI-9 cells, respectively. Notably, compared with the lowest concentration of erlotinib, gefitinib produced greater responses in the PCI-1, PCI-9, PCI-13 and PCI-68 cell lines. Conversely, erlotinib treatment at the intermediate and highest concentrations yielded better results than those of gefitinib. As previously observed following erlotinib treatment, PCI-52 did not demonstrate a concentration-dependent response to gefitinib treatment. Furthermore, even the highest concentration of gefitinib (4.94 µM) failed to reduce cell viability compared with that of the control (101.59%).

Gefitinib treatment efficacy is affected by MAGE-A expression

The linear regression model was constructed using the gefitinib concentration and MAGE-A expression levels as independent variables (Table IV), with the viable fraction compared with the control as the dependent variable. The model generated an r-value of 0.805. Analogously to the results obtained in the analysis of erlotinib, negative standardized coefficient values represented an inhibitory effect on the fraction of viable cells, while positive values indicated a beneficial effect on the fraction of viable cells. The increasing concentration of gefitinib significantly reduced the fraction of viable cells (P=0.046), demonstrating a concentration-dependent response of the cell lines to gefitinib treatment (Table IV). MAGE-A12 was also associated with a decreased number of viable cells following gefitinib treatment (P=0.027). Cell lines expressing MAGE-A11 demonstrated the lowest response to gefitinib treatment, as indicated by the large fraction of viable cells (P<0.001). MAGE-A5 expression was also correlated with a significantly poorer efficacy of gefitinib treatment (P=0.028), while MAGE-A8 expression did not significantly alter the fraction of viable cells (P=0.364). MAGE-A1 and -A9 were again excluded as independent variables.

Table IV.

Linear regression of gefitinib/MAGE-A subgroup following 72 h of treatment.

Table IV.

Linear regression of gefitinib/MAGE-A subgroup following 72 h of treatment.

Independent variableStandardized coefficientP-value
MAGE-A5   0.300   0.028
MAGE-A8   0.156   0.364
MAGE-A11   0.661 <0.001
MAGE-A12−0.371   0.027
Gefitinib concentration−0.255   0.046

[i] Bold text indicates statistically significant results. MAGE, melanoma-associated antigen.

Discussion

Due to the high rate of recurrence and a poor overall survival rate of ~50%, the treatment of head and neck squamous cell carcinoma (HNSCC) remains challenging. Therefore, improvements to patient selection in terms of non-surgical treatment approaches may help to enhance clinical outcomes. One technique for the identification of high-risk patients may be via the evaluation of MAGE-A expression status. There is an increasing understanding that the expression of certain CTAs, including MAGE-A, is associated with markedly poorer survival amongst patients with head and neck cancer (14). The present study revealed inhomogeneous expression of MAGE-A1, -A5, -A8, -A9, -A11 and -A12 in the HNSCC cell lines tested. Furthermore, treatment with erlotinib and gefitinib at clinically relevant concentrations yielded differential response rates in the various HNSCC cell lines. While four of the five cell lines (PCI-1, PCI-9, PCI-13 and PCI-68) exhibited concentration-dependent responses to erlotinib and gefitinib, TKI treatment of PCI-52 cells was completely ineffective. The PCI-1 and PCI-52 cell lines were comparable in terms of their TNM status; however, PCI-52 was the only cell line to express all of the MAGE-A subgroups investigated, while PCI-1 expressed three out of the six subgroups. Notably, the PCI-1 cell line was the most responsive to erlotinib and gefitinib treatment, whereas PCI-52 was entirely resistant to these two agents. These results highlight an urgent need for the identification of additional molecular markers, including MAGE-A tumor antigens.

The linear regression models of erlotinib and gefitinib revealed marked adaptation (r-values, 0.848 and 0.805, respectively) and significant effects of agent concentration on the fraction of viable cells, providing evidence for a useful experimental setup. Correlation analysis of MAGE-A subgroups and erlotinib treatment revealed MAGE-A5 and -A11 as significant negative predictors of treatment success. Of note, MAGE-A11 was previously shown to act as a proto-oncogene in prostate cancer by serving as a transcriptional activator of the androgen receptor (26). By contrast, MAGE-A12 was associated with an improved outcome of erlotinib administration. In a previous study by our group, MAGE-A5 and -A8 were reported as negative predictors of anti-EGFR therapy using panitumumab (15). In agreement with a recent study by our group, MAGE-A12 was correlated with a greater response to panitumumab (15). Mollaoglu et al (27) previously described MAGE-A12 as a predictor of improved prognosis in oral squamous cell carcinoma. As described by their group, N0 cervical lymph node status was found more frequently in MAGE-A12-positive patients than that of the MAGE-negative controls. Furthermore, MAGA-A11 was reported to have a negative impact on treatment with cisplatin, 5-fluorouracil, paclitaxel and docetaxel (16). In the same study, MAGE-A5 was demonstrated to be associated with improved outcomes following paclitaxel therapy. Statistical analysis revealed that treatment with gefitnib or erlotinib were comparable in the context of MAGE-A expression. MAGE-A5 and -A11 were correlated with poorer outcomes of gefitinib therapy. Similarly to the effects observed following erlotinib treatment, improved outcomes of gefitinib treatment were associated with MAGE-A12 expression. A potential reason for the negative influence of MAGE-A11 on EGFR-directed therapies may be due to its association with the expression of other transmembrane receptors. Recently, Hou et al (28) demonstrated a significant correlation between MAGE-A9 and -A11 expression and Her2/neu expression in breast cancer. There is a broad consensus that evasion of EGFR-targeted therapy is facilitated by the activation of alternative receptors, including Her2/neu, as well as their downstream signaling pathways (29,30). Even if TKI treatment combined with cisplatin and radiotherapy failed to improve progression-free survival in unselected cohorts, erlotinib and gefitinib may function as chemopreventive drugs (31). One significant consideration in the treatment of patients with head and neck cancer is the phenomenon of field cancerization (32). Therefore, the possibility of reducing the incidence of malignant transformation to dysplastic oral mucosa may be a valuable tool, based on the findings regarding the chemoproventative properties of TKIs (31,32). MAGE-A subgroup analysis may help to identify high-risk patients, thus aiding the development of personalized therapies and follow-up.

Acknowledgements

The present study was funded by the Interdisciplinary Center for Clinical Research of the University of Würzburg (grant no. Z-3/13). The manuscript was spell-checked by the American Journal Experts (Durham, NC, USA).

References

1 

van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, Van den Eynde BJ, Knuth A and Boon T: A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. J Immunol. 178:2617–2621. 2007.PubMed/NCBI

2 

Old LJ and Chen YT: New paths in human cancer serology. J Exp Med. 187:1163–1167. 1998. View Article : Google Scholar : PubMed/NCBI

3 

Kienstra MA, Neel HB, Strome SE and Roche P: Identification of NY-ESO-1, MAGE-1, and MAGE-3 in head and neck squamous cell carcinoma. Head Neck. 25:457–463. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Müller-Richter UD, Dowejko A, Zhou W, Reichert TE and Driemel O: Different expression of MAGE-A-antigens in foetal and adult keratinocyte cell lines. Oral Oncol. 44:628–633. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Scanlan MJ, Simpson AJ and Old LJ: The cancer/testis genes: Review, standardization, and commentary. Cancer Immun. 4:12004.PubMed/NCBI

6 

Simpson AJ, Caballero OL, Jungbluth A, Chen YT and Old LJ: Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer. 5:615–625. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Ferris RL: Progress in head and neck cancer immunotherapy: Can tolerance and immune suppression be reversed? ORL J Otorhinolaryngol Relat Spec. 66:332–340. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Doyle JM, Gao J, Wang J, Yang M and Potts PR: MAGE-RING protein complexes comprise a family of E3 ubiquitin ligases. Mol Cell. 39:963–974. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Yang B, O'Herrin SM, Wu J, Reagan-Shaw S, Ma Y, Bhat KM, Gravekamp C, Setaluri V, Peters N, Hoffmann FM, et al: MAGE-A, mMage-b, and MAGE-C proteins form complexes with KAP1 and suppress p53-dependent apoptosis in MAGE-positive cell lines. Cancer Res. 67:9954–9962. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Ries J, Agaimy A, Vairaktaris E, Gorecki P, Neukam FW, Strassburg LH and Nkenke E: Detection of MAGE-A expression predicts malignant transformation of oral leukoplakia. Cancer Invest. 30:495–502. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Ries J, Agaimy A, Vairaktaris E, Kwon Y, Neukam FW, Strassburg LH and Nkenke E: Evaluation of MAGE-A expression and grade of dysplasia for predicting malignant progression of oral leukoplakia. Int J Oncol. 41:1085–1093. 2012.PubMed/NCBI

12 

Krauss E, Rauthe S, Gattenlöhner S, Reuther T, Kochel M, Kriegebaum U, Kübler AC and Müller-Richter UD: MAGE-A antigens in lesions of the oral mucosa. Clin Oral Investig. 15:315–320. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Piotti KC, Scognamiglio T, Chiu R and Chen YT: Expression of cancer/testis (CT) antigens in squamous cell carcinoma of the head and neck: Evaluation as markers of squamous dysplasia. Pathol Res Pract. 209:721–726. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Laban S, Atanackovic D, Luetkens T, Knecht R, Busch CJ, Freytag M, Spagnoli G, Ritter G, Hoffmann TK, Knuth A, et al: Simultaneous cytoplasmic and nuclear protein expression of melanoma antigen-A family and NY-ESO-1 cancer-testis antigens represents an independent marker for poor survival in head and neck cancer. Int J Cancer. 135:1142–1152. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Hartmann S, Kriegebaum U, Küchler N, Lessner G, Brands RC, Linz C, Schneider T, Kübler AC and Müller-Richter UD: Efficacy of cetuximab and panitumumab in oral squamous cell carcinoma cell lines: Prognostic value of MAGE-A subgroups for treatment success. J Craniomaxillofac Surg. 41:623–629. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Hartmann S, Kriegebaum U, Küchler N, Brands RC, Linz C, Kübler AC and Müller-Richter UD: Correlation of MAGE-A tumor antigens and the efficacy of various chemotherapeutic agents in head and neck carcinoma cells. Clin Oral Investig. 18:189–197. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Yarden Y and Shilo BZ: SnapShot: EGFR signaling pathway. Cell. 131:10182007. View Article : Google Scholar : PubMed/NCBI

18 

Temam S, Kawaguchi H, El-Naggar AK, Jelinek J, Tang H, Liu DD, Lang W, Issa JP, Lee JJ and Mao L: Epidermal growth factor receptor copy number alterations correlate with poor clinical outcome in patients with head and neck squamous cancer. J Clin Oncol. 25:2164–2170. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Asami K and Atagi S: Epidermal growth factor receptor tyrosine kinase inhibitors for non-small cell lung cancer. World J Clin Oncol. 5:646–659. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Martins RG, Parvathaneni U, Bauman JE, Sharma AK, Raez LE, Papagikos MA, Yunus F, Kurland BF, Eaton KD, Liao JJ, et al: Cisplatin and radiotherapy with or without erlotinib in locally advanced squamous cell carcinoma of the head and neck: A randomized phase II trial. J Clin Oncol. 31:1415–1421. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Shin DM, Zhang H, Saba NF, Chen AY, Nannapaneni S, Amin AR, Müller S, Lewis M, Sica G, Kono S, et al: Chemoprevention of head and neck cancer by simultaneous blocking of epidermal growth factor receptor and cyclooxygenase-2 signaling pathways: Preclinical and clinical studies. Clin Cancer Res. 19:1244–1256. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Gross ND, Bauman JE, Gooding WE, Denq W, Thomas SM, Wang L, Chiosea S, Hood BL, Flint MS, Sun M, et al: Erlotinib, erlotinib-sulindac versus placebo: A randomized, double-blind, placebo-controlled window trial in operable head and neck cancer. Clin Cancer Res. 20:3289–3298. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Heo DS, Snyderman C, Gollin SM, Pan S, Walker E, Deka R, Barnes EL, Johnson JT, Herberman RB and Whiteside TL: Biology, cytogenetics, and sensitivity to immunological effector cells of new head and neck squamous cell carcinoma lines. Cancer Res. 49:5167–5175. 1989.PubMed/NCBI

24 

Hartmann S, Seher A, Brands RC, Linz C, Lessner G, Böhm H, Kübler AC and Müller-Richter UD: Influence of epidermal growth factor receptor expression on the cetuximab and panitumumab response rates of head and neck carcinoma cells. J Craniomaxillofac Surg. 42:1322–1328. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Mukohara T, Engelman JA, Hanna NH, Yeap BY, Kobayashi S, Lindeman N, Halmos B, Pearlberg J, Tsuchihashi Z, Cantley LC, et al: Differential effects of gefitinib and cetuximab on non-small-cell lung cancers bearing epidermal growth factor receptor mutations. J Natl Cancer Inst. 97:1185–1194. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Su S, Minges JT, Grossman G, Blackwelder AJ, Mohler JL and Wilson EM: Proto-oncogene activity of melanoma antigen-A11 (MAGE-A11) regulates retinoblastoma-related p107 and E2F1 proteins. J Biol Chem. 288:24809–24824. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Mollaoglu N, Vairaktaris E, Nkenke E, Neukam FW and Ries J: Expression of MAGE-A12 in oral squamous cell carcinoma. Dis Markers. 24:27–32. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Hou SY, Sang MX, Geng CZ, Liu WH, Lü WH, Xu YY and Shan BE: Expressions of MAGE-A9 and MAGE-A11 in breast cancer and their expression mechanism. Arch Med Res. 45:44–51. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Quesnelle KM and Grandis JR: Dual kinase inhibition of EGFR and HER2 overcomes resistance to cetuximab in a novel in vivo model of acquired cetuximab resistance. Clin Cancer Res. 17:5935–5944. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Yonesaka K, Zejnullahu K, Okamoto I, Satoh T, Cappuzzo F, Souglakos J, Ercan D, Rogers A, Roncalli M, Takeda M, et al: Activation of ERBB2 signaling causes resistance to the EGFR-directed therapeutic antibody cetuximab. Sci Transl Med. 3:99ra862011. View Article : Google Scholar : PubMed/NCBI

31 

Rosenthal EL, Chung TK, Carroll WR, Clemons L, Desmond R and Nabell L: Assessment of erlotinib as adjuvant chemoprevention in high-risk head and neck cancer patients. Ann Surg Oncol. 21:4263–4269. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Jaiswal G, Jaiswal S, Kumar R and Sharma A: Field cancerization: Concept and clinical implications in head and neck squamous cell carcinoma. J Exp Ther Oncol. 10:209–214. 2013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hartmann S, Brands RC, Küchler N, Fuchs A, Linz C, Kübler AC and Müller-Richter UD: Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer. Oncol Lett 10: 1211-1217, 2015.
APA
Hartmann, S., Brands, R.C., Küchler, N., Fuchs, A., Linz, C., Kübler, A.C., & Müller-Richter, U.D. (2015). Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer. Oncology Letters, 10, 1211-1217. https://doi.org/10.3892/ol.2015.3345
MLA
Hartmann, S., Brands, R. C., Küchler, N., Fuchs, A., Linz, C., Kübler, A. C., Müller-Richter, U. D."Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer". Oncology Letters 10.2 (2015): 1211-1217.
Chicago
Hartmann, S., Brands, R. C., Küchler, N., Fuchs, A., Linz, C., Kübler, A. C., Müller-Richter, U. D."Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer". Oncology Letters 10, no. 2 (2015): 1211-1217. https://doi.org/10.3892/ol.2015.3345
Copy and paste a formatted citation
x
Spandidos Publications style
Hartmann S, Brands RC, Küchler N, Fuchs A, Linz C, Kübler AC and Müller-Richter UD: Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer. Oncol Lett 10: 1211-1217, 2015.
APA
Hartmann, S., Brands, R.C., Küchler, N., Fuchs, A., Linz, C., Kübler, A.C., & Müller-Richter, U.D. (2015). Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer. Oncology Letters, 10, 1211-1217. https://doi.org/10.3892/ol.2015.3345
MLA
Hartmann, S., Brands, R. C., Küchler, N., Fuchs, A., Linz, C., Kübler, A. C., Müller-Richter, U. D."Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer". Oncology Letters 10.2 (2015): 1211-1217.
Chicago
Hartmann, S., Brands, R. C., Küchler, N., Fuchs, A., Linz, C., Kübler, A. C., Müller-Richter, U. D."Melanoma-associated antigen expression and the efficacy of tyrosine kinase inhibitors in head and neck cancer". Oncology Letters 10, no. 2 (2015): 1211-1217. https://doi.org/10.3892/ol.2015.3345
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team